Jun 26, 2026
Verification of Clostridioides difficile NCTC 12727 genome assembly via junction PCR
- Samiksha Venkatesan1,
- Michael Macey2,
- Uzaira Saniah1,
- Ernesto Abel-Santos3,4,
- Rachel McMullan5,
- Ilias Kounatidis5,
- Terry Bilverstone1
- 1Anaerobes in Medicine (AiM Lab), School of Life, Health and Chemical Sciences, The Open University, Milton Keynes, United Kingdom;
- 2AstrobiologyOU, School of Environment, Earth and Ecosystem Sciences, The Open University, Milton Keynes, United Kingdom;
- 3Department of Chemistry and Biochemistry, University of Nevada–Las Vegas, Las Vegas, USA;
- 4Nevada Institute of Personalized Medicine, University of Nevada–Las Vegas, Las Vegas, USA;
- 5School of Life, Health and Chemical Sciences, The Open University, Milton Keynes, United Kingdom
Protocol Citation: Samiksha Venkatesan, Michael Macey, Uzaira Saniah, Ernesto Abel-Santos, Rachel McMullan, Ilias Kounatidis, Terry Bilverstone 2026. Verification of Clostridioides difficile NCTC 12727 genome assembly via junction PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl4mkq8lo5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We have used this protocol and it works.
Created: June 25, 2026
Last Modified: June 26, 2026
Protocol Integer ID: 319841
Keywords: nctc 12727 genome assembly, verification of clostridioide, genome assembly, clostridioide, junction pcr this protocol, junction pcr, nctc
Abstract
This protocol describes the conditions used for validating the Clostridioides difficile NCTC 12727 genome assembly by junction PCR.
Materials
- Deionised water
- Purified DNA of C. difficile NCTC 12727, 20 ng/uL
- Q5® High-Fidelity DNA Polymerase – NEB
- 5X Q5® Reaction Buffer – NEB
- Deoxynucleotide (dNTP) Solution Mix – NEB
- 10 µM Primer stocks – IDT
- Agarose – Sigma Aldrich
- 1X TAE Electrophoresis Buffer – 50X obtained from Thermo Fisher Scientific, then diluted 50-fold in deionised water
- SYBR Safe DNA Gel Stain – Thermo Fisher Scientific
- 6X Purple Gel Loading Dye (no SDS) – NEB
- 1 Kb Plus DNA Ladder – Thermo Fisher Scientific
Method
Fifteen primers were designed for the eight junctions, tabulated below with the expected product size for each pair and their annealing temperature, calculated on NEB Tm calculator (https://tmcalculator.neb.com/#!/main). Primer C6+ F is used twice and has been italicised.
| A | B | C | D | E | |
| Junction | Primer name | Sequence | Product size (bp) | Annealing temp (°C) | |
| 1 | C5- F | GTCCCTATAGCTTTGCGTC | 756 | 60 | |
| C1+ R | CTGTATAAAATGCAGTTATAGAACC | ||||
| 2 | C1+ F | GTTTCGGGTATACTTATGTC | 826 | 58 | |
| C6+ R1 | GTTTACTTTCTGCATGAACG | ||||
| 3 | C6+ F | GTGCGAGGATTGATTAAG | 731 | 59 | |
| C2+ R | CTTTCTTTTGATGGAATCAAGTC | ||||
| 4 | C2+ F | GCTTCTTCTTGGTCATGTG | 865 | 61 | |
| C5+ R | GAACAATATCTTTTTGGCAACTG | ||||
| 5 | C5+ F | CATAAACATATGGTGAAATTAGAAG | 809 | 58 | |
| C4+ R | CAATAAGTGATTCAGCTATGG | ||||
| 6 | C4+ F | CTCTATATGTCTGGTAAACCTTTTC | 889 | 58 | |
| C6+R2 | CGAACCGTCATTCATTAC | ||||
| 7 | C6+ F | GTGCGAGGATTGATTAAG | 826 | 58 | |
| C3- R | CATGTTATTCATATCCATCCC | ||||
| 8 | C3- F | GGACTTACTGTAGAAGTTG | 817 | 57 | |
| C5- R | CCACAATTACATAAACATATGGTG |
Two 10 µL PCRs were set up per junction – one test and one negative control. All test reactions had the DNA template of purified C. difficile NCTC 12727 DNA, while the negative control reactions were inoculated with the equivalent volume of deionised water. See the table below for the composition of each 10 µL reaction.
| A | B | |
| Reagent | Volume (µL) | |
| Deionised water | 6.5 | |
| 5X Q5 Reaction buffer | 2.0 | |
| Forward primer (10 µM) | 0.5 | |
| Reverse primer (10 µM) | 0.5 | |
| dNTP Solution Mix | 0.2 | |
| Q5 High-Fidelity DNA Polymerase | 0.1 | |
| DNA template (or deionised water) | 0.2 |
These sixteen PCRs were run in the thermal cycler using the conditions below.
| A | B | C | D | |
| Step | Temperature (°C) | Time | No. of cycles | |
| Initial denaturation | 98 | 30 sec | 1 | |
| Denaturation | 98 | 10 sec | 30 | |
| Annealing | 57-61 | 30 sec | ||
| Extension | 72 | 1 min | ||
| Final extension | 72 | 2 min | 1 |
While the PCRs were running, 75 mL of molten 0.75 % agarose (in 1x TAE Electrophoresis Buffer) was used to make a gel for electrophoresis, containing 7.5 µL SYBR Safe DNA Gel Stain.
Once the PCRs were complete, 2 µL 6X Purple Gel Loading Dye (no SDS) was added to each reaction, then they were loaded onto the gel, along with 10 µL 1 Kb Plus DNA Ladder. The gel was run for at 100V for 50 min, then imaged using a gel transilluminator.