Dec 26, 2018
yeast single cell RNA-seq (yscRNA-seq)
- Mariona Nadal-Ribelles1,
- Saiful Islam2,
- Wu Wei2,
- Pablo Latorre3,
- Michelle Nguyen2,
- Eulàlia de Nadal3,
- Francesc Posas3,
- Lars M. Steinmetz4
- 1IRB Barcelona;
- 2Stanford Universtity, Stanford Genome Technology Center;
- 3IRB Barcelona, Universtat Pompeu Fabra;
- 4Stanford Universtity, Stanford Genome Technology Center, EMBL
- Yeast Protocols, Tools, and Tips
Protocol Citation: Mariona Nadal-Ribelles, Saiful Islam, Wu Wei, Pablo Latorre, Michelle Nguyen, Eulàlia de Nadal, Francesc Posas, Lars M. Steinmetz 2018. yeast single cell RNA-seq (yscRNA-seq). protocols.io https://dx.doi.org/10.17504/protocols.io.t29eqh6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 27, 2018
Last Modified: December 26, 2018
Protocol Integer ID: 16193
Keywords: yeast single cell RNA-seq (yscRNA-seq), transcriptomics
Guidelines
**Please follow all precautions that usually you need to follow RNA and single-cell work. Clean the area prior to starting the protocol. Use dedicated reagents only to single cell work (and label them appropriately). Use pipettes and filter tips throughout the entire protocol**
Cell growth
Cell growth
Grow the desired pre-inoculum of your desired yeast strain in their corresponding media O/N.
To profile exponentially growing cells, we recommend the initial culture not to grow over OD660=1
Next morning. Dilute your cells to OD660= 0.05 in the corresponding media and allow for at least 2 cell divisions prior to sorting.
Single cell isolation by FACS sorting
Single cell isolation by FACS sorting
Prepare 96/384 well plates* containing 5 µL Absolute Ethanol ** in each to fix cells immediately from sorting
* During protocol optimization we recommend using break-away plates
** this is the minimum volume required for our sorting facility/plates. Check with your facility
Note: We have obtained the same results sorting cells directly into 5 ul of cell capturing solution and lysis (see below). If doing so, prepare plates right before sorting and keep them on4 °C ice
Dilute cells prior to sorting to OD=0.05 in 3 mL of media and vortex vigurosuly to separate cell clumps.
* At this step propidium idodide (PI) can be added to check for cell viability
At the FACS facility, filter cells with Cell Strainer Tubes (check with your facility which tubes they prefer) and put cells in the appropiate sorting tube for live single cell sorting.
Check the alignment of the plate with the sorter. For example, this can be done by sorting a drop into a covered plate and look for the droplet would fall inside each well.
Sort live single yeast into the each well of the plates and leave one well (we ususally do H12 as empty/not sorted) asnegativecontrol.
* Should you want to do a positive control, sort 100 cells into one well (we usually do A1).
Cover plates with aluminim seal if plates will not be processed right away or with temporary plastic lid.
Quickly spin plates to collect cells at the bottom
Let EtOH avaporate in a sterile environment (stril hood) for 00:45:00 maximum
Once EtOH is completely evaporated, add 5 µL yeast cell lysis solutuin of cell capturing solution and lysis. Spin down and freeze immediately.
Regardless if cells are sorted into EtOH or cell capturing and lysis solution, frozen plates can be stored at -80ºC for at least 6 months.
