Mar 12, 2026
Version 2
whole-organism TChIC for single-cell co-mapping of histone modifications and gene expression in Zebrafish V.2
- Vivek Bhardwaj1,2,
- Alberto Griffa1,
- Helena Viñas Gaza1,
- Peter Zeller1,
- Alexander van Oudenaarden1
- 1Hubrecht Institute;
- 2Utrecht University
External link: https://doi.org/10.7554/eLife.110400
Protocol Citation: Vivek Bhardwaj, Alberto Griffa, Helena Viñas Gaza, Peter Zeller, Alexander van Oudenaarden 2026. whole-organism TChIC for single-cell co-mapping of histone modifications and gene expression in Zebrafish . protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7pbe8gwz/v2Version created by Vivek Bhardwaj
Manuscript citation:
Bhardwaj V, Griffa A, Gaza HV, Zeller P, Oudenaarden Av Single-cell co-mapping reveals relationship between chromatin state and gene expression in early zebrafish development. eLife 15(). doi: 10.7554/eLife.110400
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 19, 2025
Last Modified: March 12, 2026
Protocol Integer ID: 235479
Keywords: cell transcriptome with chromatin immunoclevage, early embryonic development in zebrafish, chromatin modifications in individual cell, chromatin immunoclevage, cell identity during embryonic development, specific chromatin landscape, chromatin modification, cell transcriptome, vertebrate embryogenesi, zebrafish, individual cell, cell tchic, cell identity, gene expression in the same cell, embryonic development, cell, length transcriptome, early embryonic development, same cell, gene expression, gene, zebrafish embryos across several developmental timepoint, gene expression in zebrafish, zebrafish embryo, histone modifications in individual cell, histone modification, protocol for genome, genome, pooled processing of cell, cell type
Funders Acknowledgements:
EMBO
Grant ID: ALTF 1197–2019
ERC
Grant ID: ERC-AdG 101053581-scTranslatomics
Abstract
Establishing a cell-type-specific chromatin landscape is crucial for the maintenance of cell identity during embryonic development. However, our knowledge of how this landscape is set during vertebrate embryogenesis has been limited, due to the lack of methods to jointly detect chromatin modifications and gene expression in the same cell. Here we present a protocol for genome-wide co-mapping of full-length transcriptome and histone modifications in individual cells during early embryonic development in Zebrafish: whole-organism single-cell Transcriptome with Chromatin immunoclevage (woT-ChIC). This protocol includes labelling, sorting and pooled processing of cells from zebrafish embryos across several developmental timepoints, reducing batch effects. It also allows the use of nuclei or whole-cells.
zebrafish whole-organism T-ChIC
Image Attribution
Created in BioRender. Bhardwaj, V. (2026) https://
BioRender.com/4b77tsi
Protocol materials
RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
CellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554
CellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572
CellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
rat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML
Mineral Oil BioUltra, for molecular biologyMerck MilliporeSigma (Sigma-Aldrich)Catalog #69794-500ML
Stericup® Quick Release Vacuum Driven Sterile Filters Merck Millipore (EMD Millipore)Catalog #S2GPU05RE
Silverseal plate sealergreiner bio-oneCatalog #676090
Thermolabile Proteinase KNew England BiolabsCatalog #P8111S
MgCl2 1MThermofisherCatalog #AM9530G
BSA 20ng/mLNew England BiolabsCatalog #B9000S
T4 PNKNew England BiolabsCatalog # M0201L
E. coli Poly(A) PolymeraseNew England BiolabsCatalog #M0276L
Adenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
RNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
SuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
dNTPs MixPromegaCatalog #U1515
DTT 0.1MInvitrogen - Thermo FisherCatalog #15846582
Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
DNA Polymerase I, Large (Klenow) FragmentNew England BiolabsCatalog # M0210L
Thermolabile Exonuclease INew England BiolabsCatalog # M0568L
ATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
Tris 1M pH 7.5ThermofisherCatalog #15567027
AmpliTaq™ 360 DNA PolymeraseThermo Fisher ScientificCatalog #4398828
dATPs 100mMPromegaCatalog #U1335
KCl 1MThermofisherCatalog #AM9640G
BSA 20mg/mLNew England BiolabsCatalog ##B9000
T4 DNA LigaseNew England BiolabsCatalog #M0202L
VBLOK200 Reservoir, CaseClickBio, Inc.Catalog #CBVBLOK200-1
Hybridase Thermostable RNase HBiosearch TechnologiesCatalog #H39500
RQ1 RNase-Free DNasePromegaCatalog #M6101
NEB T4 RNA Ligase 2, truncatedNew England BiolabsCatalog #M0242L
RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
RNAse AThermo ScientificCatalog #EN0531
NEBNext® High-Fidelity 2X PCR Master MixNew England BiolabsCatalog #M0541L
PronaseMerck MilliporeSigma (Sigma-Aldrich)Catalog #10165921001
SpermidineMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2626-5G
cOmplete™, EDTA-free Protease Inhibitor CocktailMerckCatalog #5056489001
FACSmax Cell Dissociation SolutionamsbioCatalog #AMS.T200100
Before start
Reagents, tips and tubes should be RNAse and DNAse-free, and ideally DNA-low-binding as well.
Embryo Dissociation
1d
Obtain Zebrafish embryos. Grow them at 28.5 °C in a 10cm diameter petri dish in ~10 mL of fresh E3 media in an incubator.
If planning to incubate the embryos for a long time, check the water level periodically for evaporation. You might want to add a beaker with water just to provide a bit more moisture.
Check on the embryos periodically. Count them and decide if and how to split them between one or multiple timepoints.
Optionally, take representative pictures of the embryos
Sort our the unfertilized embryos from the fertilized ones using a plastic Pasteur pipette. This can be done at any time between the collection of the eggs and their dissociation, but it's advisable to do it very early (~1hpf) because of the ease of distinguishing fertilized and unfertilized.
