Mar 28, 2020
Version 3
Viral Sequencing, from Gunk to Graph (Two-step, strand-switching) V.3
- 1Malaghan Institute of Medical Research (NZ)
- Coronavirus Method Development Community
Protocol Citation: David A Eccles 2020. Viral Sequencing, from Gunk to Graph (Two-step, strand-switching). protocols.io https://dx.doi.org/10.17504/protocols.io.bebujanw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: March 28, 2020
Last Modified: March 28, 2020
Protocol Integer ID: 34900
Keywords: SARS-CoV-2, COVID-19, nanopore, sequencing,
Abstract
This is a fast "gunk to graph" protocol for analysing viral RNA from nasopharyngeal swabs. The approach involves swab lysis and inactivation at the point of sampling, uses a cellulose binding / wash protocol to reduce extraction cost, incorporates sample-specific barcodes during first-strand synthesis, nanopore rapid-attachment primers during PCR amplification, and nanopore sequencing with parallel RAMPART analysis for fast assembly and phylogenetics.
Guidelines
When testing, make sure to include at least one positive control (e.g. synthetic plasmid including partial viral sequence) and at least one negative control (e.g. nuclease-free water).
Materials
MATERIALS
Q5 Hot Start High-Fidelity 2X Master Mix - 500 rxnsNew England BiolabsCatalog #M0494L
MinION sequencerOxford Nanopore Technologies
ONT MinION Flow Cell R9.4.1Oxford Nanopore TechnologiesCatalog #FLO-MIN106D
Additional materials TBA.
Safety warnings
This protocol is UNTESTED, and is in the early stages of development. Do not trust the protocol; question everything.
Assume samples are potentially infectious during extraction, and make sure to use proper sterile technique to avoid cross-contamination.
Swab Lysis
Swab Lysis
Prepare a 1.5 mL centrifuge tube with heated lysis buffer and a cellulose disc
- 10 millimolar (mM) Tris
- 10 millimolar (mM) EDTA
- 0.5 % volume SDS
- 150 millimolar (mM) NaCl
- 800 millimolar (mM) guanidine hydrochloride
- 50 millimolar (mM) Tris [pH 8]
- 0.5 % volume Triton X100
- 1 % volume Tween-20
Preheat 1.5 mL tube to 60 °C
Collect sample using a sterile polystyrene swab with a 30mm breakpoint (e.g. Puritan 25-3606-U; PurFlock Ultra 6" Sterile Elongated Flock Swab w/Polystryene Handle, 30mm Breakpoint).
Break swab and place into the prepared 1.5 mL tube with lysis buffer to remove the outer viral shell and release RNA.
Vortex tube for 00:00:30 , then incubate tube at 60 °C for 00:10:00 [10-30 mins] to inactivate viral proteins.
RNA Wash
RNA Wash
Transfer disc to a new 1.5 mL tube containing 200 µL wash buffer using a pipette tip to remove contaminants:
- 10 millimolar (mM) Tris [pH 8.0]
- 0.1 % volume Tween-20
Incubate tube at Room temperature for 00:01:00
cDNA Synthesis
cDNA Synthesis
Transfer disc to a new 200 µL PCR tube using a pipette tip
Add the following additional components into the 200 µL PCR tube (see the Nanopore protocol for Sequence-specific cDNA-PCR Sequencing (SQK-PCS109)) in a 11 µL reaction:
- 1 µL x 2 micromolar (µM) reverse primersμl
- 1 µL x 10 millimolar (mM) dNTPs
- 9 µL RNAse-free water
Reverse primers should be prefixed with sample-specific barcode sequences (if used) and the ONT reverse anchor sequence, i.e. [5' - ACTTGCCTGTCGCTCTATCTTC - [barcode] - [sequence-specific] - 3']
A potential primer pool are the reverse/right ARCTIC primers (and amplification control) with barcodes and ONT anchor sequences from here.
