Jul 08, 2019
Transposase injection mix protocol
- 1University of British Columbia
Protocol Citation: Ben Matthews 2019. Transposase injection mix protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.4a6gshe
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 17, 2019
Last Modified: July 08, 2019
Protocol Integer ID: 24638
Keywords: Aedes aegypti, transposon-mediated transformation, piggyBac, insect transformation, embryos with piggybac transposase, piggybac transposase, plasmid dna for integration, transposase, integration into aedes aegypti, injection mix protocol, injection mix protocol this protocol, plasmid dna, using mrna, injection mix, embryo, aedes aegypti, mrna, mediated integration, other insect
Abstract
This protocol details the steps necessary to generate injection mixes (comprised of plasmid DNA for integration and transposase mRNA) for transposon-mediated integration into Aedes aegypti and other insects. It has been empirically tested in Ae. aegypti embryos with piggyBac transposase. In our hands, using mRNA as a source of transposase instead of a helper plasmid increases transformation rates substantially.
Attachments
Guidelines
This protocol includes the following sections:
Materials
MATERIALS
HiScribe T7 ARCA mRNA Kit (with Tailing) - 20 rxnsNew England BiolabsCatalog #E2060S
Agencourt RNAClean XP SPRI beads Beckman CoulterCatalog #A63987
NucleoBond Xtra Midi EF plasmid purification kitMacherey-NagalCatalog #740420.10
- NucleoBond Xtra Midi EF plasmid purification kit - Machery Nagel item # 740420.10
Protocol: Machery Nagel Nucleobond EF
- HiScribeTM T7 ARCA mRNA Kit (with tailing) - New England Biolabs (NEB) item # E2060S
Protocol: HiScribe T7 ARCA mRNA kit
- Standard PCR reagents
- Magnet stand compatible with 1.5mL Eppendorf tubes
- Nuclease free water
Kits can almost certainly be substituted for similar versions from other manufacturers, but these have been empirically tested in Ae. aegypti and generates plasmid DNA and mRNA that require no further cleanup beyond the steps outlined here.
Safety warnings
For Safety Warnings and Hazard Information please refer to the SDS (Safety Data Sheet) for each kit.
Before start
*All* steps should be performed under RNAse-free conditions, with special care taken to do the final resuspension of plasmid and all steps of in vitro transcription with a separate set of RNAse- free pipettes/tips/tubes, and ideally on a separate bench from any bacterial work.
Purifying injection-ready integration plasmid
Perform a midiprep of the integration plasmid from a 50 mL overnight culture of your transposon integration plasmid.
Note
Be sure to follow the instructions precisely for all endotoxin-removal steps.
Fully dry the final pellet, and re-suspend in 50 µL nuclease free water , with nuclease free pipettes and tips.
Quantitate by NanoDrop or Qubit and record final concentration.
Expected result
Should be > 1 μg/μL - if much higher, should be diluted with nuclease free water to ~2 μg/μL and re-quantified.
Aliquot and store at -80 °C (unless preparing injection mix same-day, in which case, plasmid can be left on ice).
Note
If using the kit recommended here, plasmid is injection ready and needs no additional cleanup (at least for Ae. aegypti).
Generating transposase mRNA by in vitro transcription: template PCR
PCR:
To generate DNA template for IVT, perform PCR from a plasmid containing transposase cDNA. The primer sequences below represent an amplification strategy for wild-type or a hyperactive form of piggyBac transposase. To generate template for a different transposase (eg Mos), add the T7 polymerase initiation sequences and a linker to the 5’ end of a forward primer corresponding to the first 20-30 bp of the transposase sequence. Use an appropriate primer to match the reverse complement of the last 20-30 bp of the transposase sequence.
pBac forward primer (bold/italic represents T7 initiation sequence and necessary linkers):
GAAACTAATACGACTCACTATAGGGAGAGCCGCCACATGGGTAGTTCTTTAGACGATG
pBac reverse primer (wild-type PBac, our plasmid obtained from ITF/Rob Harrell):
CTTATTAGTCAGTCAGAAACAAC
Alternate pBac reverse primer:
TCAGAAACAACTTTGGCACATATCA
This reverse primer can be used when amplifying cDNA for a hyperactive PBac, described in Otte et al., 2018.
Citation
LINK
Perform a PCR reaction (scaled to 100 μL), using ~1 ng plasmid as template.
Note
I use KOD, but any polymerase should work. Adjust time and temperature accordingly. For KOD, I used an annealing temperature of 56° and extension time of 40s.
Run an agarose gel to verify the presence and appropriate size of the template.
To cleanup product, perform magnetic bead purification with RNAClean XP beads as described in the following sub-steps.
Note
All following steps should be performed with nuclease free water/tips/tubes/pipettes!!
Combine 1.5x volume of RNAClean XP beads to the PCR reaction in a 1.5 ml eppendorf tube.
Vortex to mix well.
Incubate for 00:05:00 at Room temperature .
Place on magnet stand until solution is clear; approximately 00:05:00 .