1 hour before the start of dissociation prepare and/or thaw the reagents required:
1. fresh E3 media (1 L or more):
- 13.3 mg NaCl
- 0.63 mg KCl
- 2.4 mg CaCl2
- 4.0 mg MgSO4
(diluted in a final volume of 1 L of H2O)
2. Pronase solution (1mg/mL, dissolved in E3 media)
PronaseMerck MilliporeSigma (Sigma-Aldrich)Catalog #10165921001
3. Calcium-free Ringer’s solution (prepared following ZFIN recipe book, 5th Edition https://zfin.atlassian.net/wiki/spaces/prot/pages/362220041/RINGER+S+SOLUTIONS) :
- 116 mM NaCl
- 2.9 mM KCl
- 5.0 mM pH 7.2 HEPES
4. FACSmax (used for timepoints lower than 10hpf).
FACSmax Cell Dissociation SolutionamsbioCatalog #AMS.T200100
5. Protease solution (used for timepoints from 10hpf (included) onwards).
- 25mL 0.5% Trypsin-EDTA
- 5mL 10X PBS0
- 20mL sterile water
6. Protease Stop solution (used for timepoints from 10hpf (included) onwards)
- 3ml FBS
- 30μL of 2M CaCl2
- 5.9mL sterile water
- 1mL 10X PBS0 (PBS0 is PBS without Ca+ and Mg+)
7. Suspension media (1mL FBS + 9ml PBS0). PBS0 is PBS without Ca+ and Mg+
8. CellTracer dyes and rat serum to stop staining (depending on whether multiple timepoints will be mixed in a single tube or not, see flowcharts below): CellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554 CellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572 CellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
rat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML
Equipment
CENTRIFUGE 5430 R
NAME
Eppendorf
BRAND
MP2231000510
SKU
After the dissociation is complete, there are a few possible routes that can be taken (requiring tweaks to the solutions). The flowchart below illustrates the 2 main choices and their required changes:
The choice of protocol will determine which solutions to prepare and whether to also procure the cell tracer dyes. Below is a more detailed overview of which solutions are needed and for which steps according to your choices. We used the two approaches in the bottom row in our datasets.
More detailed overview of which solutions are needed and for which steps according to your choices. We used the two approaches in the bottom row in our datasets. EtOH: Ethanol, WB1: Wash Buffer 1, WB: Wash Buffer, ab: antibody, pA-MN: protein A-MNase fusion protein
How to prepare the various Washing Buffers (CellTrace Staining included)
If you are not planning on using the Celltrace dyes to combine multiple samples, see alternative option below at step 2.1
Prepare Wash Buffer(w/out Spermidine), regular Wash Buffer, Wash Buffer1 (w/out Spermidine) and regular Wash Buffer 1 (WB1). Not all of these need to prepared now, but for the sake of completeness, they are all presented here.
We suggest preparing the Wash buffers in the following order: prepare 50mL of Wash Buffer(w/out Spermidine) and take 10mL aside to make WB1 (w/out Spermidine). Use the remaining 40mL to make regular WB, and from regular WB, prepare WB1 as needed.
Depending on whether the objective is to capture cells or nuclei, switch out the Tween-20 for 10% Saponin.
(Dissolve fresh 10% Saponin in PBS0. Store at 4 °C , use within 2 days. )
For all Wash Buffers: prepare On ice , store at 4 °C , use for up to 2 days
Wash Buffer(w/out Spermidine)
| A | B | |
| Wash Buffer (w/out Spermidine) | Volume 50 mL | |
| H2O RNAse free water | 47.8 mL | |
| HEPES pH 7.5 (1M) | 1 mL | |
| NaCl(5M) | 1.5 mL | |
| Saponin 10% | 250 µl | |
| Protease inhibitor | 1 complete tablet |
cOmplete™, EDTA-free Protease Inhibitor CocktailMerckCatalog #5056489001
from the Wash Buffer(w/out Spermidine), prepare the Wash Buffer(w/out Spermidine) 1. We suggest preparing it on a per-needed basis to save on the RNAse inhibitor.
| A | B | C | D | |
| Wash Buffer w/out Spermidine 1 | Volume 1 mL | Volume 1.5mL | Volume 7,5 | |
| Wash Buffer MINUS | 1mL | 1.5 mL | 7.5 mL | |
| EDTA 0.5M | 4 µl | 6 µl | 30 µl | |
| RNAse inhibitor (1:40) | 25 µl | 37.5 µl | 187,5 µl |
RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
From the remaining Wash Buffer(w/out Spermidine), prepare 40mL of the regular Wash Buffer (by adding the Spermidine).
| A | B | |
| regular WB | Volume 40mL | |
| Wash Buffer w/out Spermidine | 40mL | |
| Spermidine solution | 2.88 µl |
SpermidineMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2626-5G
From the regular Wash Buffer, prepare the Wash Buffer 1. We suggest preparing it on a per-needed basis to save on the RNAse inhibitor.
| A | B | |
| Wash Buffer1 | Volumn 2.5mL | |
| regular WB | 2.43 mL | |
| EDTA 0.5M | 10 µl | |
| RNAse inhibitor (1:40) | 62,5 µl |
RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ALTERNATIVE: Preparing Wash Buffers (not for CellTrace staining)
For those not planning to do any stainings, they only need to prepare the regular Wash Buffer following this recipe and the WB1 by adding EDTA to the regular WB.
| A | B | C | D | |
| regular Wash Buffer | Concentration | Volume 50 mL | Volume 10 mL | |
| H2O RNAse free water | 47.8 mL | 9.56 mL | ||
| HEPES pH 7.5 | 1M | 1 mL | 200 ml | |
| NaCl | 5M | 1.5 mL | 300 ml | |
| Spermidine solution | 3.6 µl | 0.72 ml | ||
| Tween (10%) | 0.05% | 250 µl | 50 ml | |
| Protease inhibitor | 1 complete tablet |
Store at 4 °C or in a cold room. Use for up to 2 days.
