Apr 23, 2024

Using high throughput amplicon sequencing to determine the diet of two generalist stink bugs (Hemiptera) in agricultural and urban landscapes.

Using high throughput amplicon sequencing to determine the diet of two generalist stink bugs (Hemiptera) in agricultural and urban landscapes.
  • 1Ghent University
Icon indicating open access to content
QR code linking to this content
Protocol CitationOlivier Berteloot 2024. Using high throughput amplicon sequencing to determine the diet of two generalist stink bugs (Hemiptera) in agricultural and urban landscapes.. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwdewdlmk/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 02, 2023
Last Modified: April 23, 2024
Protocol  Integer ID: 88662
Keywords: amplicon; NGS; metabarcoding, polyphagous herbivore stink bug species, stink bug species, invasive herbivore insect, observed genera in the diet, feeding interactions in herbivore, herbivore interaction, bug species, herbivore, polyphagous herbivore, dietary composition of polyphagous herbivore, pentatomid herbivore, molecular gut content analysis, establishing effective integrated pest management strategy, pest, detectability of the original host plant, inferring host plant, effective integrated pest management strategy, extensive dna metabarcoding study, bug, original host plant, feeding interaction, dna metabarcoding technique, dna metabarcoding, internal transcribed spacer, use of dna metabarcoding, species, monotypic diet, delivering species, polyphagous diet
Funders Acknowledgements:
VLAIO (Flanders Innovation and Entrepreneurship)
Grant ID: LA-traject HBC.2018.2224
Abstract
The use of DNA metabarcoding has become an increasingly popular technique to infer feeding interactions in herbivores and generalist predators and are especially useful when the organism of interest is polyphagous. Inferring host plant preference of native and invasive herbivore insects can be helpful in establishing effective Integrated Pest Management strategies (IPM). Both stink bugs, Halyomorpha halys, and Pentatoma rufipes, are known pests that cause severe economic damage in agroecosystems, primarily commercial fruit orchards. In this study, we performed Molecular Gut Content Analysis (MGCA) of these two polyphagous herbivore stink bug species using next-generation amplicon sequencing (NGAS) of the Internal Transcribed Spacer 2 (ITS2) barcode region. Additionally, a laboratory experiment with a host switch from a mixed diet to a monotypic diet with H. halys was conducted to determine the detectability of the original host plants in a time series up to 3 days after the host switch occurred. In our field samples, we detected 55 unique plant genera across the two stink bug species. The sampling location significantly impacts the observed genera in the diet of both stink bug species, while we observe no significant seasonal differences. Moreover, this study provides additional support for the efficiency of DNA metabarcoding techniques to infer the dietary composition of polyphagous herbivores, delivering species-level resolution of hostplant-herbivore interactions. Lastly, our study provide an initial framework for more extensive DNA metabarcoding studies further to unravel the polyphagous diet of these two pentatomid herbivores.
Guidelines
NA
Materials
see protocol
Safety warnings
NA
Ethics statement
NA
Before start
NA
Sample collection
From 2019-2022, H. halys and P. rufipes were collected in commercial organic orchards (apple, pear and mixed crops), private orchards and urban gardens. 25 locations were sampled throughout the northern parts of Belgium. P. rufipes specimens were hand-caught by scanning trees, shrubs and wildflowerstrips in and around plots in the sampling area fo00:30:00 , spending 00:01:00 per tree, shrub or flower plot, host plants were recorded. H. halys were collected using live and sticky traps baited with pheromones (Pherocon Trécé BMSB) and checked twice per week.

31m
Collected specimens were placed into clean 1.5 mL tubes (Eppendorf) and immediately frozen on dry ice to be stored in the lab at -80 °C

Dissection
Prior to DNA extraction, leave specimen for 00:00:10 in 1 % bleach solution. After, the alimentary canal was dissected from crop till rectum, flash frozen in liquid nitrogen in a 1.5 mL L tube with 2 stainless steel beads (5mm diameter) and lysed using a TissueLyser II (Qiagen Inc. Valencia CA USA).

10s
DNA extraction
Total DNA was extracted from the dissected guts using the DNeasy Blood and Tissue Kit (Qiagen), following manufacturers' instructions.
PCR and Illumina workflow
Library preparation

First amplification

performed using a customer specific primer pair, which contained an additional Illumina TruSeq adaptor sequence (see below) on 1-10 ng of DNA extract (total volume 1µl).

