Jun 10, 2025

Workflow to shed light on gram-negative bacteria transcriptomes by using direct cDNA Oxford Nanopore sequencing: from sample to data collections

  • 1Univ. Lille;
  • 2CNRS;
  • 3Inserm;
  • 4CHU Lille;
  • 5Institut Pasteur de Lille;
  • 6U1019 - UMR 9017 - CIIL - Center for Infection and Immunity of Lille, F-59000 Lille, France
Icon indicating open access to content
QR code linking to this content
Protocol CitationBrandon Robin, Sebastien Bontemps-Gallo 2025. Workflow to shed light on gram-negative bacteria transcriptomes by using direct cDNA Oxford Nanopore sequencing: from sample to data collections . protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5rkw5g1b/v1
Manuscript citation:
Robin, B., Baillez, A., Le Guillouzer, S., Lecoeur, C., Sebbane, F., & Bontemps-Gallo, S. (2025). Exploring temperature-dependent transcriptomic adaptations in Yersinia pestis using direct cDNA sequencing by Oxford Nanopore Technologies. Scientific Report. DOI : 10.1038/s41598-025-05662-1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 28, 2024
Last Modified: June 10, 2025
Protocol  Integer ID: 106553
Keywords: RNA-Seq, Yersinia pestis, temperature adaptation, Oxford Nanopore Technology, bacterial transcriptomic, negative bacteria transcriptome, effective method for bacterial transcriptomic, new insights into bacterial transcriptional adaptation, oxford nanopore minion sequencer, bacterial transcriptional adaptation, detailed workflow for whole transcriptome rna, using direct cdna oxford nanopore, direct cdna oxford nanopore, whole transcriptome, whole transcriptome rna, other pathogen, pathogen, other pathogens of public health importance, regulated gene, rna, latest ont r10 chemistry, gene expression, temperature, gene, leveraging direct cdna, nanopore sequencing, nanopore, bacteria
Funders Acknowledgements:
French National Research Agency - ANR
Grant ID: ANR-21-CE15-0047 RESISTANT
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
We developed a detailed workflow for whole transcriptome RNA-Seq analysis using the Oxford Nanopore MinION sequencer to profile the pathogen’s gene expression under conditions mimicking its infection cycle. By leveraging direct cDNA sequencing with the latest ONT R10 chemistry, we identified temperature-regulated genes, revealing new insights into bacterial transcriptional adaptations. Our workflow provides a reproducible and cost-effective method for bacterial transcriptomics, contributing to the study of temperature-dependent regulatory mechanisms in Y. pestis and other pathogens of public health importance.
Protocol materials
Maxima H Minus First Strand cDNA Synthesis KitThermo FisherCatalog #K1652
RNaseOUT RNase InhibitorInvitrogen - Thermo FisherCatalog #10-777-019
RNAse CocktailThermo Fisher ScientificCatalog #AM2286
sparQ PureMag BeadsQuantabioCatalog #95196-060
DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Q5 High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0492S
ONT Native barcoding sequencing kit v14 (24)Oxford Nanopore TechnologiesCatalog #SQk-NBD114.24
Blunt/TA Ligase Master Mix - 50 rxnsNew England BiolabsCatalog #M0367S
Nanopore Flow Cell R10.4.1Oxford Nanopore TechnologiesCatalog #FLO-MIN114
RNAprotect Bacteria ReagentQiagenCatalog #76506
Trizma® hydrochlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #T3253
EDTA (0.5 M) pH 8.0 RNase-freeThermo Fisher ScientificCatalog #AM9261
Lysozyme from chicken egg whiteMerck MilliporeSigma (Sigma-Aldrich)Catalog #L7651-1G
MICROBExpress™ Bacterial mRNA Enrichment KitThermo Fisher ScientificCatalog #AM1905
Qubit RNA BR Assay KitThermo Fisher ScientificCatalog #Q10211
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512
Bioanalyzer RNA 6000 Nano KitAgilent TechnologiesCatalog #5067
E.coli Poly (A) Polymerase - 500 unitsNew England BiolabsCatalog #M0276L
Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
Bioanalyzer High Sensitivity DNA KitAgilent TechnologiesCatalog #5067-4626
NEBNext Ultra II End Repair/dA-Tailing Module - 96 rxnsNew England BiolabsCatalog #E7546L
NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S
NucleoSpin RNAMacherey-NagelCatalog #740955
Invitrogen™ BSA (50 mg/ml) UltraPure™ Fisher ScientificCatalog #AM2616

Note
For all reagents used in this complete workflow, we recommend following the supplier recommendations in terms of storage, thawing and mixing.

