Sep 15, 2022
Validation of Genotyping Method for L444P Mice Ear-Clips
- Revi Shahar Golan1,
- David C1
- 1Department of Clinical and Movement Neurosciences, Institute of Neurology, University College London, London NW3 2PF, UK
Protocol Citation: Revi Shahar Golan, David C 2022. Validation of Genotyping Method for L444P Mice Ear-Clips. protocols.io https://dx.doi.org/10.17504/protocols.io.261ge4dewv47/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 02, 2020
Last Modified: May 31, 2024
Protocol Integer ID: 45154
Keywords: NC_000069.7, genotype, genotyping, PCR, ear tag, L444P, Neo, ASAPCRN, method for l444p mice ear, l444p mice ear, l444p protein, gel electrophoresi, interpretation of the gel electrophoresi, genotyping method, genotyping, heterozygote, digestion method, pcr primer, mice, hetero sample, pcr program
Abstract
Aim: the genotyping is used to identify if mice are heterozygote (hetero) or Wild-Type (WT), and the aim of the work is to validate the digestion method, and PCR program, the PCR primers, and the interpretation of the results.
General notes: There are two sets of primers – Neo primers to distinguish between WT and hetero samples, and L444P primers to detect L444P protein. Negative and positive samples are used to verify the digestion and PCR, by gel electrophoresis. Sequencing is used to verify the interpretation of the gel electrophoresis.
Guidelines
The sequence: (ACCESSION NC_000069) we look at GACTTGGAAACAG (about 230 to 240 on a sequencing histogram): hetero/WT are shown below, with the yellow highlighted part can either be ttg/ccg (L/P) for hetero (+/Δ), or ttg (L) for wt (+/+).
Materials
Materials
- Proteinase K (Roche, cat 10241100)
- Direct PCR (EaR) lysate buffer (Viagen, cat 402-E)
- Reaction buffer (VWR-Peqlab, cat 01-1020)
- DNA Taq polymerase (VWR-Peqlab, cat 01-1020)
- dNTP mix (40mM; VWR, cat 5100850-0500)
- RNase/DNase-free H2O (Promega, cat P1193)
- pre-cast 2% SYBR-safe E-GEL (ThermoFisher, cat G521802)
- 100bp DNA ladder (NEB, N3231)
Primers details
Neo1: 5’GATTGCACGCAGGTTCTCCG3’
Neo2: 5’CCAACGCTATGTCCTGATAG3’
L444P_F: 5’CCCCAGATGACTTGATGCTGG3’ (marked in bold, an extra T, that does not appear on the sequence)
L444P_R: 5’CCAGGTCAGGATCTCTGATGG3’
Equipment
- Thermalcycler
- Gel apparatus
Safety warnings
Please refer to the Safety Data Sheets (SDS) for health and environmental hazards.
Digestion
2h 30m
Prepare Digestion mix: 15 µL Proteinase K (Roche, cat 10241100) per 1000 µL Direct PCR (EaR) lysate buffer (Viagen, cat 402-E).
Add 50 µL digestion mix to each ear clip sample.
Heat for 55 °C , 05:00:00 .
5h
Heat 99 °C for 00:10:00 .
10m
Cool to 10 °C .
Samples can be stored in -20 °C until use.
PCR
4d
Prepare PCR master mix (MM) as below (per sample):
- 2.5 µL Reaction buffer (VWR-Peqlab, cat 01-1020)
- 0.25 µL DNA Taq polymerase (VWR-Peqlab, cat 01-1020)
- 0.5 µL Forward primer (10pmol/ µl)
- 0.5 µL Reverse primer (10pmol/ µl)
- 0.5 µL dNTP mix (40mM; VWR, cat 5100850-0500)
- 19.25 µL RNase/DNase-free H2O (Promega, cat P1193)
Note
Primers details:
Neo1: 5’GATTGCACGCAGGTTCTCCG3’
Neo2: 5’CCAACGCTATGTCCTGATAG3’
L444P_F: 5’CCCCAGATGACTTGATGCTGG3’ (marked in bold, an extra T, that does not appear on the sequence)
L444P_R: 5’CCAGGTCAGGATCTCTGATGG3’
For each sample, add 23.5 µL MM and 1.5 µL digested sample .
PCR program:
| A | B | C | |
| Temp | Time | Cycles | |
| 94°C | 5 min | ||
| 94°C | 30 sec | 35 cycles | |
| 55°C | 1 min | ||
| 72°C | 1 min | ||
| 4°C | forever |
PCR product can be kept in 4 °C for the short term, or at -20 °C .
Gel electrophoresis
30m
Run PCR products on a pre-cast 2% SYBR-safe E-GEL (ThermoFisher, cat G521802), for 00:30:00 , along with a 100bp DNA ladder (NEB, N3231), and a negative control (no DNA, only MM).
Expected result
For Neo primers, expected results are band at ~500bp for hetero samples and no band for wt (band for positive control, no band for negative control).
For L444P primers, expected results are a band for every sample (band for positive, no band for negative).
Expected result
Results of validations:
Below in a gel image of L444P samples (MEFs and ear clips) that were digested and amplified as described above.
C2 and C14 are MEF samples. 1555572, 155303, 155573 are ear clips digestions, pos sample is a hetero samples that was verified by sequencing.
Top gel image shows samples run with NEO primers
Bottom gel image shows samples run with L444P primers
The gel show that C2 is hetero (band for both Neo and L444P), and that C14 is wt (no band for Neo, and a clear band for L444P). The sequencing results verify the identification of C2 and C14.
Expected result
Sequence validations:
In order to validate the interpretation of the gel, the PCR products were sent to sequencing:
Note
When genotyping L444P ear-clips, to identify hetero/wt, one can run PCR of the digested material with Neo primers beside L444P primers (including positive and negative control), and identify by the presence/lack of band whether it is hetero or wt. There is need to sequence the PCR product.
30m
Routine check of ear clips:
Run digested ear clips with NEO primers in the first instance. Then choose one of three options:
- If the ratio wt:hetero is 1:3, there is no need for further tests. Wt animals to be terminated.
- If there are more wt than the 1:3 ratio, this suggested poor DNA for the samples that were not amplified, so need to amplify with L444P primers the samples that did not work, and sequence them.
- If there are much more hetero than the 1:3 ratio, need to sequence all the samples.