  • ITS-S2F 5’ GACGTGTGCTCTTCCGATCT
  • ITS-u4 5’ ACACGACGCTCTTCCGATCTR

15 pmol of each forward and reverse primer was used in 20 µL volume of 1x MyTaq buffer containing 1.5 units MyTaq DNA polymerase (Bioline GmbH, Luckenwalde, Germany) and 2 µL of BioStabII PCR Enhancer (Sigma-Aldrich Co.).

Step Duration (sec)Temperature (°C)Cycles
Pre-Denaturation60961
Denaturation159630
Annealing3058
Extention9070
Final holdad ininitum81
Table 1. PCR cycle settings


Second amplification
1 µL of each amplicon obtained in the first PCR was used, and these amplicons were separately amplified in a 20 µL reaction volume using standard i7- and i5- sequencing adaptors.

The second amplification was as first amplification but with a modified annealing temperature, i.e. 3 cycles at 50 °C followed by 7 cycles at 58 °C

Pooling and clean up

DNA concentration of amplicons was assessed by agarose gel electrophoresis.
20 ng of indexed amplicon DNA of each sample was subsequently pooled (up to 96 samples per pool).

The pooled libraries were purified with one volume of Agencourt AMPure XP beads (Beckman Coulter, Inc., IN, USA) to remove primer dimer and other small mispriming products, followed by an additional purification on MiniElute columns (QIAGEN GmbH, Hilden, Germany).
Size selection and sequencing

The size selection was performed by preparative gel electrophoresis on a LMP-Agarose gel. Sequencing was done on an Illumina MiSeq (Illumina, Inc., CA, USA) using V3 Chemistry (2x300bp).
Sequence analysis
Create environment

Hardware environment specs:
  • Processor: AMD Ryzen 5 5600X, 3,7 GHz (4,6 GHz Turbo Boost) - 6-Cores - 12 Threads
  • RAM: Corsair Vengance LPX 128GB (4 x 32GB) DDR4 DRAM 3200MHz C16 Memory Kit
  • Windows 11 Pro, WSL2, Ubuntu Linux 20.04


  1. Unlock processor in BIOS: press del on start up > advanced settings > virtualization > enable
  2. Win key > type: CMD > wsl --install
  3. Download Ubuntu in windows app store & install
  4. Double click Ubuntu to start Ubuntu

5. Install Miniconda
Command
Install Miniconda (Linux)
Miniconda
mkdir -p ~/miniconda3
wget https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh -O ~/miniconda3/miniconda.sh
bash ~/miniconda3/miniconda.sh -b -u -p ~/miniconda3
rm -rf ~/miniconda3/miniconda.sh
6. Initialize Miniconda
Command
Initialize Miniconda (Linux)
~/miniconda3/bin/conda init bash
~/miniconda3/bin/conda init zsh
7. Update minidconda
Command
Update Miniconda (Linux)
conda update conda
8. Install wget
Command
Install wget (Linux)
conda install wget
9. Install Qiime2 (install the shotgun too, it has the rescript pre-installed)
Command
Install QIIME2 (Linux)
wget https://data.qiime2.org/distro/amplicon/qiime2-amplicon-2023.9-py38-linux-conda.yml
conda env create -n qiime2-amplicon-2023.9 --file qiime2-amplicon-2023.9-py38-linux-conda.yml

wget https://data.qiime2.org/distro/shotgun/qiime2-shotgun-2023.9-py38-linux-conda.yml
conda env create -n qiime2-shotgun-2023.9 --file qiime2-shotgun-2023.9-py38-linux-conda.yml
10. Activate Qiime2
Command
Activate QIIME2 (Linux)
conda activate qiime2-amplicon-2023.9

or

conda activate qiime2-shotgun-2023.9
Data state

Data is not multiplexed
Paired-end 2x300bp
Quality scores are Phred 33V
Unzip all .gz files in directory
Command
For loop (Linux)
Unzip
for i in *.gz; do zcat "$i" > "${i%.*}"; done
Data are in following path (example):

/home//RAW/1_R1.fastq
/home//RAW/1_R2.fastq

absolute filepaths are needed for the metadata file, and importing in QIIME2
Metadatafile
Create a metadatafile with following information for all samples

  • absolute forward filepath
  • absolute reverse filepath
  • label
  • location
  • date
  • season
  • coordinates
  • organism
  • life stage
  • type (orchard or garden)
  • landscape (urban or rural)
  • hostplant or trap