Cell lysis solution:
| Reagents | Reference | Volume (1 rxn) | |
| 1% Triton X-100 | X100-1L | 0.05 | |
| UMI_Oligo dT_T31(100 mM) | IDT | 0.2 | |
| dNTP 25 mM | R0181 | 0.68 | |
| 100 mM DTT | 18064014 | 0.5 | |
| Zymolyase 100T (100 mg/ml) | 37340-57-1 | 0.6 | |
| RNase Inhibitor (40 U/ml) | 2313A | 0.12 | |
| RNase-Nuclease free H2O | 10977035 | 2.769 | |
| ERCC (1:1000,0000) (5000 molecules) | 4456740 | 0.081 | |
| Total | 5 |
Lysis reaction
Lysis reaction
Do the follwoing lysis cycle from fresh sorted or frozen plates and quickly proceed to add RT reaction for 1st strand cDNA synthesis
Incubate at 30ºC for at least 10 minutes *
00:10:00
3 minutes at 72ºC
00:03:00
1 minutes at 4C
* We have changed the length of cell lysis up to 30 minutes
1st strand cDNA synthesis
1st strand cDNA synthesis
Spin down the plate and perform the following cycles
42ºC for 90 mins
70ºC for 15 mins
4ºC forever
01:45:00
Library amplification
Library amplification
Add 15 µL PCR mix for library amplification
| Reagents | Volume (1 rxn) | |
| 10X Advantage 2 PCR buffer | 2.5 | |
| dNTPs (25mm) | 0.4 | |
| UMI_PCR (10uM) | 1.2 | |
| 50X Advantage 2 polymerase mix | 0.5 | |
| H20 | 10.4 | |
| Total | 15 |
Spin down the plate and do the following cycles
hold at 4ºC overnight (if necessary). This is usually a safe stopping point
qPCR validation
qPCR validation
Perform a 1:20 dilution of the amplified library to check the percentage of positive libraries.
Use your favorite protocol, and use as a target primers to a housekeeping gene or ERCCs.
This step is specially useful during the protocol set up as it allows to isnpect the efficiency of the protocol before moving forward.
| Reagent | Volume (μl) | |
| Sybergreen 2X | 2.5 | |
| Primer mix* | 0.125 | |
| H2O | 1.375 | |
| DNA | 1 |
* Primer mix is a mmix of Fw and Rv primer (10µM each)1 cycle: 95ºC 10 min
40 cycles: 95ºC 30 sec, 58ºC 30 sec and 72ºC 30 sec
1 cycle: 95ºC 15 sec, 60ºC 15 sec and 95ºC 15 sec (melting curve)
Primer sequence for qPCR:
SOMN17 Fw_TDH3_probe TCGTCAAGTTGGTCTCCTGG
SOMN18 Rv_TDH3_probe GGCAACGTGTTCAACCAAGT SOMN21 Fw_ADH1_probe TGGTGCCAAGTGTTGTTCTG
SOMN22 Rv_ADH1_probe GGCGAAGAAGTCCAAAGCTT
SOMN310 Fw_5_ERCC_00130 CGGAAAAGTACTGACCAGCG
SOMN311 Rv_5_ERCC_00130 TGCCAATGACTTCAGCTGAC
A good plate will have around 70% positive wells, as far as it’s around 50% it should be OK. Rearrange positive cells into a new plate to proceed to tagmentation.
dscDNA library clean up
dscDNA library clean up
Before commencing the purification steps, equilibrate Ampure XP beads at room temperature for 15 min, and then vortex well for several seconds.
Add 15 µL Ampure XP beads (1:0.6 ratio) to each sample (each tube might have slightly different volumes due to evaporation).
*Do not increase the volume of beads in the purification step above the 1:1 ratio. A less-than-standard amount of beads ensures that primer dimer carryover is kept to a minimum.
Mix by pipetting up and down ten times or until the solution appears homogeneous. Transfer solutions to a 96-well plate with compatible magnet stand
Incubate the mixture for 10 min at room temperature to let the DNA bind to the beads.
00:10:00
Place the 96-well plate on the magnetic stand for 5 min or until the solution is clear and the beads have been collected
00:05:00
While samples are on the magnet, carefully remove the liquid without disturbing the beads.
Wash the beads with 200 l of 80% (vol/vol) ethanol solution. Incubate the samples for 30 sec and then remove the ethanol.
*It is important that the ethanol solution is freshly prepared every time, as ethanol absorbs moisture from the environment, thus changing the final concentration. Repeat ethanol washing.
Repeat ethanol washing one more time.
Remove any trace of ethanol and let the beads dry completely, leaving the plate at room temperature for 5 min or until a small crack appears on the surface of the beads.
*Avoid over drying the beads because this will make their resuspension in the designated buffer more difficult.
