Ventral Midbrain Genomic PCR

madalynn.erb Erb

Apr 05, 2024

Ventral Midbrain Genomic PCR

DOI

https://dx.doi.org/10.17504/protocols.io.kqdg324zzv25/v1

madalynn.erb Erb¹

¹Van Andel Research Institute

Team Lee

Jane Balster

ASAP - Team Lee

DOI: https://dx.doi.org/10.17504/protocols.io.kqdg324zzv25/v1

Protocol Citation: madalynn.erb Erb 2024. Ventral Midbrain Genomic PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg324zzv25/v1

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: February 12, 2024

Last Modified: May 31, 2024

Protocol Integer ID: 97844

Keywords: ASAPCRN, ventral midbrain genomic pcr this protocol detail, ventral midbrain genomic pcr

Disclaimer

The protocols.io team notes that research involving animals and humans must be conducted according to internationally-accepted standards and should always have prior approval from an Institutional Ethics Committee or Board.

Abstract

This protocol details ventral midbrain genomic PCR.

Materials

Stainless Steel Brain Matrices, 1.0mmStoeltingCatalog #51386  QIAgen DNeasy Blood and Tissue Kit, 50 rxnQiagenCatalog #69504  GeneJET PCR Purification KitThermo Fisher ScientificCatalog #K0702  

ABC
ReagentFinal conc.ul/sample
5X KAPA2G Buffer A1.3X6.5 µl
25 mM MgCl2 2.60 mM2.6 µl
10 mM KAPA dNTP Mix0.26 mM0.65 µl
Forward primer (10 µM)  CTGCAGCTTCGAGAGGAAAG0.5 µM0.5 µl
Flox reverse primer (10 µM) CACTCTGTCCTCAGGCTTTC0.5 µM0.5 µl
KO reverse primer (10 µM) AGGTGGGAATCGGGCTAGAG0.5 µM0.5 µl
50% Glycerol6.50 %3.25 µl
5 U/ µl KAPA2G Fast Hotstart DNA Polymerase0.5 U/ul0.1 µl
DNA (diluted to 25 ng/uL)150 ng total6.0 µl
H2Oto 25 ul

4.4 µl

Brain tissue collection

Euthanize mouse via cervical dislocation.

Isolate 2 mm   coronal midbrain section using stainless steel brain matrix (Stoelting 51386).

Remove cortex and dorsal midbrain tissue.

Separate ipsilateral and contralateral ventral midbrain regions.

Immediately freeze on dry ice and store tissue at -80 °C   until DNA extraction.

DNA extraction from frozen brain tissue

Use Qiagen DNeasy Blood and Tissue Kit (Cat 69504).

Equilibrate ventral midbrain tissue to Room temperature  .

Note
Starting material amount ~15 mg   of tissue.

Cut tissue into small pieces.

Use a pipette tip to transfer tissue to a sterile 6cm dish.

Add 180 µL   of Buffer ATL to the tissue.

Dice up tissue with sterile scalpel.

Transfer tissue and buffer to 1.5mL etube.

Add 20 µL   Proteinase K to each sample.

Mix thoroughly by vortexing.

Incubate at 56 °C   until samples are completely lysed.

Note
Use thermomixer – check samples after 01:00:00  , may take up to 03:00:00  .

Add 4 µL   RNase A (100 µL  ) to each sample.

Mix by vortexing.

Incubate at Room temperature   for 00:02:00  .

Mix Buffer AL with ethanol 1:1.

Add 400 µL   Buffer AL / ethanol mix to each sample.

Vortex for 00:00:15  .

15s

Transfer samples to DNeasy Mini spin columns (placed in 2mL collection tubes).

Centrifuge at ≥6000 x g  for 00:01:00  .

Discard flow through.

Transfer column to new collection tube.

Add 500 µL   Buffer AW1.

Centrifuge at ≥6000 x g  for 00:01:00  .

Discard flow through and collection tube.

Place the column in a new collection tube – add 500 µL   Buffer AW2.

Centrifuge 20000 x g  for 00:03:00   to dry the column.

Carefully remove the column to avoid contamination with residual ethanol.

If the column touches ethanol flow through, spin again in new collection tube for 00:01:00  .

Place the column in clean 1.5mL etube – add 150 µL   of elution buffer (Buffer AE).

Incubate at Room temperature   for 00:01:00  .

Centrifuge at ≥6000 x g  for 00:01:00   to elute DNA.

Genomic PCR

DNA concentration measured using a NanoDrop One Spectrophotometer (Thermofisher Scientfiic).

All samples diluted to 25 µL   with Buffer AE.

Use the Kapa2g Fast HotStart PCR Kit (Roche 07960930001) according to the manufacturer’s instructions.

 
ABC
ReagentFinal conc.ul/sample
5X KAPA2G Buffer A1.3X6.5 µl
25 mM MgCl2 2.60 mM2.6 µl
10 mM KAPA dNTP Mix0.26 mM0.65 µl
Forward primer (10µM)0.5 µM0.5 µl
CTGCAGCTTCGAGAGGAAAG
Flox reverse primer (10µM)0.5 µM0.5 µl
CACTCTGTCCTCAGGCTTTC
KO reverse primer (10µM)0.5 µM0.5 µl
AGGTGGGAATCGGGCTAGAG
50% Glycerol6.50%3.25 µl
5 U/ µl KAPA2G Fast Hotstart DNA Polymerase0.5 U/ul0.1 µl
DNA (diluted to 25ng/uL)150ng total6.0 µl
H2Oto 25 ul4.4 µl
 

PCR Cycle:
ABCD
StepTemp (°C)TimeNote
194.0 °C5 min.
294.0 °C30 sec.
365.0 °C

15 sec.-0.5 °C per cycle decrease

468.0 °C1 sec.
5repeat steps 2-4 for 10 cycles (touchdown)
694.0 °C30 sec.
760.0 °C

15 sec.
872.0 °C

1 sec.
9repeat steps 6-8 for 20 cycles

1072.0 °C

5 min.
114.0 °CholdHold

Run samples on 2% Agarose gel at 100V for 35-45 minutes.

AB
Wild type allele400 bp
Flox allele 500 bp
KO allele 270 bp

A	B	C
Reagent	Final conc.	ul/sample
5X KAPA2G Buffer A	1.3X	6.5 µl
25 mM MgCl2	2.60 mM	2.6 µl
10 mM KAPA dNTP Mix	0.26 mM	0.65 µl
Forward primer (10 µM) CTGCAGCTTCGAGAGGAAAG	0.5 µM	0.5 µl
Flox reverse primer (10 µM) CACTCTGTCCTCAGGCTTTC	0.5 µM	0.5 µl
KO reverse primer (10 µM) AGGTGGGAATCGGGCTAGAG	0.5 µM	0.5 µl
50% Glycerol	6.50 %	3.25 µl
5 U/ µl KAPA2G Fast Hotstart DNA Polymerase	0.5 U/ul	0.1 µl
DNA (diluted to 25 ng/uL)	150 ng total	6.0 µl
H2O	to 25 ul	4.4 µl

A	B	C	D
Step	Temp (°C)	Time	Note
1	94.0 °C	5 min.
2	94.0 °C	30 sec.
3	65.0 °C	15 sec.	-0.5 °C per cycle decrease
4	68.0 °C	1 sec.
5			repeat steps 2-4 for 10 cycles (touchdown)
6	94.0 °C	30 sec.
7	60.0 °C	15 sec.
8	72.0 °C	1 sec.
9			repeat steps 6-8 for 20 cycles
10	72.0 °C	5 min.
11	4.0 °C	hold	Hold