Create the metadatafile in Google Sheets

File>download> Tab separated values .tsv
Import data into QIIME2
Command
Import data (QIIME2)
qiime tools import \
  --type 'SampleData[PairedEndSequencesWithQuality]' \
  --input-path metadata.tsv \
  --output-path paired-end-demuxed.qza \
  --input-format PairedEndFastqManifestPhred33V2


Expected result
paired-end-demuxed.qza

A QIIME 2 artifact contains data and metadata. The metadata describes things about the data, such as its type, format, and how it was generated (provenance). A QIIME 2 artifact typically has the .qza extension. Using artifacts instead of data files enables researchers to focus on the analyses they want to perform, instead of the particular format the data needs to be in for an analysis

Trim primers & cut adapters
Command
trim primers & cut adapters (QIIME2)
qiime cutadapt trim-paired \
  --p-cores 6 \
  --i-demultiplexed-sequences paired-end-demuxed.qza \
  --p-front-f GACGTGTGCTCTTCCGATCTATGCGATACTTGGTGTGAAT \
  --p-adapter-r ACACGACGCTCTTCCGATCTRGTTTCTTTTCCTCCGCTTA\
  --o-trimmed-sequences trimmed-seqs.qza \
  --verbose

Expected result
trimmed-seqs.qza

Quality filtering, denoising, dereplication and clustering (DADA2)

Looking at the quality fastqc files for each sample.
All forwards look pretty similar to each other, and all reverses look pretty similar to each other, but worse than the forwards, which is common.

Phred scores of 20 vs 40 means 1 error per 100 bases vs. 1 error per 10000 bases.

The forward scores drop off at 250 bp, we want to maintain a median phred score of 30 (1 error in 1000). Reverse scores drop off around 185 bp. Knowing our ITS2 fragment is around 350-400 base base pairs and we need some overlap for the reverse and forward reads to be merged, in DADA2 this minimum overlap is 12, more is welcome. We will leave a length of 250p forward and 185bp reverse.
Command
DADA2 (QIIME2)
qiime dada2 denoise-paired \
  --i-demultiplexed-seqs trimmed-seqs.qza \
--p-chimera-method pooled \
--p-pooling-method pseudo \
  --p-trunc-len-f 250 \
--p-trunc-len-r 185\
--p-trunc-q 0 \
--p-n-threads 10 \
  --o-representative-sequences rep-seqs.qza \
  --o-table table-dada2.qza \
  --o-denoising-stats stats-dada2.qza \
--verbose

Expected result
  • rep-seqs.qza (all sequences present, dereplicated)
  • table-dada2.qza (frequency table)
  • stats-dada2.qza (per sample input sequences and output sequences, filtered, percentage passed, denoised, merged, percentage of input merged)

Local ITS2 BLAST database development

We want to identify the ASV's (rep-seqs.qza), their frequency, and occurence is linked to the frequency table through an ID. But first we must make a local BLASTn ITS2 database of plants
Retrieve available plant ITS2 sequences via NCBI Entrez text query:
Command
ITS2 plant sequences NCBI text query (Linux)
((viridiplantae[Organism] AND its2) AND 100:10000000[Sequence Length]) NOT (uncultured OR environmental sample OR incertae sedis OR unverified)
The resulting records were then downloaded via the “Send to” menu :

send to > Complete record > File > Format: Fasta
Rename file and check whether all records were retrieved
Command
Rename (Linux)
mv sequence.fasta NCBI_Viridiplantae_ITS2_fasta_file

grep -c ">" NCBI_Viridiplantae_ITS2_fasta_file  

Expected result
#238585 ==> ok

Remove linebreaks

(NCBI nucleotide sequences downloaded in FASTA format display linebreaks every 70 bases, this may hinder further sequence processing steps)
Command
Remove linebreaks every 70 bases (Linux)
awk '!/^>/ { printf "%s", $0; n = "\n" } /^>/ { print n $0; n = "" }END { printf "%s", n }' NCBI_Viridiplantae_ITS2_fasta_file > NCBI_Viridiplantae_ITS2_fasta_file_tmp

mv NCBI_Viridiplantae_ITS2_fasta_file_tmp NCBI_Viridiplantae_ITS2_fasta_file

Collect taxonomic identifiers (taxids) of the organisms from ITS2 sequences were obtained