WB1
To an aliquot of WB, add 4 µL of 0.5 Mass Percent EDTA for each 1 mL of WB.
Store at 4 °C or in a cold room. Use for up to 2 days.
We suggest not turning all of the regular WB in WB1 immediately, as the regular WB will still be used during day 2.
Dechorionation
Transfer the embryos to a glass beaker with a plastic Pasteur pipette. Remove as much E3 as possible without exposing the embryos to air. Add ~5 mL of 2 micromolar (µM) Pronase Solution. Incubate at 28.5 °C for 00:03:00 checking constantly for cracks in the chorion. If the chorions are still intact after the 3 minutes, incubate for longer (00:01:00 - 00:02:00 ). At the first sign of the chorions cracking, proceed to the next step.
6m
Dilute the Pronase with serial dilutions with a large (enough to fill 90% the beaker) volume of E3 media. Pour away as much liquid as possible without leaving the embryos exposed to air, and repeat this washing step another 3-4 times. Swirl the beaker to release the embryos from their chorions.
8m
Transfer the dechorionated embryos with a glass pipette to 1.5mL protein low-binding tubes. Use multiple tubes so that each tube only contain 30-50 embryo (fewer at later timepoints).
Deyolking
Remove as much E3 as possible (without leaving the embryos exposed to air). Add 200 µL of Calcium-free Ringers solution.
Gently pipette up and down with a P200 pipette to deyolk (~15 times).
Expected result
the solution should turn cloudy and slightly yellow-tinted.
Let sit in Ringer’s solution for approximately 00:05:00 at Room temperature .
5m
Centrifuge the samples at 600 rcf, 00:03:00 with a Swinging Buckets Centrifuge
Equipment
CENTRIFUGE 5430 R
NAME
Eppendorf
BRAND
MP2231000510
SKU
3m
Wash the samples with 500 µL of Suspension Media at Room temperature
centrifuge at 600 rcf, 00:03:00 with the swinging buckets centrifuge (Eppendorf 5430R with swinging buckets).
3m
Dissociation:
Resuspend cells in 200 µL of either FACSmax (for timepoints up to 8hpf (included)), or Protease Solution (for timepoints 10hpf (included) onward. Incubate on shaker (Eppendorf Thermomixer Comfort) at 600 rpm, 28°C, 00:06:00
Resuspend up and down gently every 2min.
Check under the microscope that the suspension is single cell! If not keep longer.
Expected result
the solution should contain single cells
If the solution is already single cell, interrupt the shaking and proceed to the next step.
6m
If using the Protease Solution, at the end of the dissociation, add 34uL of Protease Stop Solution for every 200uL of Protease Solution.
Collect and filter the single cell solution into a 1.5 mL prot-low binding tube using the blue cap from FACS tubes (35 µL sieve Corning, 352235) and centrifuge at 600 rcf, 00:03:00 with the swinging buckets centrifuge. Simply pipettng the cells thrhough the strainer also works.
3m
Resuspend the cell pellet in 500 µL of Suspension media at Room temperature . Take a10 µL aliquot to count the number of cells. Centrifuge the rest at 600 rcf, 00:03:00 with the swinging buckets centrifuge.
3m
Resuspend the pellet in 500 µL of WB1 Full (remember the 1:40 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).
Keep on On ice until all the timepoints have been collected.
DAY 1: Cell Staining and Antibody Incubation
2h
Centrifuge all samples at 600 rcf, 00:03:00 with the swinging buckets centrifuge.
Wash each sample with 200 µL of WB1 (w/out Spermidine) (with 1:200 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ), and centrifuge them again at 600 rcf, 00:03:00 with the swinging buckets centrifuge.
Skip till Step 13 if you are not planning on staining your samples!
6m
Resuspend each sample in 1 mL of WB1 (w/out Spermidine). Add to each sample 1 µL of one or a combination of the CellTrace Dyes:
CellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554 CellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572 CellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
We suggest consistently using the same staining setup between replicate experiments to speed up the configuration of the FACS Sorting Layout.
Vortex each sample well!
Incubate the samples in the dark On ice for 00:20:00
20m
In the meantime, prepare/thaw the rat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML (which will stop the staining)
Add 70 µL of Rat Serum for each 1 mL of the staining volume (7% of staining volume) to each sample and incubate at Room temperature for 00:05:00 to stop the staining.
5m
Centrifuge the samples at 600 rcf, 4°C, 00:03:00 with the swinging buckets centrifuge.
3m
Wash each sample with 200 µL of WB1 Full (with 1:200 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ) , and centrifuge the samples at 600 rcf, 4°C, 00:03:00 with the swinging buckets centrifuge.
3m
Resuspend and collect the samples in 1 tube with WB1 Full (with 1:40 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ). Calculate the final value so that the concentration of cells is approximately 1 Mil cells/mL, and the mixing ratios corresponds to the desired experimental mix.
If planning to measure more than one histone modification in the same experiment, split the sample in the corresponding number of tubes.
If using colors to mix samples, an unstained populations of carrier cells can be added to increase the cell number.
Add to each sample the appropriate primary antibody, at the appropriate dilution. Incubate Overnight on a roller in the dark and at 4 °C .
Note
We used a 1:200 dilution for Tri-Methyl-Histone H3 (Lys27) (C36B11) Rabbit mAbCell Signaling TechnologyCatalog #9733S
and a 1:100 dilution for H3K4me1 Recombinant Polyclonal AntibodyThermo Fisher ScientificCatalog #710795
5m
DAY 2: Sort, Protein A-MN treatment and activation
1d
Note
From now on, reagents, cells, plates and machines should be kept cold, On ice or at 4 °C as much as possible (including on the way from a machine to a centrifuge).
Cells should ideally also be kept in the dark (until the sort).