** As a precaution, cover the plate during this step or protect it from any possible source of contamination or air flows that might disperse the beads around the well, thus leading to cross-contamination between adjacent wells especially.
Remove plate from the magnet and mix vigurously by pipetting up and down x3 times to resuspend beads out of the magnet
Place the plate on the magnetic stand and leave it for 2 min or until the solution appears clear and beads have accumulated in a corner of the well.
00:02:00
Recover 15 ml of SPN from each well and transfer to a new plate. Label correctly as this plate will be stored.
SAFE STOPPING POINT: cDNA llibraries can be stored at -20ºC before proceeding to tagmentation.
dscDNA library/concentration size validation
dscDNA library/concentration size validation
Run 1 µL of several purified dscDNA libraries to check the size distribution and estimate of concentrations using a High Sensitivity DNA ChIP (2100 Bioanalyzer). qPCR validation using a housekeeping gene is valuable to guide well selection. Always run your negative control.
Expected result
Adaptor annealing for tagmentation
Adaptor annealing for tagmentation
In order to load Tn5 with cell-specific adaptors, these need to be annealed as dsDNA cell-specific adaptors.
To anneal the adapters mix in a 96 well plate:
Mix UMI-TN5-U (100 µM) and UMI-TN5_1 (µM) to 96 in TE 1X to final concentration 50 µM (each), a 1:1 dilution.
Primer annealing thermocycler: 95ºC for 3 minutes and gradually cool down to room temperature (0,5 ºC/sec).
This plate can be stored at -20ºC for several months and used to lead several rounds of Tn5.
Tn5 loading with cell-specific adaptors
Tn5 loading with cell-specific adaptors
Prepare the following mix and aliquot ,
Prepare the following mix and aliquot 8.75 µL of the mix (except for adapters) into a new 96 well plate. Then add 1.25 µL of each adaptor to each well.
| Reagent | Volume | Observations | |
| 50 µM adapter (96 different) | 1.25 µL | add this later individually to each well | |
| 80% Glycerol | 6.25 µL | ||
| 50 µM Tn5 transposase | 1.25 µL | Hennig, Bianca P., et al. "Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol." G3: Genes, Genomes, Genetics (2017): g3-300257. | |
| Nuclease-free water | 1.25 µL | ||
| Total volume | 10 µL |
Incubate 37°C for one hour and freeze -20 °C if not going to be used right away.
01:00:00
* Note, this Tn5-loaded plate can be safely stored for a 1-2 weeks at -20 °C . However leaving the loaded plate on ice 4 °C will significantly reduce Tn5 activity and will result in inefficient tagmentation.
Tagmentation
Tagmentation
Prepare the following mix
| Reagent | Volume (per well) | |
| Harvested DNA | 6 µL | |
| Nuclease-free water | 8 µL | |
| 2x TAPS buffer | 2 µL | |
| 100% DMF | 2 µL | |
| 10x Transposome | 2.0 µL | |
| Total volume | 20 µL |
Incubate for 55ºC for 5 min -> 3 min 85ºC to inactivate Tn5 and then cool to 4 °C
00:05:00
* The tagmentation time can vary depending on the Tn5 purification batch.
5' capture through Streaptavidin beads
5' capture through Streaptavidin beads
Do a 1:20 dilution of MyOne Streptavidin for the total number of samples (1 µL of beads/sample) .
(Example: 20 µL beads for 20 samples)
2XBWT Buffer:
10 mM Tris-HCl pH7.5
1mM EDTA
2M NaCl
0.02% Tween-20
Wash MyOne beads x2 with 2XBWT buffer and resupsend with 20X more volume than the original volume of beads with 2XBWT
(Example: 20 µL beads for 20 samples, will be finally resuspended with 400 µL 2XBWT
Add 20 µL beads to each well and incubate at RT for 5 min at room temprature
00:05:00
Pool all samples into a single collecting tube (1.5 or 2 ml)
Place collecting tube in magnetic rack and allow time enough for the solution to be completely clear
Wash beads once with TNT buffer 100 µL
TNT Buffer:
20 mM Tris pH 7.5
50 mM NaCl,
0.02% Tween
Wash the beads once in Qiaquick PB 100 µL discard SPN
Wash beads 3x with TNT buffer 100 µL again, discard SPN
Removing 3' end fragments
Removing 3' end fragments
Resuspend the beads in the following mix:
| Reagent | Volume | |
| CutSmart buffer | 10 µL | |
| PvuI-HF enzyme (20 U/µL) | 2 µL | |
| Nuclease-free water | 88 µL | |
| Total volume | 100 µL |
Incubate at 37°C for one hour with interval mix during the incubation (to avoid beads precipitation); 2 min without mix, 30 sec 1000 rpm mix.