1. create table linking every accession number to the corresponding nucleotide sequence
Command
Create table  (Linux)
grep ">" NCBI_Viridiplantae_ITS2_fasta_file | cut -d ">" -f 2 | cut -d " " -f 1 > AccessionNumbers

paste \
  <(cat AccessionNumbers) \
  <(sed '/^>/d' NCBI_Viridiplantae_ITS2_fasta_file) > AccessionNumbers_seqs_linking_table

2. nucl_gb.accession2taxid NCBI file from the FTP website (large file)
Command
download nucl_gb.accession2taxid from NCBI (Linux)
wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/accession2taxid/nucl_gb.accession2taxid.gz

gzip -d nucl_gb.accession2taxid.gz
3. Retrieve the lines with accession numbers and write into temporary file
Command
Retrieve accession numbers (Linux)
fgrep -w -f AccessionNumbers nucl_gb.accession2taxid > AccessionNumbers_taxids_linking_table
quick check if we have retrieved all of them
Command
Accession number check (Linux)
wc -l AccessionNumbers_taxids_linking_table 

Expected result
#238585 ==> corresponds with our ITS2 sequence number

4. Create a table linking accession numbers and taxids
Command
Create final linking table (Linux)
awk 'BEGIN {FS=OFS="\t"} {print $2,$3}' AccessionNumbers_taxids_linking_table > AccessionNumbers_taxids_linking_table_final
Retrieve a list of unique taxids

Command
unique taxids (Linux)
awk -F '\t' '{print $2}' AccessionNumbers_taxids_linking_table_final | sort | uniq > Taxids_uniq

wc -l Taxids_uniq 

Expected result
#83493 unique taxids

Collect taxonomic lineages for the taxids

1. The “new_taxdump.tar.gz” NCBI reference file must be downloaded from the NCBI FTP website
Command
NCBI reference file from FTP (Linux)
mkdir taxdump

wget https://ftp.ncbi.nlm.nih.gov/pub/taxonomy/new_taxdump/new_taxdump.tar.gz
mv new_taxdump.tar.gz taxdump/

tar -xvzf taxdump/new_taxdump.tar.gz -C taxdump
2. Reformat the rankedlineage.dmp file with simpler field separator (pipe)
Command
Reformat rankedlineage.dmp file (Linux)
sed -i "s/\t//g" taxdump/rankedlineage.dmp
3. Sort the taxids in rankedlineage.dmp file
Command
Sort taxids (Linux)
sort -t "|" -k 1b,1 taxdump/rankedlineage.dmp > taxdump/rankedlineage_sorted
4. Associate the taxids with their corresponding taxonomic lineages
Command
Join taxids with ranked lineage (Linux)
join -t "|" -1 1 -2 1 -a 1 Taxids_uniq taxdump/rankedlineage_sorted > Taxids_taxonomic_lineages_linking_table

wc -l Taxids_taxonomic_lineages_linking_table

Expected result
#83493 (taxids linked to their lineages)

5. check for empty lines in the second column in the linking table
Command
check for empty lines (Linux)
awk -F '|' '{print $2}' Taxids_taxonomic_lineages_linking_table | grep -c '^$'       

Expected result
#0 (no empty lines)

Create a table gathering accession numbers, taxids, taxonomic lineages and ITS2 sequences

1. Link accession number to its corresponding taxonomic lineage, by joining both tables and generate a re-ordered 3 column .tsv file
Command
Join both tables (taxid accession numbers & lineages) (Linux)
join -t $'\t' -1 2 -2 1 -a 1 \
    <(sort -t $'\t' -n -k 2 AccessionNumbers_taxids_linking_table_final) \
    <(sort -t $'\t' -n -k 1 Taxids_taxonomic_lineages_linking_table_final) | \
    awk 'BEGIN {FS=OFS="\t"} {print $2, $1, $3}' > AccessionNumbers_taxids_Taxonomic_lineages_linking_table

Command
Add nucleotide sequences according accession numbers (Linux)
join -t $'\t' -1 1 -2 1 -a 1 \
      <(sort -t $'\t' -k 1b,1 AccessionNumbers_taxids_Taxonomic_lineages_linking_table)\
      <(sort -t $'\t' -k 1b,1 AccessionNumbers_seqs_linking_table) > Global_table