Prepare 384-wells Plates
Before starting, make sure to have enough plates to sort into. These should be 384-wells hardshell plates (Biorad) containing at least 5uL of Mineral Oil
Mineral Oil BioUltra, for molecular biologyMerck MilliporeSigma (Sigma-Aldrich)Catalog #69794-500ML and 0.05 µL of WB2 containing 28ng/uL of Celseq2 adapters.
Note
We suggest preparing the 384-wells plates in advance of the sort
You can prepare the plates by first filtering the mineral oil with a Stericup® Quick Release Vacuum Driven Sterile Filters Merck Millipore (EMD Millipore)Catalog #S2GPU05RE and then dispensing several (between 5 and 10) uLs of the filtered mineral oil in each plate.
Note
We use a Tecan Freedom Evo for this step, but many other machines might be up to the task.
Next you should dispense in each plate, 0.05 µL of CelSeq2 adapters, diluted in WB2, in each well. We use a Mosquito Liquid Handling robot (SPT Labtech) to transfer 0.05 µL from each well of a master plate(containing the primers in WB2) to each well of the target plate(s) (up to 4 at the same time). To minimise evaporation, the Mosquito should be humidified to a humidify of ~80 %
Keep the plates On ice if you plan to use them the same day, otherwise store them at -20 °C . When needed, thaw them ~ 00:30:00 before the sort On ice or on thermocyclers cooled to 4 °C .
WB2
| A | B | C | D | |
| Wash Buffer 2 | Concentration | Volume 50 mL | Volume 10 mL | |
| H2O RNAse free water | 47.8 mL | 9.56 mL | ||
| HEPES pH 7.5 | 1M | 1 mL | 200 ml | |
| NaCl | 5M | 1.5 mL | 300 ml | |
| Spermidine solution | 3.6 µl | 0.72 ml | ||
| Tween (10%) | 0.05% | 250 µl | 50 ml |
The CelSeq2 adapters were ordered from IDT and are distributed according to this layout (same as CelSeq2 and VASA-seq) 
Celseq2_primers.xlsx19.6KB
Celseq2_primers.xlsx19.6KB 30m
Centrifuge the antibody stained sample at 600 rcf, 4°C, 00:03:00 with the swinging buckets centrifuge. Respond the sample in 500 µL of WB (with 1:200 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).
Centrifuge the sample again at 600 rcf, 4°C, 00:03:00 with the swinging buckets centrifuge.
Note
It's important to use the correct buffer (WB) to wash away the EDTA that was previously present, in order for the pA-MNase not be hampered after sorting.
6m
DAY 2: Sort, Protein A-MN treatment and activation
1d
Resuspend the sample in 500 µL of WB (with 1:40 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ) + ProteinA-MN (600uL/mL, add 5uL every 1mL of WB) and Hoechst dye.
Note
We use our own in-house produced Protein A-MN. If producing your own, you might want to perform a titration the first time you use it.
For details of its production, see
Zeller, P., Yeung, J., Viñas Gaza, H. et al. Single-cell sortChIC identifies hierarchical chromatin dynamics during hematopoiesis. Nat Genet 55, 333–345 (2023). https://doi.org/10.1038/s41588-022-01260-3
Mix for 01:00:00 at 4 °C on a roller in the dark.
Centrifuge the sample at 600 rcf, 4°C, 00:03:00 with the swinging buckets centrifuge. Resuspend the sample in 500uL of WB (with 1:200 RNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).
3m
Repeat this wash again.
Filter the sample through the blue caps filter of FACS tubes. Proceed to sorting. Keep samples in the dark and On ice
Sort single cells/nuclei in 384 well-plates containing mineral oil and Celseq2 adapters in WB2. Use the Hoechst and Celltracer dyes staining to identify the cells and distinguish each timepoints.
Label the plates as you sort them (We suggest adding Histone mark, Experiment, Sorting Order information in the labelling).
Note
We suggest sorting all populations in the same plate, and to sort them by columns (population x in column 1, 2, 3; population y in column 4, 5, 6; etc), rather than rows. These two provisions help counter possible inter-plate and intra-plate batch effects (due to the fact that the robots we use dispense row-wise, rather than column-wise).
We also suggest leaving a few empty wells as Negative Controls (we typically leave wells O21 to O24 and P21 to P24).
1h
Keep plates On ice
Immediately after sorting, seal the plates with Silverseal plate sealergreiner bio-oneCatalog #676090
Once sealed, immediately centrifuge 2000 rcf, 4°C, 00:02:00 the plate, then move it on coolblocks On ice , or on 384-wells thermocyclers set at 4 °C .
2m
Prepare the WB2 + 3 millimolar (mM) CaCl2 and the Stop Solution to start and (then) stop the MN digestion.
WB2 + CaCl2:
Prepare WB2
| A | B | C | D | |
| Wash Buffer 2 | Concentration | Volume 50 mL | Volume 10 mL | |
| H2O RNAse free water | 47.8 mL | 9.56 mL | ||
| HEPES pH 7.5 | 1M | 1 mL | 200 ml | |
| NaCl | 5M | 1.5 mL | 300 ml | |
| Spermidine | 3.6 µl | 0.72 ml | ||
| Tween (10%) | 0.05% | 250 µl | 50 ml |
Dilute CaCl2 solution ~1:1000 (or more) in the WB2 solution, to a final concentration of 3mM.
MNase Stop Solution:
| A | B | C | D | |
| MNase Stop Solution | Concentration | Volume (1 plate) | N+1 plates | |
| H2O RNAse free water | 50.25 µl | |||
| EGTA | 0.5 M | 6 µl | ||
| NP40 | 10% | 11.25 µl | ||
| Prot K Thermolabile | 20 mg/mL | 7.5 µl | ||
| MgCl2 | 1M | 0.94 µl |
Calculate margin when preparing the mix to account for the robot's dead volumes
Thermolabile Proteinase KNew England BiolabsCatalog #P8111S
Note
Depending on the number of plates to be processed, there might be enough time left to prepare the Stop solution during the Digestion. Even in such case, we would still suggest to prepare the MNase Stop solution (without the Prot K) before starting the Digestion anyway, and only adding the enzyme during the Digestion.
