Sep 26, 2025

Public workspaceZebrafish enhancer reporter assay

DOI
https://dx.doi.org/10.17504/protocols.io.4r3l2pk2jg1y/v1
  • Seppe De Winter1,
  • Valérie ercier1,
  • Katina Spanier1
  • 1Lab of Computational Biology
Seppe De Winter
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.4r3l2pk2jg1y/v1
Protocol Citation: Seppe De Winter, Valérie ercier, Katina Spanier 2025. Zebrafish enhancer reporter assay. protocols.io https://dx.doi.org/10.17504/protocols.io.4r3l2pk2jg1y/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 28, 2025
Last Modified: September 26, 2025
Protocol Integer ID: 219043
Keywords: zebrafish enhancer reporter, zebrafish embryo, zebrafish microinjection, enhancer reporter cloning, including enhancer reporter cloning, enhancer reporter, describing enhancer reporter
Abstract
Protocol describing enhancer reporter assay in zebrafish embryos. Including enhancer reporter cloning, zebrafish microinjection and imaging.
Troubleshooting
Order suitable enhancer reporter plasmid
Considerations:
  • This protocol makes use of Tol2-transposase system to integrate the enhancer-reporter construct in the zebrafish's genome: make sure that the vector has Tol2 sites.
  • It is useful to have a control for successful injection/integration events. For this purpose a vector containing a constitutive reporter that is cell type-specific and that drives another fluorescent protein as the enhancer reporter can be used.
  • Promoter of the enhancer reporter should not be too strong. The amount of expression from the enhancer-reporter gene should be minimal when the enhancer is not active (or not present in the vector).

Example plasmid: Addgene 194518
‱ This plasmid can be used for Tol2 based integration
‱ This plasmid drives constitutive mCherry expression in the zebrafish's eye.
‱ This plasmid uses the ZSP promoter, which shows minimal activity without an enhancer.
‱ The enhancer drives EGFP expression.
Order enhancers
Order enhancer sequences with either constant flanking sequences or sequences that are homologous to the target plasmid. In the first case an extra step of PCR has to be performed in order to introduce the homologous sequences at the enhancer flanks. The homologous sequences should be designed in such a way that the enhancer will be cloned in the vicinity of the minimal promoter and the reporter gene. If the target plasmid is linearised using restriction digestion (as is described here), the restriction target sites should also be taken into account.

For example, for Addgene 194518 following sequences can be used:

5’ TTAGGGATAACAGGGTAATCGCGAATTGGGTACCGGGC 3’
5’ CTTTCAACAAGCCCGAAAGATCTTCTGGAAGCCTCCAGTGAATT 3’

Later, resulting in the following integration:

5' ... TTAGGGATAACAGGGTAATCGCGAATTGGGTACCGGGC [ENHANCER] AATTCACTGGAGGCTTC CAGAAGATCTTTCGGGCTTGTTGAAAG ... [ZSP] [EGFP] ... 3'

Optional: PCR amplify enhancer to introduce homologous sequence
Design and order suitable primers. For example, if the enhancers have the following constant flanking sequences:


5' ATATACCCTCTAGAGTCGAA 3'
5' GATTACCCTGTTATCCCTAA 3'

Following primers can be used:


5' ttagggataacagggtaatcATATACCCTCTAGAGTCGAA 3'
5' ctttcaacaagcccgaaagatcTTAGGGATAACAGGGTAATC 3'

Where the non-capitalised nucleotides are homologous to the plasmid

Prepare PCR reaction

  • Forward primer:Concentration300 nanomolar (nM)
  • Reverse primer:Concentration300 nanomolar (nM)
  • Template: Concentration0.1 ng/ul
  • KAPA HiFI HotStart ReadyMix 1x

Perform PCR

1 cycle
  • 3 minutes 95C

20 cycles
  • 20 seconds 98C
  • 15 seconds 65C
  • 15 seconds 72C

1 cycle
  • 2 minutes 72 C

PCR clean up

Follow: PCR clean up protocol (e.g., NucleoSpin Gel and PCR Clean-up)
Clone enhancers in reporter plasmid
3h 35m
Linearise plasmid using PCR or restriction digest.

For Addgene 194518 and the adaptor sequences mentioned above linearisation can be performed using:


BglII and XhoI

Create reaction mix:
  • rCutSmart buffer (1x)
  • Amount7 µg plasmid
  • Amount10 U BglII
  • Amount20 U XhoI
  • Add H2O to total volume of Amount20 µL

Incubate Duration02:00:00 at Temperature37 °C

2h
Clean up

Follow: PCR clean up protocol (e.g., NucleoSpin Gel and PCR Clean-up)
Perform NEBuilder reaction with linearised plasmid and enhancer fragments
Create reaction mix:
  • Linearised plasmid and insert at an 1:2 ratio
Use following formula
  • 1x enzyme mix

