Apr 16, 2026

Tweap protocol for target enrichment via in-solution hybridisation using Twist Bioscience Panels

  • 1Human Evolution, Department of Organismal Biology, Evolutionary Biology Center, Uppsala University, Uppsala, Sweden;
  • 2SciLifeLab Ancient DNA
  • Tina Saupe: Corresponding Author;
Icon indicating open access to content
QR code linking to this content
Protocol CitationTina Saupe, E-Jean Tan, Mariam Omar Gómez, Carolina Bernhardsson, Mattias Jakobsson 2026. Tweap protocol for target enrichment via in-solution hybridisation using Twist Bioscience Panels. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvoknbxl4o/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 27, 2024
Last Modified: April 16, 2026
Protocol  Integer ID: 97440
Keywords: ancient DNA, target enrichment, Dynabeads for target enrichment, Twist Bioscience, twist target enrichment standard hybridization v1 protocol, tweap protocol for target enrichment, twist bioscience panels this protocol, target enrichment, using twist bioscience panel, ancient human dna library, twist bioscience, tweap protocol, list of reagent, endogenous dna content, reagent, cold spring harbor laboratory press, solution hybridisation
Funders Acknowledgements:
Wenner-Gren Foundation in Sweden
Lars Hierta Memory Foundation
Swedish Phylogenetic Society
Abstract
This protocol uses Dynabeads™ Streptavidin for Target EnrichmentInvitrogen - Thermo FisherCatalog #65605D, 65606D
for Twist Target Enrichment Standard Hybridization v1 Protocol (link below). The protocol is designed for single- and multi-pooled hybridisation reactions optimised for dual-indexed libraries with (ultra)-low endogenous DNA content. For this protocol, the required list of reagents can be found under Materials. For the target enrichment, the user can use either a Twist Bioscience fixed or customised panels, as well as add an optional secondary panel (as a spike-in).

This protocol uses the Twist Target Enrichment Standard Hybridization v1 Protocol (link: https://www.twistbioscience.com/resources/protocol/twist-target-enrichment-standard-hybridization-v1-protocol) and was previously modified by Rohland et al (2022) for ancient Human DNA libraries. Cold Spring Harbor Laboratory Press (doi: 10.1101/gr.276728.122).
Citation
Rohland N, Mallick S, Mah M, Maier R, Patterson N, Reich D (2022). Three assays for in-solution enrichment of ancient human DNA at more than a million SNPs.
LINK


Guidelines
All steps of the protocol can be performed outside of an ancient DNA facility, however, it is recommended to use a so-called Post-PCR laboratory minimising possible contamination factors. If working with dsDNA libraries of human individuals please consider the ethical regulations of your region under investigation.

Working in a Post-PCR Laboratory:
Please keep in mind the safety guidelines of your specific country and institution.
Recommendations include wearing of:
  • lab coats
  • closed shoes and trousers
  • safety glasses
  • nitrile or latex gloves
Materials
*** list of reagents ***

Reagents required for the experiment (in the order they appear in the protocol):
- Purification Beads:
Ampure XP beads Beckman CoulterCatalog #A63881 (stored at 2-8 °C , equilibrate at Room temperature for at least 00:30:00 )
- 99.7% Ethanol (stored in chemical cabinet, stored at Room temperature )
- nuclease-free molecular biology-grade water (stored at Room temperature )

Reagents required for Day 1:
- Hybridisation reagents
  • Hybridization Mix Twist BioscienceCatalog #100212, 100587, 100528, 104235 (stored at -20 °C , spin down, ! very viscous)
  • Hybridization EnhancerTwist BioscienceCatalog #100937, 100986, 101266 (stored at -20 °C , vortex 00:00:03 , spin down, ! mineral-oil based reagent, equilibrate at Room temperature for at least 00:15:00 )

- BLOCKERs reagents Twist Universal BlockerTwist BioscienceCatalog #100856, 100578, 100767 (stored at -20 °C , keep on Ice)