Command
Check if column in table is complete (Linux)
awk -F '\t' '{print $1}' Global_table | grep -c "^$" 
awk -F '\t' '{print $2}' Global_table | grep -c "^$"
awk -F '\t' '{print $3}' Global_table | grep -c "^$"
awk -F '\t' '{print $4}' Global_table | grep -c "^$"


Expected result
All commands should come back with #0

Create a QIIME2-formatted FASTA file and taxonomic lineage files and import into QIIME2

1. FASTA file creation
Command
Create FASTA (Linux)
awk -F '\t' 'BEGIN {OFS=""} {print ">",$1,"\n",$4}' Global_table | sed 's/-//g' > Fasta_file
2. Taxonomic lineages
Command
Taxonomic lineages file (Linux)
awk 'BEGIN {FS=OFS="\t"} {print $1,$3}' Global_table > Taxonomic_lineages
import sequences into QIIME2 (activate shotgun distribution of Qiime, this includes Rescript).
Command
import into QIIME2 (QIIME2)
conda activate qiime2-shotgun-2023.9

qiime tools import \
  --type 'FeatureData[Sequence]' \
  --input-path Fasta_file \
  --output-path Fasta_file.qza

Cull sequences
Sequences displaying 5 or more degenerated bases or containing a homopolymer sequence of 12 or more nucleotides should be removed. Maximize thread usage by setting p-n-jobs to 12 (processor has 12 threads)
Command
Cull sequences (QIIME2)
qiime rescript cull-seqs \
    --i-sequences Fasta_file.qza \
    --p-homopolymer-length 12 \
    --p-n-jobs 12 \
    --o-clean-sequences Fasta_file_tmp.qza

mv Fasta_file_tmp.qza Fasta_file.qza

qiime tools export \
  --input-path Fasta_file.qza \
  --output-path .

Remove entries that were culled from taxonomy file
Command
Remove culled from taxonomy file (Linux)
fgrep -v -f \
  <(cat \
    <(grep ">" dna-sequences.fasta | cut -d ">" -f 2) \
    <(cut -d $'\t' -f 1 Taxonomic_lineages) | sort | uniq -u) \
  Taxonomic_lineages > Taxonomic_lineages_tmp

mv Taxonomic_lineages_tmp Taxonomic_lineages
import cleaned taxonomy file into QIIME2 again
Command
import taxonomy file (QIIME2)
qiime tools import \
  --type 'FeatureData[Taxonomy]' \
  --input-format HeaderlessTSVTaxonomyFormat \
  --input-path Taxonomic_lineages \
  --output-path Taxonomic_lineages.qza

Dereplicate sequences in the fasta file and taxonomic lineage file
RESCRIPt can be used to remove redundant sequence data (optional step)
Command
Dereplicate FASTA & Taxonomy (QIIME2)
qiime rescript dereplicate \
    --i-sequences Fasta_file.qza \
    --i-taxa Taxonomic_lineages.qza \
    --p-mode 'uniq' \
    --p-threads 12 \
    --o-dereplicated-sequences Fasta_file_tmp.qza \
    --o-dereplicated-taxa Taxonomic_lineages_tmp.qza

mv Fasta_file_tmp.qza Fasta_file.qza
mv Taxonomic_lineages_tmp.qza Taxonomic_lineages.qza

Filter out suspected fungal sequences

1. Sequence and taxonomy data must again be extracted from the .qza files
Command
Export fasta and taxonomic lineage files (QIIME2)
qiime tools export \
  --input-path Fasta_file.qza \
  --output-path . && mv dna-sequences.fasta Exported_fasta_file.fasta

qiime tools export \
  --input-path Taxonomic_lineages.qza \
  --output-path . && awk 'NR>1' taxonomy.tsv > Exported_taxonomic_lineages.tsv
We will blast these plant ITS2 sequences against fungi databases in order to identify sequences to have a suspected fungal orgin.