Remove supernatant.
Rinse beads with 300 µL freshly made 80% EtOH . (1/2)
Note
Use nuclease-free alcohol and water!
Let stand for 00:00:30 -00:01:00 . (1/2)
Remove supernatant. (1/2)
Rinse beads with 300 µL freshly made 80% EtOH . (2/2)
Note
Use nuclease-free alcohol and water!
Let stand for 00:00:30 -00:01:00 . (2/2)
Remove all remaining ethanol - switch to 10 μL tip! - and air dry for 00:10:00 until pellet is completely dry.
Remove from magnet stand and re-suspend bead pellet in 20 µL nuclease free water .
Incubate 00:10:00 at Room temperature and then return to magnet stand.
Once solution has fully cleared (~00:05:00 ), carefully transfer 18 µL supernatant with a 10 μL tip to a separate tube.
Check concentration with a spectrophotometer (Nanodrop) or Qubit.
Expected result
Hopefully >250 ng/μL!
Proceed to in vitro transcription (IVT) - any leftover template can be stored at -20 °C and used for subsequent IVT reactions.
Generating transposase mRNA by in vitro transcription: IVT
Note
All following steps should be performed with nuclease free water/tips/tubes/pipettes!!
Add reagents in the following order.
Nuclease free water (to 20 μL total reaction volume)
10 µL 2X ARCA/NTP Mix
2 µL PCR template
Note
2 μL - should be 500-1000 ng
2 µL T7 RNA Polymerase Mix
Mix thoroughly and pulse-spin to collect.
Incubate for 00:30:00 at 37 °C .
Add 2 µL DNAse I .
Mix thoroughly by pipetting up and down.
Incubate for 00:15:00 at 37 °C .
Remove 1 µL and save on ice for sizing and integrity analysis.
Add the following reagents.
66 µL nuclease free water
10 µL 10x Poly(A) polymerase reaction buffer
5 µL Poly(A) polymerase
Incubate for 00:30:00 at 37 °C .
Proceed immediately to cleanup and validation.
mRNA cleanup
Cleanup in vitro transcription reaction with RNAClean XP beads as described in the following substeps.
Combine 1.5x volume of RNAClean XP beads to the PCR reaction in a 1.5 ml eppendorf tube.
Vortex to mix well.
Incubate for 00:05:00 at Room temperature .
Place on magnet stand until solution is clear; approximately 00:05:00 .
Remove supernatant.
Rinse beads with 300 µL freshly made 80% EtOH . (1/2)
Note
Use nuclease-free alcohol and water!
Let stand for 00:00:30 -00:01:00 . (1/2)
Remove supernatant.
Rinse beads with 300 µL freshly made 80% EtOH . (2/2)
Note
Use nuclease-free alcohol and water!
Let stand for 00:00:30 -00:01:00 . (2/2)
Remove all remaining ethanol - switch to 10 μL tip! - and air dry for 00:10:00 until pellet is completely dry.
Remove from magnet stand and re-suspend bead pellet in 55 µL nuclease free water .
Incubate 00:10:00 at Room temperature and then return to magnet stand.
Once solution has fully cleared (~00:05:00 ), carefully transfer 50 µL supernatant with a 10 μL tip to a separate tube.
mRNA quantitation and sizing verification
Quantitate using spectrophotometer (Nanodrop) or Qubit.
Expected result
A successful IVT reaction should generate 50 μL of purified product at >400 ng/μL.
Run 1 µL final mix (alongside 1 µL reserved pre-poly(A)-tailing ) on a Bioanalyzer, Tapestation, or agarose gel with an RNA ladder.
Things to look for:
- Pre-poly(A)-tailing: a single, bright band with no sign of degradation products
- Post-poly(A)-tailing: one or multiple bands, broader in size distribution but all product should be longer than the pre-tailing product
This image is a Bioanalyzer gel representing wild-type (lanes 1, 2, and 4) and hyperactive PBac transposase (lanes 7, 8, and 10). Lanes 4 and 10 are post-poly(A)-tailing procedure.
Note the increased size of tailed product and the single coherent band in the pre-tailed product, with no evidence in either lane of degradation products.
Expected result
This procedure should generate >20 μg of injection-ready mRNA.
Proceed immediately to final injection mix preparation. Any leftover mRNA should be aliquoted and stored at -80 °C .
Final injection mix preparation
Combine mRNA and donor plasmid at final concentrations of 300 ng/μL each (or any other desired concentration). Any necessary dilution must be done with nuclease free water or nuclease free injection buffer, as appropriate. For Ae. aegypti, we use water.
Aliquot injection mix into 5 µL aliquots in small nuclease-free tubes.
Freeze at -80 °C .
Keep injection mixes frozen until immediately before injection. Thaw a single aliquot on ice for an injection session, and do not re-freeze.
Citations
Step 6
M. Otte, O. Netschitailo, O. Kaftanoglu, Y. Wang, R. E. Page Jr. & M. Beye. Improving genetic transformation rates in honeybees.
10.1038/s41598-018-34724-w