Dec 26, 2025
UTAG-seq: accurate detection of somatic mutations by single-cell duplex-sequencing
- Yichi Niu1,
- Chenghang Chuck Zong1
- 1Baylor College of Medicine
Protocol Citation: Yichi Niu, Chenghang Chuck Zong 2025. UTAG-seq: accurate detection of somatic mutations by single-cell duplex-sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly5z8mvx9/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 17, 2025
Last Modified: December 26, 2025
Protocol Integer ID: 235271
Keywords: cell somatic mutation detection, accurate detection of somatic mutation, seq to individual human umbilical cord blood cell, somatic mutation, somatic mutation detection, individual human umbilical cord blood cell, comprehensive genome coverage, cell duplex, characterization of somatic mosaicism, somatic mosaicism, sequencing method, cell, utag
Funders Acknowledgements:
Yichi Niu
Grant ID: 1UG3NS132132
Chenghang Zong
Grant ID: 1UG3NS132132
Disclaimer
Patent application covering UTAG-seq chemistry has been filed by Baylor College of Medicine.
Abstract
Here, we developed UTAG-seq, a single-cell duplex-sequencing method that enables comprehensive genome coverage. Applying UTAG-seq to individual human umbilical cord blood cells, we validated the somatic mutation calling accuracy to be < 10-9. Together, these results demonstrate that UTAG-seq supports highly accurate single-cell somatic mutation detection and will facilitate the characterization of somatic mosaicism across diverse biological contexts.
Protocol materials
Protease (20 mg/mL)Qiagen
DEPC-treated waterAmbionCatalog #AM9915G
0.5M EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #E7889-100ML
10% Triton X-100 solutionMerck MilliporeSigma (Sigma-Aldrich)
1 M KClThermo Scientific
10% NP40Amresco
UltraPure™ 1M Tris-HCI, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
5M NaClInvitrogen - Thermo FisherCatalog #AM9760G
Tn5 transposase, unloadedDiagenodeCatalog #C01070010-20
GlycerolMerck MilliporeSigma (Sigma-Aldrich)Catalog #G5516-100ML
5X TB1Illumina, Inc.
Q5U® Hot Start High-Fidelity DNA PolymeraseNew England BiolabsCatalog #M0515
dNTP solution mix (10 mM each)New England BiolabsCatalog #N0447
10X ThermoPol BufferNew England Biolabs
Thermolabile Proteinase KNew England BiolabsCatalog #P8111S
Thermolabile USER II Enzyme - 50 unitsNew England BiolabsCatalog #M5508S
10X T4 Ligase bufferNEB
T4 DNA LigaseNew England BiolabsCatalog #M0202L
Deep Vent DNA Polymerase - 200 unitsNew England BiolabsCatalog #M0258S
Evagreen dye, 20x in waterBiotiumCatalog ##31000
Ampure XP beadsBeckmanCatalog #A63881
NEBNext Ultra II Q5 Master MixNew England BiolabsCatalog #M0544X
Cell lysis
3h 20m
Prepare cell lysis buffer (2.5 uL per cell)
0.075 µL UltraPure™ 1M Tris-HCI, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
0.01 µL 0.5M EDTAMerck MilliporeSigma (Sigma-Aldrich)Catalog #E7889-100ML
0.05 µL 1 M KClThermo Scientific
0.025 µL 10% Triton X-100 solutionMerck MilliporeSigma (Sigma-Aldrich)
0.09 µL 10% NP40Amresco
0.12 µL Protease (20 mg/mL)Qiagen
2.13 µL DEPC-treated waterAmbionCatalog #AM9915G
Sort single cell/nuclei into individual PCR tube or well. Incubate at 50 °C 03:00:00 75 °C 00:20:00 to perform cell lysis. Lysed cells can be stored at -80 °C .
3h 20m
Custom Tn5 transposase assembly
40m
Prepare 500 µL 2X Annealing buffer.
40 µL UltraPure™ 1M Tris-HCI, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
10 µL 5M NaClInvitrogen - Thermo FisherCatalog #AM9760G
450 µL DEPC-treated waterAmbionCatalog #AM9915G
Transposon annealing.
20 µL 2X Annealing buffer
10 µL 200 micromolar (µM) ME_REV
10 µL 200 micromolar (µM) T1ME_U
Oligonucleotides sequences
ME_REV: /5Phos/CTGTCTCTTATACACATCT
T1ME_U: TCGUCGGCAGCGUC AGATGTGTAUAAGAGACAG
90 °C 00:05:00
65 °C 00:05:00 Ramp rate 0.1ºC/s
4 °C Hold, Ramp rate 0.1ºC/s
10m
Custom Tn5 assembly.
20 µL Tn5 transposase, unloadedDiagenodeCatalog #C01070010-20
20 µL Annealed transposon mix
Incubate at 23 °C 00:30:00 . Add 20 µL GlycerolMerck MilliporeSigma (Sigma-Aldrich)Catalog #G5516-100ML . Mix well and brief centrifuge. Store at -20 °C .
30m
Single-cell UTAG procedure
3h 4m 30s
Prepare tagmentation mix (2.5 uL per cell).
1 µL 5X TB1Illumina, Inc.