1 - Sample collection
20m
All bacterial culture volumes were stabilized by 2 volumes of RNAprotect Bacteria Reagent.

RNAprotect Bacteria ReagentQiagenCatalog #76506

Calculate the required RNAprotect Bacteria Reagent volume (2 volumes for 1 bacterial culture volume) and pipet it into a tube.

Note
Here, we harvested 5 mL of exponential growth phase culture in 10 mL of RNAprotect Bacteria Reagent.

Add 1 volume of bacterial culture to the tube. Mix immediately by vortexing for 00:00:05 .
Incubate for 00:05:00 at Room temperature 15-25°C .

5000 x g, Room temperature, 00:10:00 .
Discard the supernatant. Remove residual supernatant by gently dabbing the inverted tube once onto a paper towel.
2 - Bacterial lysis and RNA extraction
3h
Prepare TE buffer (30 millimolar (mM) Tris , 1 millimolar (mM) EDTA , 8 ) containing 15 mg/mL Lysozyme .

Trizma® hydrochlorideMerck MilliporeSigma (Sigma-Aldrich)Catalog #T3253
EDTA (0.5 M) pH 8.0 RNase-freeThermo Fisher ScientificCatalog #AM9261
Lysozyme from chicken egg whiteMerck MilliporeSigma (Sigma-Aldrich)Catalog #L7651-1G
Add 100 µL TE buffer containing lysozyme on the pellet.
Resuspend the pellet and vortex 00:00:10 each 00:02:00 during 00:10:00 atRoom temperature .
Add 350 µL RA1 lysis buffer containing 3.5 µL β-mercaptoethanol and vortex vigorously.

NucleoSpin RNAMacherey-NagelCatalog #740955

Reduce viscosity and clear the lysate by filtration through NucleoSpin Filter (violet ring) in a collection tube centrifuging 11000 x g, Room temperature, 00:01:00 .
Discard the NucleoSpin Filter and add 350 µL Ethanol 70% to the homogenized lysate and mix by pipetting up and down (5 times).
Pipet lysate up and down 2–3 times and load the lysate to the NucleoSpin RNA Column (light blue ring) placed in a collection tube.
11000 x g, Room temperature, 00:00:30 and place the column in a new Collection Tube (2 mL).
Add 350 µL MDB (Membrane Desalting Buffer) and 11000 x g, Room temperature, 00:01:00 . Discard flow through and place the column back into the collection tube.
Prepare DNase reaction mixture in a sterile 1.5 mL microcentrifuge tube: For each isolation, add 10 μL reconstituted rDNase to 90 μL Reaction Buffer for rDNase. Mix by flicking the tube.

Apply 95 µL DNase reaction mixture directly onto the center of the silica membrane of the column.
Incubate 00:15:00 at Room temperature .
Add 200 µL Buffer RAW2 and 11000 x g, Room temperature, 00:00:30 .
Place the column into a new Collection Tube (2 mL).

Add 600 µL Buffer RA3 and 11000 x g, Room temperature, 00:00:30 .
Discard flow through and place the column back into the collection tube.
Add 250 µL Buffer RA3 and 11000 x g, Room temperature, 00:00:30 .
Discard flow through and place the column back into the collection tube.
11000 x g, Room temperature, 00:02:00 to dry the membrane completely.
Place the column into a 1.5 mL nuclease-free collection tube provided with the kit.
Place the 1.5 mL nuclease-free collection tube and the column with the cap opened at 50 °C for 00:02:00 to dry the membrane completely.

Elute the RNA in 40 µL RNase-free H2O (prewarmed at 50 °C ) and incubate at 50 °C for 00:02:00 .
11000 x g, Room temperature, 00:01:00 .
Recover and deposit the eluate onto the center of the silica membrane of the column for a second elution and 11000 x g, Room temperature, 00:01:00 .

Aliquot 3 µL eluate to evaluate the quantity and quality of total RNA and store total RNA at -80 °C .

  • Analyze 1 µL to evaluate the RNA concentration of total RNA .

Qubit RNA BR Assay KitThermo Fisher ScientificCatalog #Q10211
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512
Equipment
Qubit 4
NAME
Fluorometer
TYPE
Invitrogen
BRAND
Q33238
SKU
LINK
  • Analyze 1 µL to evaluate the 260/280 and 260/230 ratios.
Equipment
NanoDrop™ 2000
NAME
Microvolume Spectrophotometer
TYPE
Thermo Scientific™
BRAND
ND-2000
SKU
LINK
  • Analyze 1 µL to evaluate the RNA integrity number (RIN).

