May 02, 2024
  • 1Teagasc, Crops Research, Oak Park, Carlow R93XE12
Icon indicating open access to content
QR code linking to this content
Protocol CitationStephen Byrne, Virgile Ballandras, Louise McNamara 2024. YDV Multiplex PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvok5obl4o/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 12, 2024
Last Modified: May 02, 2024
Protocol  Integer ID: 98140
Keywords: yellow dwarf viruses, BYDV, CYDV, Multiplex PCR, barley yellow dwarf virus, yellow dwarf virus, primer for cydv, barley sample, multiplex pcr assay, ydv multiplex pcr, bydv primer, frontiers in microbiology, ydv multiplex pcr this protocol, single aphid, diversity of cereal, electrophoresi, aphid, nucleic acid, microbiology, barley, throughput sequencing, cydv, pcr, capillary electrophoresi, pav, internal control for both aphid
Funders Acknowledgements:
Teagasc
Grant ID: RapID-Pest (1365)
Euphresco network for phytosanitary research coordination and funding
Grant ID: 2021-A-374
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This protocol describes the process of carrying out a multiplex PCR assay followed by capillary electrophoresis to detect C/BYDV and determine species (BYDV-MAV, BYDV-PAS, BYDV-PAV, CYDV (RPS or RPV)). The starting point for this is cDNA that has been synthesized from nucleic acid extracted from single aphids or leaf material - an internal control targeting GAPDH is included and primers can be selected depending on the sample matrix (aphid or barley). The BYDV primers were taken from:
 
Sõmera, M., Massart, S., Tamisier, L., Sooväli, P., Sathees, K. and Kvarnheden, A., 2021. A survey using high-throughput sequencing suggests that the diversity of cereal and barley yellow dwarf viruses is underestimated. Frontiers in Microbiology12, p.673218.
 
In-house sequence data was used to modify primers where necessary, add a primer for CYDV and an internal control for both aphid and barley samples. The CYDV primers captures both RPS and RPV (high resolution melt analysis may be required to distinguish these if required).
Materials

Equipment
MiniAmp Plus Thermal Cycler
NAME
Applied Biosystems
BRAND
A37835
SKU

Equipment
5200 Fragment Analyzer System
NAME
Capillary Electrophoresis
TYPE
Agilent Technologies
BRAND
M5310AA
SKU
Nuclease-free waterMerck MilliporeSigma (Sigma-Aldrich) 2X QIAGEN Multiplex PCR Master MixQiagenCatalog #206143 dsDNA reagent kit (1-500 bp)Agilent TechnologiesCatalog #DNF-905

Protocol materials
2X QIAGEN Multiplex PCR Master MixQiagenCatalog #206143
dsDNA reagent kit (1-500 bp)Agilent TechnologiesCatalog #DNF-905
Nuclease-free waterMerck MilliporeSigma (Sigma-Aldrich)
Safety warnings
Please read SDS associated with various consumables and kits used in this protocol and wear appropriate PPE. A site specific procedural risk assessment should be carried out prior to introducing this protocol to the lab.
Before start
This protocol assumes that you have already isolated Total RNA from plant or insect material, and converted to cDNA using random hexamers. The protocol uses capillary electrophoresis for separation of PCR products; however it is also possible to separate and visualise using a high quality agarose gel electrophoresis method.
PCR protocol
2h 45m
Identify samples for analysis, including positive (virus infected aphid/barley) and negative controls (virus free aphid/barley), a positive control consisting of a mix of gBlocks with sequences for all targets in the multiplex PCR, and a no-template control. Details on the gBlocks can be found here: Download gBlocks-ordered-YDV-MULTIPLEX.txtgBlocks-ordered-YDV-MULTIPLEX.txt2.6KB

Prepare the primer mix for the multiplex PCR (YDVmixHV when sample matrix is barley, or YDVmixSA when sample matrix is an aphid) using primers according to tables below. The primer mixes are prepared with each primer in the working solution at 10 micromolar (µM) .