0.5 µL 10 millimolar (mM) MgCl2
0.2 µL U-Tn5 (1:200 diluted)
0.8 µL DEPC-treated waterAmbionCatalog #AM9915G
Gently mix and briefly spin down. Incubate at 25 °C 00:50:00 37 °C 00:05:00 .
Note: the activity of purchased Tn5 transposase may vary between different batches. The goal of this step is to tagment gDNA to an average of ~200 bp fragments. Please adjust the amount of enzyme at this step if needed.
55m
Tn5 inactivation.
Add 1 µL 0.2 Molarity (M) EDTA. Incubate at 50 °C 00:30:00 .
30m
Gap filling.
Add 1 µL 0.2 Molarity (M) MgCl2.
Add 3 µL Sealing mix:
1 µL 10X ThermoPol BufferNew England Biolabs
1 µL dNTP solution mix (10 mM each)New England BiolabsCatalog #N0447
0.1 µL Q5U® Hot Start High-Fidelity DNA PolymeraseNew England BiolabsCatalog #M0515
0.9 µL DEPC-treated waterAmbionCatalog #AM9915G
Incubate at 65 °C 00:00:30 . Quench reaction on ice. Add 1 µL 0.1 Molarity (M) EDTA. Mix well and briefly spin down. Incubate at Room temperature 00:05:00 .
5m 30s
Add 1 µL Thermolabile Proteinase KNew England BiolabsCatalog #P8111S . Incubate at 25 °C 02:00:00 20 °C Overnight 55 °C 00:12:00 .
USER digestion.
Add 2 µL USER mix:
0.2 µL 10X ThermoPol BufferNew England Biolabs
0.5 µL Thermolabile USER II Enzyme - 50 unitsNew England BiolabsCatalog #M5508S
1.3 µL 10 micromolar (µM) T2ME_ssDNA
Incubate at 37 °C 00:30:00 .
Oligonucleotides sequences
T2ME_ssDNA: GTCTCGTGGGCTCGG AGATGTGTAT
30m
Ligation adapter annealing.
Add 1 µL MgCl2 mix:
0.3 µL 10X ThermoPol BufferNew England Biolabs
0.5 µL 0.2 Molarity (M) MgCl2
0.2 µL DEPC-treated waterAmbionCatalog #AM9915G
Incubate at 55 °C 00:05:00 25 °C 00:05:00 Ramp rate 0.1ºC/s.
10m
Ligation.
Add 6 µL Ligation mix:
2.1 µL 10X T4 Ligase bufferNEB
1 µL T4 DNA LigaseNew England BiolabsCatalog #M0202L
2.9 µL DEPC-treated waterAmbionCatalog #AM9915G
Incubate at 25 °C 00:30:00 65 °C 00:10:00 .
40m
Yield test.
Prepare qRT-PCR mix (10 uL per cell):
1 µL 10X ThermoPol BufferNew England Biolabs
0.25 µL 10 micromolar (µM) T1ME
0.25 µL 10 micromolar (µM) T2ME
0.2 µL dNTP solution mix (10 mM each)New England BiolabsCatalog #N0447
0.15 µL Deep Vent DNA Polymerase - 200 unitsNew England BiolabsCatalog #M0258S
0.5 µL Evagreen dye, 20x in waterBiotiumCatalog ##31000
7.15 µL DEPC-treated waterAmbionCatalog #AM9915G
0.5 µL Template.
Oligonucleotides sequences
T1ME: TCGTCGGCAGCGTC AGATGTGTATAAGAGACAG
T2ME: GTCTCGTGGGCTCGG AGATGTGTATAAGAGACAG
Perform the following program on a qPCR machine.
94 °C 00:02:00
26 cycles of
94 °C 00:00:20
68 °C 00:00:20
72 °C 00:01:00
3m 40s
Amplification step 1.
Add:
1 µL 0.2 Molarity (M) EDTA
1.2 µL 10 micromolar (µM) T2ME_ssDNA
2.5 µL 10 micromolar (µM) Illumina Nextra i5 index
25 µL NEBNext Ultra II Q5 Master MixNew England BiolabsCatalog #M0544X
PCR cycles:
98 °C 00:00:30
11 cycles of
98 °C 00:00:10
63 °C 00:00:30
72 °C 00:01:00
Cycle end
72 °C 00:03:00
Purify with 1.4 X Ampure XP beadsBeckmanCatalog #A63881 . Elute in 20 µL DEPC-treated waterAmbionCatalog #AM9915G .
5m 10s
Amplification step 2.
Add the following reagents to 20 µL purified products.
2.5 µL 10 micromolar (µM) Illumina Nextra i7 index
2.5 µL 10 micromolar (µM) Illumina P5
25 µL NEBNext Ultra II Q5 Master MixNew England BiolabsCatalog #M0544X
Oligo sequences:
Illumina P5: AATGATACGGCGACCACCGAGA
PCR cycles:
98 °C 00:00:30
5 cycles of
98 °C 00:00:10
63 °C 00:00:30
72 °C 00:01:00
Cycle end
72 °C 00:03:00
Purify with 1.4 X Ampure XP beadsBeckmanCatalog #A63881 . Elute in 20 µL DEPC-treated waterAmbionCatalog #AM9915G .
5m 10s