Incubate at Temperature50 °C for Duration00:45:00


45m
thaw Stellar chemically competent bacteria on ice for Duration00:15:00

15m
Add Amount2.5 µL of reaction mix to Amount20 µL of bacteria

Keep Duration00:30:00 on ice

30m
45 second heat shock at Temperature42 °C

Keep Duration00:05:00 on ice

5m
Plate on on Carbenicillin plates and incubate at Temperature37 °C DurationOvernight

Pick single colonies and incubate DurationOvernight in Amount10 mL LB medium with Carbenicillin at Temperature37 °C

Isolate plasmids using QIAprep Spin Miniprep kit and elute twice for a total of Amount50 µL

Sequence plasmid prep using Sanger sequencing

For the plasmid Addgene 194518, the following primer can be used:


5'-CGACTCACTATAGGGCGAATTGGG-3'


Tol2 Transposase mRNA synthesis
2h 35m
Order suitable plasmid for in vitro Tol2 Transposase expression (see Kwan et al.,  https://doi.org/10.1002/dvdy.21343). For example, pCS2FA
Linearize plasmid. pCS2FA can be linearized using NotI-HF.


Prepare reaction mix:
  • rCutSmart Buffer (1x)
  • Amount5 µg plasmid
  • Amount20 U NotI-HF
  • Add H2O to total volume of Amount50 µL

Incubate DurationOvernight at Temperature37 °C

Heat inactivate restriction enzyme at Temperature65 °C fo Duration00:20:00

20m
Purify linearized plasmid using PureLink PCR cleanup kit (Invitrogen)
In vitro transcription of capped Tol2 mRNA with mMESSAGE mMACHINE‱ SP6 Transcription Kit (Invitrogen)
Create reaction mix:
  • SP6 reaction buffer (1x)
  • NTP/CAP (1x)
  • Amount1 µg linearized plasmid
  • Amount2 µL SP6 RNA Polymerase Enzyme Mix
  • Add H2O to a total volume of Amount20 µL

Incubate Duration02:00:00 atTemperature37 °C

2h
Remove template DNA by adding Amount1 µL of TURBO DNase, mix and incubate Duration00:15:00 at Temperature37 °C

15m
Purify Tol2 Transposase mRNA using ssDNA/RNA Clean & Concentrator Kit (Zymo research)
Collect zebrafish embryo's and inject enhancer construct
30m
Prepare Danieau's embryo medium (100x)
  • NaCl Concentration1.74 Molarity (M)
  • KCl Concentration21 millimolar (mM)
  • MgSO4.7H2O Concentration12 millimolar (mM)
  • Ca(NO3)2.4H2O Concentration18 millimolar (mM)
  • HEPES Concentration150 millimolar (mM)

Bring to Ph7.6
Prepare agar plates
Boil Concentration2 Mass Percent agarose (Ultra Pure Invitrogen) in Amount50 mL Danieau's medium (1x)

Pour solution in 10cm petri dish
Place template plate (containing 6 slated rows; World Precision Instruments) on top of the agar (it will float) for Duration00:30:00

30m
Remove template plate and cover with Danieau's medium (1x) to prevent drying, store at Temperature4 °C


Fabricate micropipettes by heading and pulling 11 mm borosilicate tubes (World Precision Instruments) using micropipette puller (Sutter-brown).
Prepare injection mix containing plasmid DNA (Concentration30 µg/µL ) and Tol2 mRNA (Concentration40 ng/ul )
Prepare for injection
Turn on the Pneumatic microinjector system (PicoPump, World Precision Instruments, SUS-PV820) and set the injection pressure to 10-20 PSI and hold pressure to 0.2-0.5 PSI to prevent backflow
Backfill the needle with injection mix, using capillary action.
Check injection volume (2-4nl) by injecting a droplet in mineral oil on a micrometer slide. Based on droplet volume, adjust needle size (by breaking the tip) or adjust injection duration.
Collect 1 cell stage embryos and inject
Breeding is trigged by the light / dark cycle (zebrafish mate in the first few hours of each light cycle). Use breeding tanks with slotted bottoms to separate adults from the eggs.
Collect the embryos at the 1-cell stage and place them in Danieau's embryo medium (1x) with methylene blue on agar plate.
Use plastic pipettes to transfer the eggs to and from the injection plate
Arrange the eggs in the injection plate slits, with the cell pointing to the side
Remove Danieau's medium such that it's just covering the top of the agar (this prevents the eggs from floating)
Carefully push the needle through the chorion and position it into the cell at the one-cell stage. Press the pedal to delivery a droplet of working solution to the cell and remove the needle.
Go to repeat for each egg

Transfer the eggs (carefully) to petridish containing Danieau's medium (1x)
Place petridish with eggs in incubator at Temperature28.5 °C and raise for desired amount of time

Imaging
Select zebrafish with successful injection based on constitutive enhancer control (mCherry fluorescence in the eye in case of Addgene 194518) using widefield fluorescence microscope
Anesthetize fish using tricaine (Concentration0.02 Mass Percent )
Mount fish on fluorodish (FD3510-100. world precision instruments) in low melting agarose (Concentration1 Mass Percent )
Image fish on fluorescence microscope