- PROBEs reagents
  • Twist Custom Panels (Ancient Human DNA)Twist BioscienceCatalog #94002772 (stored at -20 °C , keep on Ice)
  • Twist Fixed Panel (Mitochondrial DNA)Twist BioscienceCatalog #102038, 102039, 102040

Reagents required for Day 2:
(A) prepared 2X Binding & Washing Buffer (B&W Buffer):
ABC
Reagentsrecommended concentrationfinal concentration
Tris-Cl1 M10 mM
EDTA0.5 M1 mM
NaCl5 M2 M
nuclease-free molecular biology-grade water--
Tween 2010%0.1%

- Streptavidin Binding Beads:
Dynabeads™ Streptavidin for Target EnrichmentInvitrogen - Thermo FisherCatalog #65605D, 65606D
(stored at 2-8 °C , equilibrate at Room temperature for at least 00:30:00 )

- Amplification Kit: Equinox Library Amplification Kit (2X)Watchmaker GenomicsCatalog #7K0021-096 (stored at -20 °C , keep on Ice)

- Amplification Primers:
Oligonucleotides (10 millimolar (mM) , stored at -20 °C , keep on Ice)
P5 Primer sequences: AATGATACGGCGACCACCGA
P7 Primer sequences: CAAGCAGAAGACGGCATACGA

- EB buffer: EB bufferQiagenCatalog #19086

*** list of equipment ***
  • Thermomixer (e.g. Eppendorf ThermoMixerTM C with SmartblockTM Thermoblock for 1.5 ml)
  • Thermomixer (e.g. Eppendorf 5355 Thermomixer R Comfort with Thermoblock for 50 ml)
  • Thermal cycler (2x)
  • Invitrogen DynaMag-PCR Magnet (size - 1.5 ml)
  • Invitrogen DynaMag-PCR Magnet (size - 0.2 ml)
  • Table rotator (e.g. Revolver Rotator Mixer from Life Science products for 1.5 ml)
  • Table centrifuge for 0.2 PCR strips and 1.5 ml)
  • Lab vortex mixer
Equipment
Invitrogen™ DynaMag™-PCR Magnet
NAME
magnetic rack
TYPE
Invitrogen™
BRAND
492025
SKU
LINK

Equipment
DynaMag-2
NAME
Magnet
TYPE
Invitrogen
BRAND
12321D
SKU
LINK





Protocol materials
TWEEN 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P7949
Dynabeads™ Streptavidin for Target EnrichmentInvitrogen - Thermo FisherCatalog #65606D
Ampure XP beads Beckman CoulterCatalog #A63881
Hybridization Mix Twist BioscienceCatalog #100212, 100587, 100528, 104235
Hybridization EnhancerTwist BioscienceCatalog #100937, 100986, 101266
EB bufferQiagenCatalog #19086
Dynabeads™ Streptavidin for Target EnrichmentInvitrogen - Thermo FisherCatalog #65605D, 65606D
Twist Fixed Panel (Mitochondrial DNA)Twist BioscienceCatalog #102038, 102039, 102040
Equinox Library Amplification Kit (2X)Watchmaker GenomicsCatalog #7K0021-096
Twist Custom Panels (Ancient Human DNA)Twist BioscienceCatalog #94002772
Twist Universal BlockerTwist BioscienceCatalog #100856, 100578, 100767
Safety warnings

Safety information
The products required for the target enrichment are non-hazardous excluding the hybridisation mix.
The hybridisation mix contains Dimethyl sulfoxide (DMSO) which is rapidly adsorbed through the skin.
99.5% Ethanol is inflammable chemical.

