Sep 26, 2025
Zebrafish enhancer reporter assay
- Seppe De Winter1,
- Valérie ercier1,
- Katina Spanier1
- 1Lab of Computational Biology
Protocol Citation: Seppe De Winter, Valérie ercier, Katina Spanier 2025. Zebrafish enhancer reporter assay. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2pk2jg1y/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 27, 2025
Last Modified: September 26, 2025
Protocol Integer ID: 219043
Keywords: zebrafish enhancer reporter, zebrafish embryo, zebrafish microinjection, enhancer reporter cloning, including enhancer reporter cloning, enhancer reporter, describing enhancer reporter
Abstract
Protocol describing enhancer reporter assay in zebrafish embryos. Including enhancer reporter cloning, zebrafish microinjection and imaging.
Order suitable enhancer reporter plasmid
Considerations:
- This protocol makes use of Tol2-transposase system to integrate the enhancer-reporter construct in the zebrafish's genome: make sure that the vector has Tol2 sites.
- It is useful to have a control for successful injection/integration events. For this purpose a vector containing a constitutive reporter that is cell type-specific and that drives another fluorescent protein as the enhancer reporter can be used.
- Promoter of the enhancer reporter should not be too strong. The amount of expression from the enhancer-reporter gene should be minimal when the enhancer is not active (or not present in the vector).
Example plasmid: Addgene 194518
‱ This plasmid can be used for Tol2 based integration
‱ This plasmid drives constitutive mCherry expression in the zebrafish's eye.
‱ This plasmid uses the ZSP promoter, which shows minimal activity without an enhancer.
‱ The enhancer drives EGFP expression.
Order enhancers
Order enhancer sequences with either constant flanking sequences or sequences that are homologous to the target plasmid. In the first case an extra step of PCR has to be performed in order to introduce the homologous sequences at the enhancer flanks. The homologous sequences should be designed in such a way that the enhancer will be cloned in the vicinity of the minimal promoter and the reporter gene. If the target plasmid is linearised using restriction digestion (as is described here), the restriction target sites should also be taken into account.
5’ TTAGGGATAACAGGGTAATCGCGAATTGGGTACCGGGC 3’
5’ CTTTCAACAAGCCCGAAAGATCTTCTGGAAGCCTCCAGTGAATT 3’
Later, resulting in the following integration:
5' ... TTAGGGATAACAGGGTAATCGCGAATTGGGTACCGGGC [ENHANCER] AATTCACTGGAGGCTTC CAGAAGATCTTTCGGGCTTGTTGAAAG ... [ZSP] [EGFP] ... 3'
Optional: PCR amplify enhancer to introduce homologous sequence
Design and order suitable primers. For example, if the enhancers have the following constant flanking sequences:
5' ATATACCCTCTAGAGTCGAA 3'
5' GATTACCCTGTTATCCCTAA 3'
Following primers can be used:
5' ttagggataacagggtaatcATATACCCTCTAGAGTCGAA 3'
5' ctttcaacaagcccgaaagatcTTAGGGATAACAGGGTAATC 3'
Where the non-capitalised nucleotides are homologous to the plasmid
Prepare PCR reaction
- Forward primer:300 nanomolar (nM)
- Reverse primer:300 nanomolar (nM)
- Template: 0.1 ng/ul
- KAPA HiFI HotStart ReadyMix 1x
Perform PCR
1 cycle
- 3 minutes 95C
20 cycles
- 20 seconds 98C
- 15 seconds 65C
- 15 seconds 72C
1 cycle
- 2 minutes 72 C
Clone enhancers in reporter plasmid
3h 35m
Linearise plasmid using PCR or restriction digest.
BglII and XhoI
Create reaction mix:
- rCutSmart buffer (1x)
- 7 µg plasmid
- 10 U BglII
- 20 U XhoI
- Add H2O to total volume of 20 µL
Incubate 02:00:00 at 37 °C
2h
Perform NEBuilder reaction with linearised plasmid and enhancer fragments
Create reaction mix:
- Linearised plasmid and insert at an 1:2 ratio
Use following formula
- 1x enzyme mix
Incubate at 50 °C for 00:45:00
45m
thaw Stellar chemically competent bacteria on ice for 00:15:00
15m
Add 2.5 µL of reaction mix to 20 µL of bacteria
Keep 00:30:00 on ice
30m
45 second heat shock at 42 °C
Keep 00:05:00 on ice
5m
Plate on on Carbenicillin plates and incubate at 37 °C Overnight
Pick single colonies and incubate Overnight in 10 mL LB medium with Carbenicillin at 37 °C
Sequence plasmid prep using Sanger sequencing
5'-CGACTCACTATAGGGCGAATTGGG-3'
Tol2 Transposase mRNA synthesis
2h 35m
Order suitable plasmid for in vitro Tol2 Transposase expression (see Kwan et al., https://doi.org/10.1002/dvdy.21343). For example, pCS2FA
Linearize plasmid. pCS2FA can be linearized using NotI-HF.