Bioanalyzer RNA 6000 Nano KitAgilent TechnologiesCatalog #5067
Equipment
Bioanalyzer
NAME
Bioanalyzer
TYPE
Agilent
BRAND
G2991AA
SKU
LINK
Any bioanalyzer will suffice.
SPECIFICATIONS


Expected result
Quantification obtained with the Qubit 4 Fluorometer: 0.2-0.7 µg/µL
Ratios obtained with the Nanodrop: 260/280 >1.7, ideally 2.0
260/230 2.0-2.2
RIN obtained with the Bioanalyzer: >7
The RIN is calculated with the 16S and 23S rRNA peaks. The area under the 23S rRNA peak is around twice as important as the 16S one.

3 - mRNA enrichment
6h
MICROBExpress™ Bacterial mRNA Enrichment KitThermo Fisher ScientificCatalog #AM1905

MICROBExpress is designed to rapidly enrich bacterial mRNA from purified total RNA by removing the 16S and 23S ribosomal RNAs. MICROBExpress is designed so that small RNAs (including tRNA and 5S rRNA) remain in the enriched mRNA population if they were present in the total RNA treated in the procedure.
Pipet 200 µL Binding Buffer into a 1.5 mL tube provided with the kit.

Add total RNA (2-10 µg in a maximum volume of 15 μL) to the Binding Buffer and vortex gently to mix.

Note
For the proof of concept, we used the maximal quantity supported by the kit, 10 µg

Add 4 µL Capture Oligo Mix to the total RNA in the Binding Buffer.
Vortex gently to mix, and microfuge briefly to get the mixture to the bottom of the tube.

Heat denaturate RNA to 70 °C for 00:10:00

Anneal at 37 °C for 00:15:00 minimum to 01:00:00 maximum (it will result in only a very modest increase in rRNA removal).

During annealing incubation, prepare the Oligo MagBeads.
Withdraw 50 µL Oligo MagBeads per sample to a 1.5 mL tube (max 500 µL per tube, i.e. max for 10 samples per tube).

Note
Record the volume of Oligo MagBeads withdrawn.

Capture the Oligo MagBeads by placing the tube on a magnetic stand. Leave the tube on the stand until all of the Oligo MagBeads are arranged inside the tube near the magnet.

Note
This will take 3 min or more depending the magnet stand used.

Leaving the tube on the magnet stand, carefully remove the supernatant by aspiration and discard the supernatant.
Wash the Oligo MagBeads with an equal volume of Nuclease-free H2O than the recorded volume in step 32.1 by brief and gentle vortexing.
Leaving the tube on the magnet stand, carefully remove the supernatant by aspiration and discard the supernatant.
Equilibrate the Oligo MagBeads with an equal volume of Binding Buffer (recorded volume in step 32.1) by brief and gentle vortexing.
Leaving the tube on the magnet stand, carefully remove the supernatant by aspiration and discard the supernatant.
Resuspend the Oligo MagBeads in an equal volume of Binding Buffer (recorded volume in step 31.1) by gently tapping the tube.
Prewarm the Oligo MagBead slurry at 37 °C as well as the Wash Solution before proceeding.
Add 50 µL prewarmed prepared Oligo MagBeads to the RNA/Capture Oligo Mix (incubated at step 32).
Incubate at 37 °C for 00:15:00 .
Capture the Oligo MagBeads by placing the tube on the magnet stand.
Carefully aspirate the supernatant to avoid dislodging the Oligo MagBeads.
Transfer it to a Collection Tube On ice
Add 100 µL prewarmed Wash Solution to the captured Oligo MagBeads. Resuspend the beads by brief and gentle vortexing.
Recapture the Oligo MagBeads on the magnet stand and carefully recover the supernatant.
Pool this supernatant with the RNA already in the Collection Tube On ice .
Add 35 µL 3 M Sodium Acetate , 7 µL 5 mg/mL Glycogen ,1200 µL 100% Ethanol to the Collection Tube.
Precipitate at least at-20 °C Overnight .


Note
Prepare 70% Ethanol and store at -20 °C for the following washes.


15000 x g, 4°C, 00:30:00
Carefully discard the supernatant by inverting the tube. The pellet could be invisible.
Wash by adding 750 µL cold 70% Ethanol , vortex briefly.
15000 x g, 4°C, 00:15:00 and carefully decant and discard the supernatant by inverting the tube.
Repeat the wash steps 42-43
Short-spin the tube and carefully remove any remaining supernatant with a pipettor avoiding to dislodge the pellet.
Air dry the pellet for 00:05:00 maximum
Resuspend the mRNA-enriched pellet in 18 µL Nuclease-free Water and incubate 00:15:00 atRoom temperature . If necessary, vortex the sample vigorously to resuspend the RNA.