Before start
  • The protocol takes approximately 1.5 working days (~8 hours/day) excluding the hybridisation time of 16h.
  • Timely overview of the target enrichment workflow using dual-indexed libraries with (ultra)-low endogenous (human) DNA:
ABC
StepBefore startingTime [h]
1Preparation of dual-indexed libraries to enrich.1.5
Hybridisation workflow
2Prepare libraries for hybridisation.1
3Hybridisation16
4Binding hybridised targets to Streptavidin Binding Beads 2
5Post-capture PCR amlification and Clean-up1
6Quantity and Quality control of the enriched libraries0.5

Important information:

  • Only dual-indexed libraries should be pooled together, in order to minimise index association due to jumping PCR during the post-capture library amplification. We recommend to pool only dual-indexed libraries of the same individual with different index combinations.

  • We recommend to prepare batches of re-amplifications of the selected dual-indexed DNA libraries to increase the quantity of the target sequences available in low amount and achieve a more uniform coverage across the the entire genome.

  • Libraries should be concentrated to a volume of 10 µl (ideally between 250 - 1000 ng) using a vacuum concentrator or the alternate Pre-Hybridisation DNA concentration protocol (described in the original protocol, page 19 - 20). This protocol have been tested with maximum 40 µl of library input.

  • According to the Twist Bioscience company, the ideal temperature for aDNA is 62 °C , with a hybridisation time ranging 15:00:00 to 17:00:00 .

  • If using a non-human specific panel, replace the species-specific blocking solution.

The following protocol uses the alternate Pre-Hybridisation DNA concentration protocol prior to the original protocol for target enrichment utilised for the Post-PCR laboratory, Human Evolution, EBC, Uppsala University.

Used abbreviations throughout the protocol:
B&W - Binding and Washing
h - hour(s)
min - minute(s)
ml - millilitre
ng - nanogram
RT - room temperature
rxn(s) - reaction(s)
sec - seconds
µl - microlitre
Pre-Laboratory Setup (Day 1)
45m 6s
A list of required reagents , their the preparation, and equipment can be found in Materials.
(A) Set the Thermo mixer using the 1.5 ml Smartblock at 65 °C at the start of the day.

(B) Fetch ice, to keep reagents on ice.

(C) Retrieve dsDNA libraries from the freezer and allow them to thaw at Room temperature Spin down and homogenise by pipetting before transferring to the respective 0.2 mL PCR tube(s) . (Refer to section 3)
Thermo cycler setting:

Note
Two Thermal cycler are needed for Day 1!

(A) Program the first Thermal cycler and make sure that the lid is heated to at least 105 °C .
NB! For the preparation of the solution master mixes.
ABC
temperaturetime
activation95°C

(B) Program the second Thermal cycler and make sure the lid is heated to at least 65 °C .
NB! For the incubation of the hybridisation reactions.
ABC
temperaturetime
activation62°C

Preparation of the Reagents (Day 1)
30m
Please read Materials to prepare the reagents prior to the start of the procedure.
Preparation for the target enrichment using the 'alternate pre-hybridisation DNA concentration' protocol from Twist Bioscience.
(A) Aliquot the total amount of Hybridization EnhancerTwist BioscienceCatalog #100937, 100986, 101266 for each reaction into a 1.5 mL LoBind Eppendorf tube(s) . Store at Room temperature .

(B) Prepare the Ampure XP beads Beckman CoulterCatalog #A63881 .
  • Vortex pre-equilibrated Ampure XP beads Beckman CoulterCatalog #A63881 until homogenised mixed. NB! Vortex until all Beads are removed from the outer surface.
  • Aliquot the total amount of Ampure XP beads Beckman CoulterCatalog #A63881 into a 1.5 mL LoBind Eppendorf tube(s) .

(D) Prepare fresh 80 % volume Ethanol .

(E) Heat the Hybridization Mix Twist BioscienceCatalog #100212, 100587, 100528, 104235 at 65 °C in the Thermo mixer for 00:10:00 , or until all precipitate is dissolved, then cool to Room temperature on the Benchtop for at least 00:05:00 .

Note
The volume of the Ampure XP beads Beckman CoulterCatalog #A63881 is 1.8x more than the input of the library.