15m
Dispense 0.1 µL of WB2 + 3 millimolar (mM) CaCl2 in each well to activate the MN.
We use a Nanodrop Liquid Handling machine for this step, and dispense into 2 plates, held in cool blocks, at the time.
As soon as plates have received the MNAse, seal each plate with Aluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
Transfer the plates to 384-wells thermocyclers set at 4 °C for a 00:30:00 digestion.
Note
You should be able, with practice, to simultaneously dispense in a set of plates while centrifuging the pair that was just dispensed. If you can proceed at a steady pace (thus keeping the timing uniform), you would only need to time the first pair of plates, and then just proceed to the Digestion Stop in the same order and at the same pace.
Note
If timing allows, it would be good (and polite) to run a Daily Clean of the Nanodrop (~7/8 minutes) to remove any potential traces of the nuclease.
32m
Stop the digestion of the plates by adding 0.1 µL of MNase Stop Solution to each well.
(Remember to add the Thermolabile Prot K, if not done previously)
We use a Nanodrop Liquid Handling machine for this step, and dispense into 2 plates, held in cool blocks, at the time.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
Once the centrifugation is complete, move plate to a 384-well thermocycler.
Note
Once done, you should run a Daily Clean of the Nanodrop (~7/8 minutes) to remove any potential traces of the Prot K for the next user(s).
2m
Incubate the plate at 4 °C for 00:20:00 , then 37 °C for 02:00:00 , then 55 °C for 00:20:00 and then hold at 4 °C .
2h 40m
Once done, freeze all plates in a -80 °C . The plates can then be thawed and processed at any time.
DAY 3: RNA and DNA Fragment processing and DNA adapter ligation
1d
Thaw the plates you plan to process On ice or at 4 °C on pre-cooled thermocyclers.
Note
Reagents and plates should be kept cold, On ice or at 4 °C as much as possible (including on the way from a machine to a centrifuge). Coolblocks are highly advisable.
Fragment RNA
Incubate the plates in a pre-warmed thermocycler at 85 °C for 00:02:00 .
Immediately move plates to a pre-cooled thermocycler at 4 °C .
Note
Carefully time this step to correctly fragment the RNA.
2m
Blunt End RNA fragments and Poly-A tailing
Prepare Mix1, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep On ice
| A | B | C | D | |
| Mix1 | 1 cell (nL) | 1 plate (400 cells), uL | N plates + 10% | |
| T4 PNK | 1,2 | 12 | ||
| polyA polymerase | 0,175 | 1,75 | ||
| ATP (0.1mM)(1 in 100) | 0,88 | 8,75 | ||
| Tris-HCl 1M pH8 | 2,8 | 28 | ||
| 50% PEG8000 | 0,75 | 7,5 | ||
| BSA 20mg/mL | 0,075 | 0,75 | ||
| RNAse out | 1 | 10 | ||
| KCl 1M | 3 | 30 | ||
| DTT 0,1M | 2 | 20 | ||
| MgCl2 1M | 0,15 | 1,5 | ||
| H2O | 3,12 | 31,2 | ||
| Per well in strip | 18,93 |
T4 PNKNew England BiolabsCatalog # M0201L
E. coli Poly(A) PolymeraseNew England BiolabsCatalog #M0276L
Adenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
RNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
MgCl2 1MThermofisherCatalog #AM9530G
BSA 20ng/mLNew England BiolabsCatalog #B9000S
15m
Dispense Mix1 with Nanodrop Liquid Handling Robot. Dispense 0.150 µL of Mix1 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at 37 °C for 01:00:00 , and then hold at 4 °C .
1h
First Strand cDNA synthesis of RNA fragments
Prepare Mix2, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep On ice
| A | B | C | D | |
| Mix2 | 1 cell (nL) | 1 plate (400 cells), uL | N plates + 10% | |
| SSIII | 1 | 10 | ||
| KCl 1M | 0,75 | 11,25 | ||
| DTT 0.1M | 0,5 | 7,5 | ||
| dNTPs Mix (10mM) | 0,75 | 11,25 | ||
| 50% PEG8000 | 0,5 | 7,5 | ||
| BSA 20mg/mL | 0,05 | 0,75 | ||
| H20 | 6,45 | 96,75 | ||
| Per well in strip | 18,125 |
SuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
dNTPs MixPromegaCatalog #U1515
BSA 20ng/mLNew England BiolabsCatalog #B9000S
15m
Dispense Mix2 with Nanodrop Liquid Handling Robot. Dispense 0.100 µL of Mix2 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at 50 °C for 01:00:00 , and then hold at 4 °C .
1h
DNA fragment Blunt Ending
Prepare Mix3, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep On ice
| A | B | C | D | |
| Mix3 | 1 cell (nL) | 1 plate (400 cells), uL | N plates + 10% | |
| Klenow large | 0,325 | 3,25 | ||
| NaCl 5M | 0,2 | 2 | ||
| T4 PNK | 0,325 | 3,25 | ||
| TL Exo1 | 0,5 | 5 | ||
| dNTPs Mix (10mM) | 0,325 | 3,25 | ||
| Tris-HCl 7,5pH | 1,75 | 17,5 | ||
| DTT 0,1M | 0,75 | 7,5 | ||
| ATP 100mM | 0,65 | 6,5 | ||
| MgCl2 1M | 0,25 | 2,5 | ||
| 50% PEG8000 | 0,75 | 7,5 | ||
| BSA 20mg/mL | 0,075 | 0,75 | ||
| H20 | 9,1 | 91 | ||
| Per well in strip | 18,75 |
DNA Polymerase I, Large (Klenow) FragmentNew England BiolabsCatalog # M0210L
T4 PNKNew England BiolabsCatalog # M0201L
Thermolabile Exonuclease INew England BiolabsCatalog # M0568L
dNTPs MixPromegaCatalog #U1515
ATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
DTT 0.1MInvitrogen - Thermo FisherCatalog #15846582 Tris 1M pH 7.5ThermofisherCatalog #15567027
MgCl2 1MThermofisherCatalog #AM9530G
BSA 20ng/mLNew England BiolabsCatalog #B9000S
Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
15m
Dispense Mix3 with Nanodrop Liquid Handling Robot. Dispense 0.150 µL of Mix3 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at 37 °C for 00:30:00 , then 75 °C for 00:20:00 , and then hold at 4 °C .