Note
If the RNA solution is brown, there is probably a small amount of Oligo Magbeads remaining in the sample. To remove them, put the tube on the magnet stand for 3 min and move the enriched mRNA solution to a new RNase-free tube.

Aliquot 2 µL eluate to evaluate the quantity and quality of mRNA-enriched sample and store it at -80 °C .

  • Analyze 1 µL to evaluate the RNA concentration.

Qubit RNA BR Assay KitThermo Fisher ScientificCatalog #Q10211
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512
Equipment
Qubit 4
NAME
Fluorometer
TYPE
Invitrogen
BRAND
Q33238
SKU
LINK
  • Analyze 1 µL to evaluate the rRNA depletion.

Bioanalyzer RNA 6000 Nano KitAgilent TechnologiesCatalog #5067
Equipment
Bioanalyzer
NAME
Bioanalyzer
TYPE
Agilent
BRAND
G2991AA
SKU
LINK
Any bioanalyzer will suffice.
SPECIFICATIONS


Expected result
Quantification obtained with the Qubit 4 Fluorometer: 50-200 ng/µL
RIN obtained with the Bioanalyzer: N/A
The RIN is calculated with the 16S and 23S rRNA peaks. However, the smaller the 16S and 23S rRNA peaks, the more efficient the depletion. The efficiency depends on the bacteria of interest and the starting total RNA quantity.




4 - mRNA-enriched 3'-polyadenylation
1h 30m
E.coli Poly (A) Polymerase - 500 unitsNew England BiolabsCatalog #M0276L DNA LoBind Tube 1.5ml EppendorfCatalog #022431021

In a 1.5 ml microcentrifuge tube, set up 3’ polyadenylation reaction as follows:

AB
Reagent Volume
Non-polyadenylated mRNA-enriched X µl
10X E. coli poly(A) polymerase buffer 2 µl
ATP (10 mM) 2 µl
Nuclease-free water 15-X µl
E. coli poly(A) polymerase (5 U/µl) 1 µl
TOTAL 20 µl

Note
The quantity of starting mRNA-enriched depends on the quantity obtained after rRNA depletion. We recommend using more than 300 ng and less than 10 µg. Here, we used 1,5 µg.

Incubate at 37 °C for 00:00:45 . The recommendations from Oxford Nanopore are between 0.5 and 1.5 minutes maximum.
Stop the reaction by adding5 µL 50 mM EDTA .
sparQ PureMag BeadsQuantabioCatalog #95196-060
Equilibrate at Room temperature for at least 00:30:00 before use and vigorously vortex to resuspend the beads.

Add 100 µL SparQ PureMag Beads (0.8X for RNA fragments >150 bp, decreased the ratio until 0.5X to select long fragments or increase up to 0.9X to keep the short fragments).
Incubate on a Hula Mixer 100 rpm, 00:05:00 at Room temperature .
Equipment
Rotator Mixer Multi 1
NAME
Hula mixer
TYPE
StarLab
BRAND
N2400-5000
SKU
LINK

Spin down the sample and pellet on a magnet stand. Keeping the tube on the magnet, pipet off and discard the supernatant.
Wash the beads with 200 µL 80% ethanol freshly prepared . Vortex 00:01:00 and pellet on a magnet stand. Pipet off and discard the supernatant.
Repeat the previous wash (step 54).
Briefly spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Allow to dry for 00:00:30 or more but do not dry the pellet to the point of cracking.
Remove the tube from the magnet stand and resuspend the pellet in 9 µL nuclease-free H2O . Incubate 00:05:00 at Room temperature .
Pellet the beads on a magnet until the eluate is clear and colourless.
Recover the eluate containing the 3’-polyadenylated RNA in a 1.5 mL Eppendorf LoBind tube.
Analyze 1 µL final eluate and quantify the final concentration using a Qubit RNA BR assay kit.
concentration
Qubit RNA BR Assay KitThermo Fisher ScientificCatalog #Q10211
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512

Expected result
The expected concentration of 3'-polyadenylated mRNA-enriched as a function of input material: 15-100 ng/µL

Store the samples at -80 °C or proceed immediately with the library preparation, keeping your sample On ice .
5 - Reverse transcription and strand-switching
2h 30m

Note
From this point, we followed the SQK-LSK114 ONT protocol (version DCS_9187_v114_revG_19Apr2023) coupled to the SQK-NBD114.24 protocol (version NBA_9168_v114_revL_15Sep2022) with few adjustments.
It is important to check the newly available protocol update on the Oxford Nanopore Community to take notes about the potential new major recommendations.