15m
Dried Library Preparation (Day 1)
20m
Prepare the dsDNA libraries for the hybridisation reaction.
Transfer the repective volume or 10 µL of each dsDNA library to new 0.2 mL PCR tube(s) .
Add 1.8x of Ampure XP beads Beckman CoulterCatalog #A63881 to each dsDNA library in the 0.2 mL PCR tube(s) . Mix by briefly pulse-spinning. Quick spin-down.
Incubate for 00:05:00 at Room temperature .
5m
Place the 0.2 mL PCR tube(s) on a magnetic rack for 00:05:00 .
NB! Wait until all beads from a pellet. The tube(s) should contain a clear solution.

5m
Do not remove the tube(s) from the magnet rack! Remove and discard the supernatant.
Washing Steps. Perform this step for a total of 3 times.
NB! Keep the tube(s) on the magnetic rack.
Wash the bead pellet by gently adding 250 µL of 80 % volume Ethanol .
NB! Do not disturb the pellet.
Incubate for 00:01:00 .
5m
Remove and discard the ethanol.
After the last wash, use a 10 µL Pipette to remove all traces of supernatant.
NB! Do not disturb the pellet.
Air-dry the pellet on the magnetic rack for 00:05:00 to 00:10:00 or until the pellet are dry.
Note
Prepare the Blockers solution master mix while waiting for the air-dry. (Refer to section 12).

5m
Remove the tube(s) from the magnetic rack.
Add 12 µL Blockers solution Master Mix to the dried dsDNA libraries and homogenise by pipetting.
Tip! Wash the pellet carefully down with the Blockers solution mix without pulling beads into the tip.
Preparation of the Blockers solution master mix (MM)
Prepare Blockers solution MM in a 1.5 mL LoBind Eppendorf tube(s) .

ABC
reagentsper reaction [µl]MM (n*reagent)
Blockers solution5.0
Universal Blockers7.0
Total12.0

Resuspend and briefly spin down the Blockers solution MM. Store on ice until the transfer to the dried dsDNA libraries (Refer to step 11).
Preparation of the Probes Solution master mix
Prepare Probes solution MM in a 1.5 mL LoBind Eppendorf tube(s) .
ABC
reagentsper reaction [µl]MM (n*reagent)
Hybridisation Mix5.0
Twist Custom panel1.0
Twist secondary panel0.5
nuclease-free molecular biology-grade water3.5
Total10.0

Resuspend and brielfy centrifuge the Probe solution MM.
For each hybridisation reaction, aliquot 10 µL Probe solution MM to 0.2 µL PCR tube(s) . Briefly spin down and store on ice.

Hybridisation Preparation
16h 20m
Incubate the tube(s) containing the Probes solution MM at 95 °C for 00:05:00 in the Thermo cycler.
5m
After the incubation, remove the tube(s) from the Thermo cycler and place immediately cool on ice for 00:05:00 .
5m
Incubate the Blockers solution reaction tube(s) containing the eluted dsDNA libraries at 95 °C for 00:05:00 .
5m
Place the Probes and Blockers solution reaction tube(s) on the bench at Room temperature for 00:05:00 .
5m
Carefully mix the Probes solution reactions by flicking the tube(s). Briefly spin down.
Pipette 10 µL of the Probes solution reactions to each Blockers solution reaction tube(s).
Homogenise by pipetting up and down for 4-5 times. Briefly spin down. Ensure all solution is at the bottom of the tube(s).
Add 30 µL of Hybridisation Enhancer to the top of the hybridisation reaction. Homogenise by pipetting up and down for 4-5 times. Briefly spin down. Ensure that there are no bubbles present.
Incubation of the hybridisation reactions
16h
Place the tube(s) in the thermal cycler at 65 °C for 16:00:00 .
16h
Pre-Laboratory Setup (Day 2)
(A) Set two Thermo mixer, using a 1.5 mL Smartblock and a 50 mL respectively, at 49 °C at the start of the day.
(B) Fetch Ice prior to preparation of the Post-capture PCR amplification.
Preparation of the Reagents (Day 2)
20m
(A) Place the Dynabeads™ Streptavidin for Target EnrichmentInvitrogen - Thermo FisherCatalog #65606D on a rotator for at least 00:20:00 .
(B) Make 1X B&W buffer from the prepared 2X B&W buffer in a 1:1 dilution.
(C) Aliquot the total respective amounts for 1X and 2X B&W buffers described in the Note.