50m
A-tailing DNA fragments
Prepare Mix4, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep On ice
| A | B | C | D | |
| mix4 | 1 cell (nL) | 1 plate (400 cells), uL | N plates + 10% | |
| Taq 360 | 0,2 | 2,0 | ||
| dATP 100mM | 0,2 | 2,0 | ||
| KCl 1M | 1 | 10,0 | ||
| 50% PEG8000 | 0,75 | 7,5 | ||
| BSA 20mg/mL | 0,075 | 0,8 | ||
| H2O | 12,775 | 127,8 | ||
| Per well in strip | 18,8 |
AmpliTaq™ 360 DNA PolymeraseThermo Fisher ScientificCatalog #4398828
dATPs 100mMPromegaCatalog #U1335
KCl 1MThermofisherCatalog #AM9640G
BSA 20mg/mLNew England BiolabsCatalog ##B9000
Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
15m
Dispense Mix4 with Nanodrop Liquid Handling Robot. Dispense 0.150 µL of Mix4 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at 72 °C for 00:15:00 , and then hold at 4 °C .
15m
Start thawing the adaptor master plate (On ice ). It's advisable to centrifuge it at 2000 rcf, 4°C, 00:02:00 once it's thawed.
Start humidifying the Mosquito Liquid Handling robot (SPT Labtech).
2m
Adaptor Ligation DNA fragments
Using a Mosquito Liquid Handling robot (SPT Labtech) transfer 50nL of 5uM paired forked adaptors from each well of the adaptor master plate to the plate(s) being processed.
Note
Humidify the Mosquito to ~80 % to minimise the evaporation from the adaptor master plate!
These adaptors were purchased from IDT, paired (top and bottom strand) and annealed, diluted to the working concentrations and stored at -20C till used. Sequences and layout are in this table:ChIC_forked_adaptors.xlsx24.3KB
ChIC_forked_adaptors.xlsx24.3KB A more complete explanation of their design is in the Supplementary Information of the sortChIC paper from where they are derived:
10m
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Repeat the dispension with the other plates.
Note
Once the Mosquito is done transferring the adaptors to one set of plates, you can immediately start transferring the adaptors to a second set of plates while dispensing Mix5 to the set of plates that just finished.
Prepare Mix5, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep On ice
| A | B | C | D | |
| Mix5 | 1 cell (nL) | 1 plate (400 cells), uL | N plates + 10% | |
| T4 ligase (40000U) | 3,5 | 35 | ||
| MgCl2 1M | 0,35 | 3,5 | ||
| DTT 0,1M | 6,75 | 67,5 | ||
| ATP 100mM | 0,35 | 3,5 | ||
| Tris pH7.5 1M | 0,45 | 4,5 | ||
| 50% PEG8000 | 0,75 | 7,5 | ||
| BSA 20mg/mL | 0,075 | 0,75 | ||
| H20 | 2,85 | 28,5 | ||
| Per well in strip | 18,84 |
T4 DNA LigaseNew England BiolabsCatalog #M0202L
MgCl2 1MThermofisherCatalog #AM9530G
DTT 0.1MInvitrogen - Thermo FisherCatalog #15846582
ATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
Tris 1M pH 7.5ThermofisherCatalog #15567027
BSA 20mg/mLNew England BiolabsCatalog ##B9000
Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
15m
Dispense Mix5 with Nanodrop Liquid Handling Robot. Dispense 0.150 µL of Mix5 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at 4 °C for 00:20:00 , then at 16 °C for 16:00:00 , then 65 °C for 00:10:00 , and then hold at 4 °C .
16h 30m
DAY 4: Pooling, Second Strand Synthesis, Amplification
18h 4m
Pooling:
Add 1uL of nuclease-free Water in each well of each plate.
Note
We use a Nanodrop Liquid Handling Robot for this, but an iDOT or similar machines should be capable of the same movement.
5m
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at 2000 rcf, 4°C, 00:02:00 .
2m
Prepare Pooling Plate(s)
Label each pooling plates so that they can be identified and connected with the plate they are to collect.
Pre-wet each pooling plate with 1 mL or 2 mL of filtered Mineral Oil. Tilt the plates until the oil has spread over the entire collection surface. We use VBLOK200 Reservoir, CaseClickBio, Inc.Catalog #CBVBLOK200-1 , but a clean, upside-down pipette tips box lid works as well .
15m
Place each plate upside down over a pooling plate.
Centrifuge them at up to 2000 rcf, 4°C, 00:02:00 . Do not stack pooling plates on top of each other in the centrifuge.
Expected result
the plate should be empty, and the pooling plate should contain 2 separate liquids, with the acqeous phase below and the oil above.
2m
For each plate, pool the aqueous phase in 2mL DNA-low-binding tubes. Centrifuge the tubes at 2000 rcf, 00:01:00 (this is just to separate the acqueous phase form the oil).
5m
Take the lower aqueous phase and move it into a 1.5 mL DNA-low binding tube.
1m
Centrifuge the tubes 2000 rcf, 00:01:00 again.
1m
Take the lower aqueous phase and move it into a 1.5 mL DNA-low binding tube. During this pipetting step measure the volume.
2m
Clean up DNA using DNA beads
Add 0.8X µl (depending on volume of each sample) of DNA beads diluted 1 in 8 with bead binding buffer (1 M NaCl, 20% PEG8000, 20mM Tris pH8, 1 mM EDTA) and mix by pipetting.