Transfer 100 ng of polyA mRNA into 0.2 mL PCR tube and adjust the volume to 7.5 µL with nuclease-free H2O.
Mix by flicking the tube to avoid unwanted shearing and spin down briefly.
Add 2.5 µL 2 µM VN primer and 1 µL 10 mM dNTPs to the PCR tube.

Note
VN primer sequence (HPLC grade):
/5phos/ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN

Mix by flicking the tube to avoid unwanted shearing and spin down briefly.
Incubate at 65 °C for 00:05:00 .
Snap cool On ice or on a prechilled freezer block for 00:01:00 .

Meanwhile, prepare the following mix in a separate tube:

AB
ReagentVolume per sample
5X RT Buffer4 µL
RNaseOUT1 µL
Nuclease-free Water1 µL
10 µM Strand-Switching primer2 µL
Mix gently by flicking the tube and spin down.
RNaseOUT RNase InhibitorInvitrogen - Thermo FisherCatalog #10-777-019 Maxima H Minus First Strand cDNA Synthesis KitThermo FisherCatalog #K1652

Note
Strand-Switching primer sequence (HPLC grade):
TTTCTGTTGGTGCTGATATTGCTmGmGmG
(mG = 2' O-Methyl RNA bases)

Add 8 µL Strand-Switching mix to the snap-cooled mRNA. Mix by flicking the tube and spin down.
Incubate in a thermal cycler at 42 °C 00:02:00
Add 1 µL Maxima H minus Reverse Transcriptase . Mix by flicking the tube and spin down.

Incubate using the following program in a thermal cycler:
  • Reverse transcription and strand switching 42 °C 01:30:00
  • Heat inactivation 85 °C 00:05:00
  • Hold 4 °C
6 - RNA degradation and second strand synthesis
2h
Add 1 µL RNAse Cocktail to the reverse transcription reaction.

RNAse CocktailThermo Fisher ScientificCatalog #AM2286
Incubate at 37 °C for 00:10:00 in a thermal cycler.
Meanwhile, resuspend the SparQ PureMag Beads by vortexing.
Add 17 µL SparQ PureMag Beads in a 1.5 mL Eppendorf LoBind tube.

sparQ PureMag BeadsQuantabioCatalog #95196-060
DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Transfer the sample to the beads and mix by flicking the tube.
Incubate on a Hula mixer 100 rpm, 00:05:00 at Room temperature .
Spin down the sample and pellet on a magnet stand. Pipet off the supernatant.
Wash the beads with 200 µL fresh 80 % Ethanol without disturbing the pellet.
Discard the ethanol using a pipette.
Repeat the previous step.
Spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Allow to dry for 00:00:30 , but do not dry the pellet to the point of cracking.

Remove the tube from the magnet stand and resuspend the pellet in 10 µL Nuclease-free H2O .

Incubate on a Hula mixer 100 rpm, 00:10:00 at Room temperature .
Briefly spin down the tube and pellet the beads on the magnet stand until the eluate is clear and colourless, for at least 00:01:00 .
Remove and retain 10 µL eluate into a 0.2 ml PCR tube.

Prepare the following reaction mix in a 1.5 ml tube:

AB
ReagentVolume per sample
Q5 High-Fidelity 2X Master Mix12.5 µL
10 µM PR2 primer1 µL
Nuclease-free H2O1.5 µL
Mix gently by flicking the tube and spin down.

Q5 High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0492S

Note
PR2 primer sequence (HPLC grade):
/5Phos/TTTCTGTTGGTGCTGATATTGC

Add 15 µL reaction mix to the reverse-transcribed sample in the PCR tube.

Incubate using the following program in a thermal cycler:
  • Denaturation 94 °C 00:01:00
  • Annealing 50 °C 00:01:00
  • Extension 72 °C 00:15:00
  • Hold 4 °C
Meanwhile, resuspend the SparQ PureMag Beads by vortexing.
Add 20 µL SparQ PureMag Beads2 in a 1.5 mL Eppendorf LoBind tube.

sparQ PureMag BeadsQuantabioCatalog #95196-060
DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Transfer the sample to the beads and mix by flicking the tube.
Incubate on a Hula mixer 100 rpm, 00:05:00 at Room temperature .
Spin down the sample and pellet on a magnet stand. Pipet off the supernatant.
Wash the beads with 200 µL fresh 80 % Ethanol without disturbing the pellet.
Discard the ethanol using a pipette.
Repeat the previous step.
Spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Allow to dry for 00:00:30 , but do not dry the pellet to the point of cracking.
Remove the tube from the magnet stand and resuspend the pellet in 14 µL Nuclease-free H2O .
Incubate on a Hula mixer 100 rpm, 00:10:00 at Room temperature .
Briefly spin down the tube and pellet the beads on the magnet stand until the eluate is clear and colorless, for at least 00:01:00 .
Remove and retain 14 µL eluate into a 1.5 mL Eppendorf LoBind tube.
Analyze 1 µL strand-switched cDNA with a Qubit fluorometer using the Qubit dsDNA HS assay kit.

Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512

Expected result
The expected concentration of cDNA: 0.5-2 ng/µL

To calculate the cDNA molarity, analyze 1 μl of the strand-switched cDNA length with a Bioanalyzer.

Note
If the mean cDNA length is known, the molarity could be calculated with the NEBioCalculator.

Store the samples at -20 °C for long-term storage or at 4 °C for short-term storage.

7 - End-prep
1h 30m
ONT Native barcoding sequencing kit v14 (24)Oxford Nanopore TechnologiesCatalog #SQk-NBD114.24
The ONT Native barcoding sequencing kit v14 (24) contains 24 barcodes. In other words, the maximum number of samples to be simultaneously run in compatible R10.4.1 flow cells is 24.

Dilute the DNA Control Sample (DCS) by adding 105 µL Elution Buffer (EB) directly to one DCS tube. The final concentration is 10 ng/µL.
Mix gently by pipetting and spin down.
In 0.2 ml PCR tubes, aliquot the same highest quantity possible of cDNA per sample up to 11.5 µL.


Note
Expect a minimum of 70 fmol for all samples summed. To date, we have not go below 5 fmol of cDNA per sample with 24 samples. Here, we used 14 fmol of cDNA per sample.

Make up each sample to 11.5 μl using Nuclease-free H2O. Mix gently by pipetting and spin down.
Calculate the DNA Control Sample volume (X µL) to put in each cDNA sample. To know, 1 µL of DCS should be used for 200 fmol (130 ng for 1 kb cDNA, the maximum quantity per sample) of cDNA sample.

Note
Here, for 14 fmol of cDNA, we used 0.07 µL DCS per sample.

Prepare the following end-prep mix:
AB
ReagentVolume per sample
DNA Control SampleX µL
Ultra II End-prep Reaction Buffer1.75 µL
Ultra II End-prep Enzyme Mix0.75 µL
Nuclease-free H2O 1 - X µL
Mix gently by flicking the tube and spin down.

NEBNext Ultra II End Repair/dA-Tailing Module - 96 rxnsNew England BiolabsCatalog #E7546L
Add 3.5 µL end-prep mix to the 11.5 µL of cDNA sample. Mix by pipetting and spin down.

Incubate in a thermal cycler 20 °C 00:05:00 and 65 °C 00:05:00 .

Meanwhile, by vortexing, resuspend the room-temperature equilibrated AMPure XP beads (AXP) provided in the ONT kit and add 15 µL AXP into as many 1.5 ml Eppendorf DNA LoBind tubes as samples.

Transfer each cDNA sample into the 1.5 ml Eppendorf DNA LoBind tubes containing AXP.
Mix by flicking the tube.
Incubate on a Hula mixer for 00:05:00 at Room temperature .
Spin down the sample and pellet on a magnet stand until the eluate is clear and colorless. Pipet off the supernatant.
Wash the beads with 200 µL fresh 80 % Ethanol without disturbing the pellet.
Discard the ethanol using a pipette.
Repeat the previous step.
Spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Allow to dry for 00:00:30 , but do not dry the pellet to the point of cracking.
Remove the tube from the magnet stand and resuspend the pellet in 9 µL Nuclease-free H2O .
Incubate on a Hula mixer 100 rpm, 00:02:00 at Room temperature .
Briefly spin down the tube and pellet the beads on the magnet stand until the eluate is clear and colorless, for at least 00:01:00 .
Remove and retain 9 µL eluate into a 1.5 mL Eppendorf LoBind tube.
Analyze 1 µL end-prepped cDNA with a Qubit fluorometer using the Qubit dsDNA HS assay kit.

Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512

Expected result
The expected concentration of end-prepped cDNA: 1-4 ng/µL 1

Take forward the highest equimolar mass possible of each sample to be barcoded up to 7.5 µL into the native barcode ligation step. However, you may store the samples at 4°C overnight.