Note
Per hybridisation reaction you need in total
  • 600 µL 2X B&W buffer at Room temperature
  • 2500 µL 1X B&W buffer 1 at Room temperature
  • 2100 µL 1X B&W buffer 2 heated at 49 °C in a thermal mixer.

20m
Add 0.1 % volume of TWEEN 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P7949 to each B&W buffer.

Heat the 1x B&W buffer 2 at 49 °C in a thermal mixer.
Preparation of the Streptavidin Binding Beads
6m
Aliquot 300 µL Streptavidin Binding Beads for each reaction into a 1.5 mL LoBind Eppendorf tube(s) .
NB! Pipette Streptavidin Binding Beads carefully to ensure all beads are in the tube(s).
NB! Change the tip every time.
Place the tube(s) on a magnetic rack for 00:02:00 .
NB! Wait until all beads from a pellet. The tube(s) should contain a clear solution.
2m
Remove and discard the supernatant.
NB! Do not disturb the pellet.
Remove the tube(s) from the magnet rack!
Washing Steps. Perform this step for a total of 3 times.
Resuspend the bead pellet using 600 µL 1X B&W buffer 1 .

Place the tube(s) in the magnetic rack for 00:02:00 .
NB! Wait until all beads from a pellet. The tube(s) should contain a clear solution.
2m
Remove and discard the supernatant.
NB! Do not disturb the pellet.

2m
Remove the tube(s) from the magnet rack.
Add 600 µL 2X B&W buffer and resuspend the beads by vortexing until homogenised.
Briefly centrifuge to remove bubbles from the lid.
Beads-Probe Binding
30m
Open the thermal cycler lid.
Quick spin-down.
Transfer each hybridisation reaction (~52 µl) to one 1.5 mL LoBind Eppendorf tube(s) containing the cleaned Streptavidin Binding Beads.
NB! The Hybridisation enhancer may interfer with pipette everything into the binding bead tube(s). Try to pipette carefully and check if nothing in the tip is left.
Mix by pipetting up and down.
NB! This step is critical for minimising the off-target binding. Do not let the hybridisation reaction cool down!
Incubate the tube(s) containing the hybridisation reactions and Streptavidin Binding Beads on a table rotator for 00:30:00 at Room temperature .

30m
Beads-Probe Washing
9m
Remove the 1.5 mL LoBind Eppendorf tube(s) from the table rotator and quick spin-down to ensure all solution is at the bottom of the tube(s).
Place the 1.5 mL LoBind Eppendorf tube(s) on the magnetic rack for 00:02:00 .

2m
Remove and store the hybridisation reaction in a new 1.5 mL LoBind Eppendorf tube(s)
~ It contains the non-enriched library. Freeze the non-enriched library at -20 °C .

Remove the 1.5 mL LoBind Eppendorf tube(s) from the magnetic rack and add 700 µL 1X B&W buffer 1 . Resuspend by pipetting carefully up and down or flicking carefully.

Quick spin-down.
Move the entire volume of each hybridisation reaction (~700 µl) into a new 1.5 mL LoBind Eppendorf tube(s) .
Place the tube(s) on the magnetic rack for 00:01:00 .
NB! Wait until all beads from a pellet. The tube(s) should contain a clear solution.
1m
Remove and discard the clear supernatant.
NB! Do not disturb the pellet.
Remove the tube(s) from the magnetic rack.
Washing Steps. Perform this step for a total of 3 times.