YDVmixHV:

AB
Primer NamePrimer Sequence
RpvFCTCGTGGGCTATCGCTATGG
CydvRTCATGGCGGAGCTCATGCAG
GAPDH-HV-FGGAGTCCACCGGTGTTTTCA
GAPDH-HV-RAGACAAACATGGGAGCGTCC
GavFGTTACAAGATCACAAACGTCAAG
PasFGAAGAGGGCCAAATTCTATACC
PavFCTTCACAATCAGCAGGAC
YanR24TGTTGAGGRGTCTACCTATTTG
YDVmixSA:

AB
Primer NamePrimer Sequence
RpvFCTCGTGGGCTATCGCTATGG
CydvRTCATGGCGGAGCTCATGCAG
GAPDH-SA-FGGCGAAGTTTCTGTTGATGG
GAPDH-SA-RCAGCACCAGCAGATCCCC
GavFGTTACAAGATCACAAACGTCAAG
PasFGAAGAGGGCCAAATTCTATACC
PavFCTTCACAATCAGCAGGAC
YanR24TGTTGAGGRGTCTACCTATTTG
Prepare a master-mix for the number of samples to be run so that each well will contain:

12.5 µL of 2X QIAGEN Multiplex PCR Master MixQiagenCatalog #206143
10.5 µL of molecular grade nuclease-free water
1 µL of working solution of appropriate primer mix prepared in step 2 above

Note: use of the QIAGEN Multiplex PCR Master Mix (or equivalent) is recommended - in the case of insect/plant/crop co-infection, each target is amplified with similar efficiencies (in contrast to other polymerase options). Using different enzymes will likely require some optimisation.


Pipette 1 µL of cDNA (or control) into each well of a PCR plate and keep on ice.

Pipette 24 µL of master-mix from step 3 into each well, seal the plate carefully with foil lid, and centrifuge the PCR plate briefly to ensure no droplets adhere to sides of sample wells.

Place the PCR plate in a
Equipment
MiniAmp Plus Thermal Cycler
NAME
Applied Biosystems
BRAND
A37835
SKU
and run the following PCR cycle:

  • 95 °C 00:05:00

followed by 40 cycles of

  • 95 °C 00:00:30
  • 60 °C 00:01:30
  • 72 °C 00:00:30

and a final elongation step of

  • 68 °C 00:10:00

2h 30m
Capillary Electrophoresis
2h
Bring all reagents from dsDNA reagent kit (1-500 bp; DNF-905) to room temperature by removing from the fridge and freezer at least 00:30:00 prior to setting up a run.

30m
Set up a run on the 5200 Fragment Analyser by adding 1 mL of 1X Inlet Buffer into row A of the 1.2 ml deep 96-well plate (to make 12 mL fresh add 2.4 mL of 5X Inlet buffer to 9.6 mL of molecular grade water. Inlet buffer should be changed daily. Into the same plate place 1 mL of Capillary Storage solution into row H (note: the storage buffer only needs to be changed on a weekly basis). This plate needs to go into drawer "B" of the instrument.

Add 30 µL of ready to use marker (1 and 500 bp) to row A of a compatible 96-well PCR plate and add a drop of miner oil (provided in kit) to each well and place plate into drawer "M" of the instrument. The marker is good for 30+ injections or 1 month.

Prepare sufficient 1X conditioning solution for the number of samples you are going to run (e.g. 45 mL is sufficient for a single plate) and connect to correct fluid line.

Prepare sufficient gel for the number of samples you are going to run (e.g. 4.5 µL added to 45 mL of separation gel is sufficient for a single plate) and connect to correct fluid line.

The samples are prepared by adding 2 µL of PCR product to 22 µL of 1X TE (provided) in the well of a compatible PCR plate. Vortex the plate and centrifuge briefly to collect contents at bottom of the wells.

Update the solution levels on instrument and commence a run using method appropriate for the DNF-905-dsDNA (1 to 500 bp) kit.

An example of results from running PCR products from an amplification with YDVmixSA primer mix and various control template mixes (gBlocks) - all have internal GAPDH control, and then different combinations of BYDV-PAS, BYDV-MAV, BYDV-PAV, CYDV.

Protocol references
Sõmera, M., Massart, S., Tamisier, L., Sooväli, P., Sathees, K. and Kvarnheden, A., 2021. A survey using high-throughput sequencing suggests that the diversity of cereal and barley yellow dwarf viruses is underestimated. Frontiers in Microbiology12, p.673218.