Note
To date, we fruitfully tested the range 7-30 ng cDNA per sample .
Here, we pooled 15 ng (16 fmol) of each end-prepped cDNA sample.

8 - Native barcode ligation
2h
ONT Native barcoding sequencing kit v14 (24)Oxford Nanopore TechnologiesCatalog #SQk-NBD114.24
Select a unique barcode for each sample to be run together on the same flow cell.
Up to 24 samples can be barcoded and combined in one experiment.
In 0.2 ml PCR tubes, add the reagents in the following order:

AB
ReagentVolume
End-prepped DNA7.5 µL
Native Barcode (NB01-24)2.5 µL
Blunt/TA Ligase Master Mix10 µL
Thoroughly mix the reaction by gently pipetting and briefly spinning down

Blunt/TA Ligase Master Mix - 50 rxnsNew England BiolabsCatalog #M0367S

Incubate for 00:20:00 at Room temperature .
The following volume of EDTA depends on the cap color EDTA tube in the ONT kit.
Add 2 µL clear cap EDTA or 4 µL blue cap EDTA to each tube, mix thoroughly by pipetting and spin down briefly.

Pool all the barcoded samples in a 1.5 mL Eppendorf DNA LoBind tube.
By vortexing, resuspend the room-temperature equilibrated AMPure XP beads (AXP) provided.
Add AMPure XP Beads (AXP) to the pooled reaction, and mix by pipetting for a 0.4X clean.
In other words: 14.67 µL AXP per sample used if you added the clear cap EDTA
OR 16 µL AXP per sample used if you added the blue cap EDTA


Note
Here, we added blue cap EDTA in 20 barcoded samples, thus we performed a 320 µL AXP clean.

Incubate on a Hula mixer 100 rpm, 00:10:00 at Room temperature .

Spin down the sample and pellet on a magnet stand for 00:05:00 until the eluate is clear and colorless. Pipet off the supernatant.
Keeping the tube on the magnet stand, wash the beads with 700 µL fresh 80% Ethanol without disturbing the pellet. Discard the ethanol using a pipette.
Repeat the previous step.
Spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Allow to dry for 00:00:30 , but do not dry the pellet to the point of cracking.
Remove the tube from the magnet stand and resuspend the pellet in 33 µL Nuclease-free H2O by gently flicking the tube.
Incubate for 00:10:00 at 37 °C . Agitate the sample for 00:00:10 by gently flicking the tube every 00:02:00 to encourage DNA elution.

Pellet the beads on a magnet stand until the eluate is clear and colorless.
Remove and retain 33 µL eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
Analyze 1 µL barcoded cDNA with a Qubit fluorometer using the Qubit dsDNA HS assay kit.

Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512

Expected result
The expected concentration of pooled barcoded sample: 3-10 ng/µL 1

Take forward the barcoded DNA library to the adapter ligation step.
However, you may store the sample at 4°C overnight.
9 - Adapter ligation
2h
ONT Native barcoding sequencing kit v14 (24)Oxford Nanopore TechnologiesCatalog #SQk-NBD114.24

In a 0.2 mL PCR tube, mix in the following order:

AB
ReagentVolume
barcoded DNA library30 µL
Native Adapter5 µL
NEBNext Quick Ligation Reaction Buffer (5X)10 µL
Quick T4 DNA Ligase5 µL
Thoroughly mix the reaction by gently pipetting and briefly spinning down.

NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S
Incubate the reaction for 00:20:00 at Room temperature in a thermal cycler.

Resuspend by vortexing the room-temperature equilibrated AMPure XP beads (AXP) provided.
Transfer into a clean 1.5 mL Eppendorf DNA LoBind tube and add 20 µL AXP to the reaction and mix by pipetting.

Incubate on a Hula mixer 100 rpm, 00:10:00 at Room temperature .

Spin down the sample and pellet on a magnet stand until the eluate is clear and colorless. Pipet off the supernatant.
Wash the beads by adding 125 µL Short Fragment Buffer (SFB) to retain DNA fragments of all sizes.
Flick the beads to resuspend and spin down.
Return the tube to the magnet stand and allow the beads to pellet.
Discard the supernatant using a pipette.
Repeat the previous wash.
Spin down and place the tube back on the magnet stand. Pipet off any residual ethanol.
Remove the tube from the magnetic rack and resuspend the pellet in 15 µL Elution Buffer (EB) .

Spin down and incubate for 00:10:00 at 37 °C . Agitate the sample for 00:00:10 by gently flicking every 00:02:00 to encourage DNA elution.

Pellet the beads on a magnet stand until the eluate is clear and colorless, for at least 00:01:00 .