2. Download ITS siquences manually from the UNITEwebsite
3. Shorten the description line of the FASTA file to match the BLAST command line requirements
Command
FASTA description line (Linux)
paste \
  <(grep ">" sh_general_release_dynamic_10.05.2021.fasta | cut -d "|" -f 2) \
  <(sed '/^>/d' sh_general_release_dynamic_10.05.2021.fasta) > AccessionNumbers_seqs_linking_table

awk -F '\t' 'BEGIN {OFS=""} {print ">",$1,"\n",$2}' AccessionNumbers_seqs_linking_table > UNITE_fungi_seqs.fasta
4. create a local BLAST database from the UNITE ITS sequences
Command
UNITE ITS BLAST database
makeblastdb \
  -in UNITE_fungi_seqs.fasta \
  -parse_seqids \
  -blastdb_version 5 \
  -title "UNITE_fungi_seqs" \
  -dbtype nucl
5. BLAST plant ITS2 sequences against UNITE fungi database
Command
BLAST ITS2 UNITE
blastn \
  -db UNITE_fungi_seqs.fasta \
  -query Exported_fasta_file.fasta \
  -num_threads 12 \
  -max_target_seqs 1 \
  -outfmt "6 qacc sacc evalue bitscore length pident ssciname scomname staxid" \
  -out blastn_outfile_UNITE_fungi
using 12 threads again as this is our maximum

6. Reformat the BLAST output file and add length data for each plant reference sequence
Command
Reformat BLAST output file (Linux)
sort -buk 1,1 blastn_outfile_UNITE_fungi | sed "s/100.000/100/g" > blastn_outfile_UNITE_fungi_uniq

awk -F '\t' '{print $1}' blastn_outfile_UNITE_fungi_uniq > AccessionNumbers_in_blastn_outfile

paste \
  <(cat AccessionNumbers_in_blastn_outfile) \
  <(fgrep -w -f AccessionNumbers_in_blastn_outfile Global_table | awk -F '\t' '{print length($4)*0.95}' | cut -d ',' -f 1) > AccessionNumbers_seqs_length_linking_table

join -t $'\t' -1 1 -2 1 -a 1 \
      <(sort -t $'\t' -k 1b,1 blastn_outfile_UNITE_fungi_uniq)\
      <(sort -t $'\t' -k 1b,1 AccessionNumbers_seqs_length_linking_table) > blastn_outfile_UNITE_fungi_uniq_withlengthdata
7. Remove sequences showing at least 90% identity with UNITE ITS sequences on at least 95% of their length
Command
Gather fungal hits (Linux)
awk -F '\t' '$6>=90' blastn_outfile_UNITE_fungi_uniq_withlengthdata | awk -F '\t' '$5>=$NF' | awk -F '\t' '{print $1}' > Sequences_to_remove_UNITE_seqs
8. Filter suspected fungal sequences from our plant ITS2 reference sequences
Command
new command name
grep -n -A 1 -f Sequences_to_remove Exported_fasta_file.fasta | \
sed -n 's/^\([0-9]\{1,\}\).*/\1d/p' | \
sed -f - Exported_fasta_file.fasta > Fasta_file_without_fungi

grep -v -f Sequences_to_remove_UNITE_seqs Exported_taxonomic_lineages.tsv > Taxonomic_lineages_without_fungi

Filter out suspected misidentified sequences

To identify sequences with a wrong identification, our plant ITS2 reference sequences are analyzed in a cross-validation scheme with data leakage, thus were sets of test and training sequences are strictly identical. This allows comparing expected and predicted taxonomies for each sequence and discarding those for which the expected taxonomy at the family rank is observed only once in the top 5 hits resulting from the BLASTn analysis.

1. Create a table linking accession numbers to taxids from the filtered FASTA file
Command
linking table (Linux)
grep ">" Fasta_file_without_fungi | cut -d ">" -f 2 > AccessionNumbers

fgrep -f AccessionNumbers Global_table | awk 'BEGIN {FS=OFS="\t"} {print $1,$2}' > AccessionNumbers_taxids_linking_table
2. Generate a BLAST database
Command
BLAST database (Linux)
makeblastdb \
  -in Fasta_file_without_fungi \
  -parse_seqids \
  -blastdb_version 5 \
  -taxid_map AccessionNumbers_taxids_linking_table \
  -title "Fasta_file_without_fungi" \
  -dbtype nucl
3. BLAST the plant ITS2 sequences against themselves
Command
BLAST plant ITS2 against themselves (Linux)
blastn \
  -db ./Fasta_file_without_fungi \
  -query Fasta_file_without_fungi \
  -num_threads 12 \
  -max_target_seqs 5 \
  -outfmt "6 qacc sacc evalue bitscore length pident ssciname scomname staxid" \
  -out blastn_outfile_leakedCV

Process leaked cross-validation results to compare expected to predicted taxonomies