Take the beads out of the fridge ~ 00:30:00 before using them
5m
Incubate for 00:15:00 at Room temperature .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
5m
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in 17 µL of nuclease-free water (away from the magnet).
Let elute for 00:02:00 , then move back onto the magnet. Once the beads have coalesced on the side of the tube and the eluant is clear, move the eluant to a new tube.
4m
Second Strand Synthesis:
On ice !
Add 2 µL of 10X SSS buffer. Mix by vortexing and spin down.
1m
Add 1 µL of SSS Enzyme and mix by gently flicking the tube. Spin down
1m
Incubate at
16 °C for 02:30:00 , 65 °C for 00:20:00 , then hold at 4 °C
2h 50m
Add 1.3X µl of undiluted DNA beads (26 µL ) and incubate for 00:15:00 at Room temperature
15m
Take out of the freezer the IVT reagents (except the enzyme) so they start thawing ~30min in advance of when they will be used.
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in 8 µL of nuclease-free water (away from the magnet). Let elute for ~ 00:02:00
2m
IVT
Prepare the IVT mix (thaw the reagents (except the T7 enzyme) ~00:30:00 in advance):
| A | B | C | |
| IVT Mix | 1 tube | N + 1 tube | |
| ATP | 2 uL | ||
| GTP | 2 uL | ||
| CTP | 2 uL | ||
| UTP | 2 uL | ||
| T7 Buffer | 2 uL | ||
| T7 Enzyme | 2 uL |
Add 12 µl of IVT mix to each tube of eluate with beads.
Incubate on a thermocycler at 37 °C for 13:00:00 , with lid at 70 °C . Then, hold at 4 °C
13h 30m
DAY 5: rRNA depletion, RNA adapter ligation, RT, PCR and final library
6h 29m 30s
IVT bead cleanup
Move samples onto magnet rack.
Move supernatant to a new tube, and add 1.3X Ampure RNA beads (26 µL ) and incubate for 00:10:00 at Room temperature
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in 10 µL of nuclease-free water (away from the magnet). Let elute for ~ 00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, move the supernatant to a new tube.
rRNA depletion
Transfer 6 µL of the aRNA to a new tube On ice , and freeze the remaining eluant at -80 °C
Prepare the Hybridisation buffer - oligos mix:
Prepare the Hybridisation Buffer.
Note
We suggest preparing a large volume of the Hybridisation buffer once, aliquoting and storing it at -20 °C until needed.
| A | B | |
| Hybridisation Buffer | ||
| NaCl 5M | 200 uL | |
| Tris-HCl (1M), pH 7.5 | 500uL | |
| H2O | 300 uL |
Mix the Hybridisation Buffer with the rRNA depletion Oligos (On ice )
| A | B | C | |
| 1 tube | n+1 tubes | ||
| Hybridization Buffer | 2 uL | ||
| rRNA-depletion oligos, 25uM | 2 uL |
The rRNA depletion oligos that we used for the Zebrafish Ribosomes are these (ordered from IDT and pooled together): Zf_rRNA_dep_oligos.xlsx15.5KB
Zf_rRNA_dep_oligos.xlsx15.5KB 2m
Add 4 µL of the Hybridisation Buffer + rRNA depletion Oligos mix to each tube.
Spin down and cool 0 °C .
1m
Incubate tubes on a thermocycler at 95 °C for 00:02:00 , then decrease the temperature to 45 °C at a rate of 0.1C/s, then hold at 45 °C
2m
Prepare the RNAse mix:
Prepare the RNAse Buffer.
| A | B | |
| RNAse Buffer | ||
| Tris-HCl (1M), pH 7.5 | 500 uL | |
| NaCl (5M) 200µl | 200 uL | |
| MgCl2 (1M) 200µl | 200 uL | |
| H20 3100µl | 3100 uL |
Note
We suggest preparing a large volume of the RNAse buffer once, aliquoting and storing it at -20 °C until needed.
Prepare the RNAse Mix.
| A | B | C | |
| 1 tube | n+1 tubes | ||
| Epicentre (Lucigen) RNaseH (Thermostable) | 2 uL | ||
| RNAse buffer | 8 uL |
Hybridase Thermostable RNase HBiosearch TechnologiesCatalog #H39500
2m
Incubate the RNAse Mix at 45 °C for a few minutes (we suggest placing it in the same thermocycler as samples, once they are holding at 45C)
5m
While keeping both samples and Hybridise Mix on the thermocycler at 45 °C , add 10 µL of the RNAse mix to each sample.
1m
Incubate the samples at 45 °C for 00:30:00 .
30m
Spin down and cool On ice .
DNAse treatment (removal of depletion oligos)
Prepare the DNAse Mix:
| A | B | C | |
| 1 tube | n+1 tubes | ||
| Nuclease-free Water | 21 uL | ||
| CaCl2 (10mM) | 5 uL | ||
| Promega RQ1 DNAse | 4 uL |
RQ1 RNase-Free DNasePromegaCatalog #M6101
Add 30 µL of DNAse Mix to each tube. Incubate at 37 °C for 00:30:00 , then hold at 4 °C .
30m
Start thawing Ampure RNA beads at Room temperature ~30 min before the Bead clean up.
Bead Cleanup
Add 80 µL of undiluted, pre-warmed RNA beads to each sample and incubate at Room temperature for 00:10:00 .
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
5m
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in 6 µL of nuclease-free water (away from magnet). Let elute for ~ 00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer 5 µL of eluant to a new tube (On ice ).
Adapter ligation
Pre-heat a thermocycler to 70 °C (with heated lid at 105 °C ).
Add to each sample 1 µL of RA3(20 micromolar (µM) ).
RA3 (ordered from IDT): /5rApp/TGGAATTCTCGGGTGCCAAGG/3SpC3/
Heat adapter-sample-mix at 70 °C for 00:02:00 and then directly put On ice
2m
Pre-heat a thermocycler to 25 °C (with lid heated at 25 °C or without the lid closed).