Remove and retain 15 µL eluate into a clean 1.5 mL Eppendorf DNA LoBind tube.
  • Analyze 1 µL adapted DNA library with a Qubit fluorometer using the Qubit dsDNA HS assay kit.

Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
MICROTUBE 0.5 ML PP NEUTRALFisher ScientificCatalog #12655512

  • Analyze 1 µL adapted DNA library with a Bioanalyzer to evaluate the length distribution of the library and to calculate the molarity.

Bioanalyzer High Sensitivity DNA KitAgilent TechnologiesCatalog #5067-4626
Equipment
Bioanalyzer
NAME
Bioanalyzer
TYPE
Agilent
BRAND
G2991AA
SKU
LINK
Any bioanalyzer will suffice.
SPECIFICATIONS


Expected result
The expected concentrations of adapted DNA library: 3-10 ng/µL 1 3-20 nanomolar (nM)

Make up the library to 12 µL containing 35-50 fmol (for 1-10kb library length) or 100 fmol (for <1kb library length) .
The prepared library is ready for loading onto the R10.4.1 flow cell. Store the library on ice until loading.

Note
Here, we loaded around 100 fmol.

10 - Priming and loading the SpotON flow cell
45m
On the computer, plug in the MinION, check for the operating system updates and prohibit it during the run. Get the last MinKNOW software version and start a hardware check.

Note
We recommend installing the GPU version instead of the CPU if your computer complies with the minimum ONT requirements to avoid run crash.

Open the MinION device lid and slide the R10.4.1 flow cell under the clip. Press down firmly on the flow
cell to ensure correct thermal and electrical contact. Start a flow cell check.

Nanopore Flow Cell R10.4.1Oxford Nanopore TechnologiesCatalog #FLO-MIN114

Note
ONT will replace any flow cell with fewer than 800 nanopores when the result is reported within two days of performing the flow cell check, and when the storage recommendations have been followed. The warranty on this product is 12 weeks from receipt by the customer.

Meanwhile, at Room temperature , prepare the flow cell priming mix as directed below:

AB
ReagentVolume
Flow Cell Flush (FCF)1170 µL
50 mg/ml Bovine Serum Albumin (BSA)5 µL
Flow Cell Tether (FCT)30 µL
Mix by pipetting.
ONT Native barcoding sequencing kit v14 (24)Oxford Nanopore TechnologiesCatalog #SQk-NBD114.24
Invitrogen™ BSA (50 mg/ml) UltraPure™ Fisher ScientificCatalog #AM2616


Slide the flow cell priming port cover clockwise to open the priming port and draw back a small volume to
remove any bubbles in the following way:
1) Set a P1000 pipette to 200 μl
2) Insert the tip into the priming port
3) Turn the wheel until you can see a small volume of yellow buffer entering the pipette tip

Note
Visually check that there is continuous buffer from the priming port to the beginning of the waste channel after the sensor array to be sure that the array of pores is covered by buffer at all times.

Avoiding the introduction of air bubbles, load 800 µL priming mix into the flow cell via the opened priming port (form a drop at the end of the pipette tip before inserting into the priming port and gently load the priming mix). You can see the yellow buffer enter the waste channel.
Wait for 00:05:00 .

During this time, in a 1.5 ml Eppendorf DNA LoBind tube, prepare the library as follows:

AB
ReagentVolume
Sequencing Buffer (SB)37.5 μL
(Pipet mix immediately before use) Library Beads (LIB)25.5 μL
adapted cDNA library12 μL

Gently lift the SpotON sample port cover (to make the SpotON sample port accessible and enable the creation of a drop before sample loading).
To complete the flow cell priming, load 200 µL priming mix into the flow cell via the opened priming port (not the SpotON sample port), avoiding the introduction of air bubbles as already mentioned.
Mix the prepared library gently by pipetting and immediately load 75 µL prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.
Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port and close the priming port.
Close the device lid and set up a sequencing run on MinKNOW.

Fill in the fields step-by-step (Experiment ID, Sample ID) and select the kit SQK-NBD114.24.
In sequencing analysis settings, basecalling and barcoding should be ON, select Trim barcodes since each barcode data is separately stored, turn the alignment ON and check the output settings. Make sure there is enough free disk space (at least 500 GB) and use POD5 file extension to rebasecall. The MinQ Score should be 8. To determine the sequencing duration, choose 72 h or less, or a number of reads depending on the objectives.

Note
We recommend downloading the sequence FASTA file of your strain to benefit from the real-time analysis in terms of sequence coverage. In this way, you can stop the run when the required sequencing depth is obtained (10X minimum for transcriptomes).