Mix gently by flicking the tube and spin down 00:00:05
Denature RNA and anneal primers at 65 °C for 00:05:00 and then snap cool on a pre-chilled freezer block for 00:01:00
In a separate tube, mix together the following in an 8 µL reaction:
- 4 µL 5X RT Buffer
- 1 µL RNAseOUT
- 1 µL Nuclease-free water
- 2 µL x 10 micromolar (µM) ONT Strand-switching primer (SSP)
Mix gently by flicking the tube and spin down 00:00:05
Add the strand-switching buffer to the snap-cooled, annealed RNA, mix by flicking the tube and spin down
Incubate at 42 °C for 00:02:00
Add 1 µL of Maxima H Minus Reverse Transcriptase, to a total volume of 20 µL
Mix gently by flicking the tube and spin down 00:00:05
Incubate using the following protocol:
| Cycle step | Temperature | Time | No. of cycles | |
| Reverse transcription and strand-switching | 42° C | 90 mins | 1 | |
| Heat inactivation | 85° C | 5 mins | 1 | |
| Hold | 4° C | ∞ |
Thermal cycler settings for reverse transcription and strand switching
PCR amplification
PCR amplification
In four new 200 µL PCR tubes, prepare the following reaction at Room temperature in a 50 µL reaction:
- 25 µL 2X Q5 Hot Start High-Fidelity Master Mix
- 1.5 µL cDNA primer (cPRM)
- 18.5 µL Nuclease-free water
- 5 µL Reverse-transcribed cDNA from the previous step (pool, or single sample)
Amplify using the following cycling conditions:
| Cycle step | Temperature | Time | No. of cycles | |
| Initial denaturation | 95 °C | 30 secs | 1 | |
| Denaturation | 95 °C | 15 secs | 10-40* | |
| Annealing | 62 °C | 15 secs | 10-40* | |
| Extension | 65 °C | 50 secs per kb | 10-40* | |
| Final extension | 65 °C | 6 mins | 1 | |
| Hold | 4 °C | ∞ |
Thermal cycler settings for PCR amplification
* Starting from viral RNA, the recommended starting point is 20 cycles - adjust this depending on experimental needs.
Add 1 µL of NEB Exonuclease 1 (20 units) directly to each PCR tube to remove unextended primers. Mix by pipetting.
Incubate the reaction at 37 °C for 00:15:00 , followed by 80 °C for 00:15:00
Run 1μl of amplified product on a gel (or similar length-based QC device) to verify that amplified products exist at the expected length. Because this is a strand-switch protocol, there may be a smear of template DNA rather than specific bands.
Bead Cleanup
Bead Cleanup
Add 160 µl of resuspended AMPure XP beads to the 1.5 mL tube and mix by pipetting
Incubate on a gentle agitator (e.g. hula mixer or rotator mixer) for 00:05:00 at Room temperature
Spin down 00:00:05 the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
Keep the tube on the magnet and wash the beads with 200 µL of freshly-prepared 70 % volume ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step: wash with 200 µL 70 % volume ethanol , and discard the ethanol / wash liquid.
Spin down 00:00:05 and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for 00:00:30 [at most] but do not dry the pellet to the point of cracking (the magnetic beads should just start to lose their shiny sheen).
Remove the tube from the magnetic rack and resuspend pellet in 12 µL of Elution Buffer (EB).
Incubate at Room temperature for00:10:00
Pellet beads on magnet 00:05:00 until the eluate is clear and colourless
While still on the magnet, carefully remove and retain 12 µL of eluate into a clean 1.5 mL Eppendorf DNA LoBind tube
Quantify 1 µl of the amplified cDNA library using the Quantus Fluorometer using the ONE dsDNA assay (see ncov 2019 sequencing protocol, step 16)
Adapter Addition
Adapter Addition
Add 1 µL of Rapid Adapter (RAP) to the amplified cDNA library
Mix by pipetting and spin down 00:00:05
Incubate the reaction for 00:05:00 at Room temperature
Store the prepared library On ice until ready to load onto a flow cell.
Nanopore Sequencing
Nanopore Sequencing
Start the sequencing run using MinKNOW, using SQK-PCS109 as the sample preparation protocol
RAMPART Analysis
RAMPART Analysis
Analyse the run results using RAMPART (see https://artic.network/ncov-2019/ncov2019-using-rampart.html)