Prepare reaction mix:
- rCutSmart Buffer (1x)
- 5 µg plasmid
- 20 U NotI-HF
- Add H2O to total volume of 50 µL
Incubate Overnight at 37 °C
Heat inactivate restriction enzyme at 65 °C fo 00:20:00
20m
Purify linearized plasmid using PureLink PCR cleanup kit (Invitrogen)
In vitro transcription of capped Tol2 mRNA with mMESSAGE mMACHINE‱ SP6 Transcription Kit (Invitrogen)
Create reaction mix:
- SP6 reaction buffer (1x)
- NTP/CAP (1x)
- 1 µg linearized plasmid
- 2 µL SP6 RNA Polymerase Enzyme Mix
- Add H2O to a total volume of 20 µL
Incubate 02:00:00 at37 °C
2h
Remove template DNA by adding 1 µL of TURBO DNase, mix and incubate 00:15:00 at 37 °C
15m
Purify Tol2 Transposase mRNA using ssDNA/RNA Clean & Concentrator Kit (Zymo research)
Collect zebrafish embryo's and inject enhancer construct
30m
Prepare Danieau's embryo medium (100x)
- NaCl 1.74 Molarity (M)
- KCl 21 millimolar (mM)
- MgSO4.7H2O 12 millimolar (mM)
- Ca(NO3)2.4H2O 18 millimolar (mM)
- HEPES 150 millimolar (mM)
Bring to 7.6
Prepare agar plates
Boil 2 Mass Percent agarose (Ultra Pure Invitrogen) in 50 mL Danieau's medium (1x)
Pour solution in 10cm petri dish
Place template plate (containing 6 slated rows; World Precision Instruments) on top of the agar (it will float) for 00:30:00
30m
Remove template plate and cover with Danieau's medium (1x) to prevent drying, store at 4 °C
Fabricate micropipettes by heading and pulling 11 mm borosilicate tubes (World Precision Instruments) using micropipette puller (Sutter-brown).
Prepare injection mix containing plasmid DNA (30 µg/µL ) and Tol2 mRNA (40 ng/ul )
Prepare for injection
Turn on the Pneumatic microinjector system (PicoPump, World Precision Instruments, SUS-PV820) and set the injection pressure to 10-20 PSI and hold pressure to 0.2-0.5 PSI to prevent backflow
Backfill the needle with injection mix, using capillary action.
Check injection volume (2-4nl) by injecting a droplet in mineral oil on a micrometer slide. Based on droplet volume, adjust needle size (by breaking the tip) or adjust injection duration.
Collect 1 cell stage embryos and inject
Breeding is trigged by the light / dark cycle (zebrafish mate in the first few hours of each light cycle). Use breeding tanks with slotted bottoms to separate adults from the eggs.
Collect the embryos at the 1-cell stage and place them in Danieau's embryo medium (1x) with methylene blue on agar plate.
Use plastic pipettes to transfer the eggs to and from the injection plate
Arrange the eggs in the injection plate slits, with the cell pointing to the side
Remove Danieau's medium such that it's just covering the top of the agar (this prevents the eggs from floating)
Carefully push the needle through the chorion and position it into the cell at the one-cell stage. Press the pedal to delivery a droplet of working solution to the cell and remove the needle.
repeat for each egg
Transfer the eggs (carefully) to petridish containing Danieau's medium (1x)
Place petridish with eggs in incubator at 28.5 °C and raise for desired amount of time
Imaging
Select zebrafish with successful injection based on constitutive enhancer control (mCherry fluorescence in the eye in case of Addgene 194518) using widefield fluorescence microscope
Anesthetize fish using tricaine (0.02 Mass Percent )
Mount fish on fluorodish (FD3510-100. world precision instruments) in low melting agarose (1 Mass Percent )
Image fish on fluorescence microscope