01:00:00
Wash the beads three times in TNT. 100 µL
Eluting single stranded cDNA library
Eluting single stranded cDNA library
Resuspend in 30 µL Nuclease-free water.
30 µL
Incubate 10 min at 70°C, 850 rpm mix.
00:10:00
Bind the beads to the magnet immediately and collect the supernatant.
sscDNA cleanup
sscDNA cleanup
Add 54µl of room temperature Ampure XP beads to 30µ sscDNA library
54 µL Ampure XP beads
Incubate 10 min at RT.00:10:00
Bind the beads to the magnet for 1min and discard supernatant or until solution is completely clear.
00:01:00
Wash once with 200 µL fresh 80% ethanol for 20-30 sec. Let the beads be bound to the magnet the entire time.
Dry the beads for up to 2 min.
00:02:00
Resuspend in 30 µL Qiagen EB buffer and incubate 5 min at RT.
00:05:00 30 µL EB
Bind the beads 1 min and transfer SPN to a new tube.
Library Concentration
Library Concentration
To quantify library concentration, set up a KAPA quantification reaction with a 1:100 and 1:1000 dilutions of the eluted cDNA library.
| Reagent | Volume (1 rxn) | |
| KAPA SYBR® FAST qPCR Master Mix containing Primer Premix | 12 µl | |
| PCR-grade water | 4 µ | |
| Diluted library DNA or DNA Standard | 4 µl | |
| TOTAL | 20 µl |
This kit can be subsituted by your favorite quantification method or by a qPCR using P5-P7 primer pairs with known standards (PhiX is strongly recommended) sybergreen 2X mastermix.
qPCR cycling conditions for KAPA and homemade Sybergreen
| Temperature | Time | ||
| 95ºC | 5 min | ||
| 95ºC | 30 sec | repeat this for 30 cycles for qPCR quantification | |
| 60ºC | 45 sec | ||
| 4ºC | hold |
Use the qPCR to calculate library quantification using the template provided by KAPA biosystems or the instructions provided from your manufacturer.
We have used KAPA, NEB and homemade systems with similar results.
Library Size
Library Size
Sett up a separate PCR to run a bioanalyzer to determine the final size distribution. Prepare the following mix:
| KAPA SYBR Q-PCR Mastermix ABI Prism | 10 µL | |
| Primers mix (10 X) | 2 ml | |
| Water | 6 µL | |
| DNA without dilution | 2 µl | |
| Total volume | 20 µl |
Run the same PCR as in step 58 but for 11 cycles
Run 1 µL into a High sensitivity DNA CHIP to obtain an average library size based on the Bioanalyzer profile.
Expected result
Sequencing
Sequencing
Sequence the library on the HiSeq 2000 High output using C1-P1-PCR-2 as the Read 1 primer and UMI-TN5-U as the Index read primer.
To run the libraries on the HiSeq rapid run, us LNA primers. Spike in at primer at 0.5 uM.
Index 1 primer into HP8 (position 17) in the HiSeq
Read 1 primer into HP9 (position 16) in the Hiseq
(double check this information with your sequencing kit/instrument)
UMI_PCR_read1: +GAATGA+TACGGCG+ACCA +CCGA+T - custom 250 nmole. DNA oligo, HPLC Purification
Index1: CTGT+CT+CTT+ATA+CA +CA+TCTGA+CG+C - custom 250 nmole DNA oligo, HPLC Purification
*Note for High Output run custom primers are needed as well but without LNA
Load around 8-14 pmol of each library per lane. Libraries are single stranded DNA, so no denaturing is required.