Note
Keep the 1X B&W buffer 2 heated at 49 °C all the time.


Add 700 µL 1B B&W buffer 2 to each tube. Briefly resuspend by pipetting 2-3 times. Centrifuge briefly.
Incubate the tube(s) for 00:05:00 at 49 °C .
5m
Place the tube(s) on the magnetic rack for 00:01:00 .
1m
Remove and discard the clear supernatant.
NB! Do not disturb the pellet.
Remove the tube(s) from the magnetic rack.
After the last wash, use a 10 µL Pipette to remove all traces of supernatant.
NB! Do not disturb the pellet.
Remove the tube(s) from the magnetic rack and add 45 µL nuclease-free molecular biology-grade water or EB bufferQiagenCatalog #19086 (for long storage) to each hybridisation reaction. Resuspend briefly by pipetting carefully up and down. Incubate on ice.

Post-capture PCR amplification
Program the Thermal cycler and set the lid temperature to 105 °C .
ABCD
temperaturetimecycles
initialisation98 °C45 sec
denaturation98 °C15 sec15
annealing60 °C30 sec
extension72 °C30 sec
final extension72 °C1 min
hold4 °C

Prepare Amplification MM in a 1.5 mL LoBind Eppendorf tube(s) .
ABC
reagentspre reaction [µl]MM (n*1.05*reagent)
Equinox Library Amp Mix (2x)25.0
Amplification Primer2.5

For each hybridisation reaction, aliquot 27.5 µL Ammplification MM to a 0.2 µL PCR tube(s) .

Add 22.5 µL hybridisation reaction to the 0.2 µL PCR tube(s) . Quick spin-down.

Place the tube(s) in the thermal cycler, close the lid and start the cycler program.
Post-amplification washing step
26m
(A) Prepare the Ampure XP beads Beckman CoulterCatalog #A63881 .
  • Vortex pre-equilibrated Ampure XP beads Beckman CoulterCatalog #A63881 until homogenised mixed. NB! Vortex until all Beads are removed from the outer surface.
  • Aliquot the total amount of Ampure XP beads Beckman CoulterCatalog #A63881 into a 1.5 mL LoBind Eppendorf tube(s) .

(B) Prepare fresh 80 % volume Ethanol .
Add 90 µL of Ampure XP beads Beckman CoulterCatalog #A63881 to eac 0.2 mL PCR tube(s) . Mix by vortexing. Quick spin-down.
Incubate for 00:05:00 at Room temperature .

5m
Place the 0.2 mL PCR tube(s) on a magnetic rack for 00:05:00 .
NB! Wait until all beads from a pellet. The tube(s) should contain a clear solution.
5m
Do not remove the tube(s) from the magnet rack! Remove and discard the supernatant.
Washing Steps. Perform this step for a total of 3 times.
NB! Keep the tube(s) on the magnetic rack.
Wash the bead pellet by gently adding 250 µL of 80 % volume Ethanol .
NB! Do not disturb the pellet.
Incubate for 00:01:00 .
1m
Remove and discard the ethanol.
After the last wash, use a 10 µL Pipette to remove all traces of supernatant.
NB! Do not disturb the pellet.
Air-dry the pellet on the magnetic rack for 00:05:00 to 00:10:00 or until the pellet are dry.
15m
Remove the tube(s) from the magnetic rack.
Add 12 µL EB buffer to the dried hybridisation reactions and homogenise by pipetting.
Tip! Wash the pellet carefully down with the EB buffer without pulling beads into the tip.
Quality & Quantity Assessment
Use 2 µL enriched dsDNA library to measure the DNA concentrations using Qubit and Fragment analyser. Read instrument manuals for further instructions.

Citations
Rohland N, Mallick S, Mah M, Maier R, Patterson N, Reich D. Three assays for in-solution enrichment of ancient human DNA at more than a million SNPs.
https://doi.org/10.1101/gr.276728.122