1. Retrieve top 5 hits accession numbers and taxids
Command
Retrieve top 5 hits (Linux)
awk -F '\t' '{print $1}' blastn_outfile_leakedCV | sort | uniq > AccessionNumbers_in_blastn_outfile

awk 'BEGIN {FS=OFS="\t"} {print $1,$9}' blastn_outfile_leakedCV > AccessionNumbers_PredictedTaxids_linking_table
2. Use these files to keep only the top 5 hits for each reference sequence
Command
Keep top 5 hits in reference sequences (Linux)
wk 'seen[$1]++{ $1="" }1' OFS='\t' AccessionNumbers_PredictedTaxids_linking_table \
  | fgrep -w -A 4 -f AccessionNumbers_in_blastn_outfile \
  | sed '/--/d' > AccessionNumbers_PredictedTaxids_linking_table_top5

paste \
  <(awk -F '\t' '{print $1}' AccessionNumbers_PredictedTaxids_linking_table_top5 | awk 'BEGIN {FS=OFS="\t"} NF {p = $0} {print p}') \
  <(awk -F '\t' 'BEGIN {FS=OFS="\t"} {print $2}' AccessionNumbers_PredictedTaxids_linking_table_top5) > AccessionNumbers_PredictedTaxids_linking_table_top5_tmp && mv AccessionNumbers_PredictedTaxids_linking_table_top5_tmp AccessionNumbers_PredictedTaxids_linking_table_top5
3. Number the lines for further data processing

Command
Add line numbers (Linux)
awk 'BEGIN {FS=OFS="\t"} {print NR,$0}' AccessionNumbers_PredictedTaxids_linking_table_top5 > AccessionNumbers_PredictedTaxids_linking_table_top5_tmp && mv AccessionNumbers_PredictedTaxids_linking_table_top5_tmp AccessionNumbers_PredictedTaxids_linking_table_top5

4. Generate new linking tables that display the taxonomy info at family rank
Command
New linking tables (Linux)
paste \
  <(awk 'BEGIN {FS=OFS="\t"} {print $1}' Global_table) \
  <(awk 'BEGIN {FS=OFS="\t"} {print $3}' Global_table | awk -F '; ' '{print $5}') > AccessionNumbers_taxonomic_lineages_linking_table

paste \
  <(awk 'BEGIN {FS=OFS="\t"} {print $2}' Global_table) \
  <(awk 'BEGIN {FS=OFS="\t"} {print $3}' Global_table | awk -F '; ' '{print $5}') | sort -buk 1,1 > Taxids_taxonomic_lineages_linking_table
5. Reformat the table so we can write expected taxonomies to it
Command
Add predicted taxonomies (Linux)
sort -n -k 2 AccessionNumbers_PredictedTaxids_linking_table_top5 | awk 'BEGIN {FS=OFS="\t"} {print $3,$4}' > AccessionNumbers_PredictedTaxids_linking_table_top5_tmp && mv AccessionNumbers_PredictedTaxids_linking_table_top5_tmp AccessionNumbers_PredictedTaxids_linking_table_top5

awk 'BEGIN {FS=OFS="\t"} $1 != prev { printf "%s%s", ors, $1; prev=$1; ors=ORS } { printf " %s", $2 } END { print "" }' AccessionNumbers_PredictedTaxids_linking_table_top5 | sed "s/ /\t/g" > AccessionNumbers_PredictedTaxids_linking_table_top5_tmp && mv AccessionNumbers_PredictedTaxids_linking_table_top5_tmp AccessionNumbers_PredictedTaxids_linking_table_top5
6. Add expected taxonomies to the table
Command
Add expected taxonomy (Linux)
join -t $'\t' -1 1 -2 1 -a 1 \
  <(sort -t $'\t' -k 1 AccessionNumbers_PredictedTaxids_linking_table_top5) \
  <(sort -t $'\t' -k 1 AccessionNumbers_taxonomic_lineages_linking_table) -o 1.1,2.2,1.2,1.3,1.4,1.5,1.6 > AccessionNumbers_PredictedTaxids_linking_table_top5_tmp && mv AccessionNumbers_PredictedTaxids_linking_table_top5_tmp AccessionNumbers_PredictedTaxids_linking_table_top5