Prepare the Ligation Mix (On ice ):
| A | B | C | |
| 1 tube | n+1 tubes | ||
| NEB 10x T4 RNA Ligase Reaction Buffer | 1.1 µl | ||
| NEB T4 RNA Ligase 2, truncated | 1.1 µl | ||
| Invitrogen RNaseOUT | 1.1 µl | ||
| Nuclease-free H2O | 1.1 µl |
NEB T4 RNA Ligase 2, truncatedNew England BiolabsCatalog #M0242L
RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
3m
Add 4 µL of the Ligation mix to each tube, mix well by pipetting and spin down (keep On ice )
Incubate on thermocycler at 25 °C for 01:00:00 (lid heated at 25°C or without the lid closed), then hold at 4 °C .
1h
cDNA synthesis
Pre-heat a thermocycler to 65 °C (with heated lid at 105 °C ).
Prepare the dNTPs Mix (On ice ):
| A | B | C | |
| 1 tube | n+1 tubes | ||
| Promega dNTP Mix (10 mM each) | 1 µl | ||
| RTP (20 µM) | 2 µl |
SuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
dNTPs MixPromegaCatalog #U1515
RTP (ordered from IDT): GCCTTGGCACCCGAGAATTCCA
Add 3 µL of the dNTPs to each tube.
Incubate on thermocycler at 65 °C for 00:05:00 , then transfer tubes directly On ice .
5m
Prepare the Reverse Transcription Mix (On ice ):
| A | B | C | |
| 1 tube | n+1 tubes | ||
| Invitrogen 5x FS Buffer | 4 µl | ||
| H2O | 1 µl | ||
| Invitrogen 0.1M DTT | 1 µl | ||
| Invitrogen RNaseOUT (40U/ µl) | 1 µl | ||
| Invitrogen SS III (200U/ µl) | 1 µl |
RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019 SuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
Add 8 µL of the Reverse Transcription mix to each tube, mix well by pipetting and spin down (keep On ice ).
Incubate in a thermocycler at 50 °C for 01:00:00 , then 70 °C for 00:15:00 , and then hold at 4 °C (with lid heated at 85 °C ).
1h 15m
RNA degradation
Add 1 µL of RNAse AThermo ScientificCatalog #EN0531 to each tube.
Incubate on thermocycler at 37 °C for 00:30:00 , then hold at 4 °C (with heated lid at 70 °C )
30m
Start thawing Ampure DNA beads at Room temperature ~30 min before the next Bead clean up.
Bead Cleanup
Add 22 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at Room temperature for 00:10:00 .
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add 1 mL of 80% EtOH to each sample. incubate for 00:00:30
30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash
1m
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in 20 µL of nuclease-free water (away from magnet). Let elute for ~ 00:02:00
2m
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer 20 µL of eluant to a new tube (On ice ).
2m
Split the eluant in 2 tubes. Store half (10 µL ) at -20 °C , and continue with the other 10 µL .
2m
PCR amplification
Prepare the PCR Mix:
| A | B | C | |
| 1 tube | n+1 tubes | ||
| NEBNext High-Fidelity 2X PCR Master Mix | 25 µl | ||
| RP1 | 2 µl | ||
| H2O (nuclease free) | 11 µl |
NEBNext® High-Fidelity 2X PCR Master MixNew England BiolabsCatalog #M0541L
RP1 (Illumina RNA PCR Primer 1):
5’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
3m
Add 36 µL of the PCR Mix to each 10uL sample.
1m
To each sample, add 2 µL of one Illumina TruSeq Small RNA Index Adapter (RPI Series). When choosing indexes, keep in mind your sequencing arrangements (it's not advisable to have 2 samples with the same index, even if they come from different organisms).
Note
We usually avoid the following indexes: RPI10, RPI24, RPI41
Adaptor sequences (Illumina TruSeq Small RNA Index Adapter, RPI Series) are here : Illumina_RPI_sequences.xlsx9.5KB
Illumina_RPI_sequences.xlsx9.5KB 1m
Incubate at 98 °C for 00:00:30 ,
then run either 7 or 8 cycles of: 98 °C for 00:00:10 , 60 °C for 00:00:30 , 72 °C for 00:00:30 ;
then 72 °C for 00:10:00 ,
and finally hold at 4 °C
30m
Bead Cleanup
Add 40 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at Room temperature for 00:15:00 .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
Resuspend in 25 µL of nuclease-free water (away from magnet). Let elute for ~ 00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer 25 µL of eluant to a new tube.
Bead Cleanup
Add 20 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at Room temperature for 00:15:00 .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add 1 mL of 80% EtOH to each sample. Incubate for 00:00:30
30s
Remove the supernatant.
Repeat the 80% EtOH wash
Dry up the beads (until they should lose their shimmer, up to 00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
Resuspend in 10 µL of nuclease-free water (away from magnet). Let elute for ~ 00:02:00
Place each sample in magnet rack. Once the beads have coalesced on the side of the tube and the eluant is clear, transfer 10 µL of eluant to new tubes.
Label these tubes carefully for they contain the final library. Store at -20C if not planning on measuring concentration and size distribution soon,
Measure the concentration with a Qubit High Sensitivity DNA assay.
Measure the distribution of lengths of the library with a High Sensitivity DNA Bioanalyser.
Store at -20C if not planning on sequencing soon.
Expected result
the concentration should be greater than 1ng/uL, and the average length should be around 500-600nt.
Example library size distribution with a High Sensitivity DNA Bioanalyser.
The peaks, particularly evident in B, are due to the ChIC fraction of the library. The smoother curve is due to the RNA fraction of the library.
Proceed to sequence each library at a depth of ~60M reads per plate.
Note
We have used Ilumina NextSeq 2000 or Novaseq 6000, 2 x 100 bp, with 10% PhiX spike in, low complexity region: NNNNNNNNNNNTNNNNNNNNNNN .