Count the number of times the expected family is observed in the top 5 hits
Command
Count expected family in top 5 (Linux)
awk 'BEGIN {FS=OFS="\t"} { i=$1; $1=""; print i, gsub($2,"")-1 }' AccessionNumbers_PredictedTaxids_linking_table_top5 > Predicted_taxonomy_count

Remove sequences for which the expected family is observed only once in the taxonomy of the top 5 hits
Command
new command name
awk 'BEGIN {FS=OFS="\t"} $2==1 {print $1}' Predicted_taxonomy_count > Sequences_to_remove

grep -n -A 1 -f Sequences_to_remove Fasta_file_without_fungi | \
sed -n 's/^\([0-9]\{1,\}\).*/\1d/p' | \
sed -f - Fasta_file_without_fungi > NCBI_ITS2_Viridiplantae_fasta_file.fasta

grep -v -f Sequences_to_remove Taxonomic_lineages_without_fungi > NCBI_ITS2_Viridiplantae_taxonomic_lineages.tsv

Import data into QIIME2
Command
Import into QIIME2
qiime tools import \
  --type 'FeatureData[Sequence]' \
  --input-path NCBI_ITS2_Viridiplantae_fasta_file.fasta \
  --output-path NCBI_ITS2_Viridiplantae_fasta_file.qza

qiime tools import \
  --type 'FeatureData[Taxonomy]' \
  --input-format HeaderlessTSVTaxonomyFormat \
  --input-path NCBI_ITS2_Viridiplantae_taxonomic_lineages.tsv \
  --output-path NCBI_ITS2_Viridiplantae_taxonomic_lineages.qza

Train the classifier using the taxonomic lineages and the fasta file


Command
train classifier
qiime feature-classifier fit-classifier-naive-bayes \
  --i-reference-reads NCBI_ITS2_Viridiplantae_fasta_file.qza \
  --i-reference-taxonomy NCBI_ITS2_Viridiplantae_taxonomic_lineages.qza \
  --o-classifier ITS2_classifier.qza\
--verbose

Cluster ASVs into OTUs with 99% similarity

Command
CLUSTER WITH QIIME
new command name
qiime vsearch cluster-features-de-novo \
  --i-table table.qza \
  --i-sequences rep-seqs.qza \
  --o-clustered-table otu_table.qza \
  --o-clustered-sequences otu_file.qza \
  --p-perc-identity 0.97

Assign taxonomy with BLAST, VSEARCH and the Naive Bayes Classifier

Command
BLAST in QIIME2
qiime feature-classifier classify-consensus-blast \
--i-query otu_file.qza \
--i-reference-reads NCBI_ITS2_Viridiplantae_fasta_file.qza \
--i-reference-taxonomy NCBI_ITS2_Viridiplantae_taxonomic_lineages.qza \
--o-search-results blast_results.qza \
--o-classification classified_blast_results.qza \
--verbose

Command
VSEARCH in QIIME
new command name
qiime feature-classifier classify-consensus-vsearch \
--i-query otu_file.qza \
--i-reference-reads NCBI_ITS2_Viridiplantae_fasta_file.qza \
--i-reference-taxonomy NCBI_ITS2_Viridiplantae_taxonomic_lineages.qza \
--o-search-results vsearch_results.qza \
--o-classification classified_vsearch_results.qza \
--verbose

Command
Naive Bayes Classifier in QIIME
new command name
qiime feature-classifier classify-sklearn \
  --i-classifier ITS2_classifier.qza \
  --i-reads otu_file.qza \
  --o-classification taxonomy_classifier.qza

Export files from QIIME2 for import in R

OTU counts to a .tsv file
Command
ASV counts export (QIIME2)
biom convert -i feature-table.biom -o feature-otu_table.tsv --to-tsv

OTU sequences to .fasta file
Command
OTUS to FASTA (QIIME2)
 qiime tools export \
  --input-path otu_file.qza \
  --output-path otu_file.fasta
Taxonomy file to .tsv file
Command
Taxonomy files to .tsv (QIIME2)
 qiime tools export \
  --input-path classified_blast_results.qza \
  --output-path taxonomy_blast.tsv

 qiime tools export \
  --input-path classified_vsearch_results.qza \
  --output-path taxonomy_vsearch.tsv

 qiime tools export \
  --input-path taxonomy_classifier.qza \
  --output-path taxonomy_classifier.tsv
metadata is already in .tsv (see step 11)
R script to create data file, calculate metrics & visualize data
Download R_script.RR_script.R26KB