Jun 13, 2019

Public workspaceTransient transcriptome sequencing: experimental protocol to monitor genome-wide RNA synthesis including enhancer transcription

DOI
dx.doi.org/10.17504/protocols.io.3vzgn76
Transient transcriptome sequencing: experimental protocol to monitor genome-wide RNA synthesis including enhancer transcription
  • 1Max-Planck-Institute for Biophysical Chemistry, Department of Molecular Biology, Am Faßberg 11, 37077 Göttingen, Germany
Saskia Gressel
Open access
DOI: dx.doi.org/10.17504/protocols.io.3vzgn76
Protocol Citation: Saskia Gressel, Katja Lidschreiber, Patrick Cramer 2019. Transient transcriptome sequencing: experimental protocol to monitor genome-wide RNA synthesis including enhancer transcription. protocols.io https://dx.doi.org/10.17504/protocols.io.3vzgn76
Manuscript citation:
This manuscript will be published as a chapter in Methods in Molecular Biology.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Here, we describe an easy-to-use, detailed bench protocol for application of TT-seq, including in vitro transcribed RNA spike-in controls that enable normalization across samples, estimation of the amount of cross-contamination by non-labeled RNA, and a correction for antisense artifacts. This manuscript will be published as a chapter in Methods in Molecular Biology.
Created: June 07, 2019
Last Modified: June 13, 2019
Protocol Integer ID: 24217
Keywords: Transient transcriptome sequencing (TT-seq), nascent RNA, 4-thiouridine (4sU), RNA fragmentation, spike-ins, RNA synthesis, RNA processing, enhancer RNA (eRNA), transcription unit (TU) annotation, productive initiation rates
Abstract
Transcriptome analysis by RNA sequencing (RNA-seq) measures the steady-state abundance of cellular RNA, which is a result of the interplay of RNA synthesis and RNA degradation. In order to measure RNA synthesis, RNA can be labeled with 4-thiouridine (4sU) in cells, purified and sequenced (4sU-seq). Although 4sU-seq has a higher sensitivity than RNA-seq, it is not sensitive enough to reliably detect short-lived (transient) RNAs such as enhancer, antisense, and promoter-associated RNAs synthesized from large genomes such as the human genome. This is because when the 4sU labeling time is less than 30 min only a short 3’-region of transcripts is labeled, and a long pre-existing unlabeled 5’ region leads to a 5’-bias in the sequencing data. Transient transcriptome sequencing (TT-seq) overcomes this limitation by combining a short 4sU labeling pulse with an RNA fragmentation step. The labeled, newly synthesized RNA fragments are purified and sequenced, resulting in a very low fraction of contaminating non-labeled RNA. TT-seq is easy to use and includes RNA spike-in controls for global normalization between datasets from different samples. TT-seq enables studies of the kinetics of RNA metabolism, and mechanistic studies of transcription regulation. Also, TT-seq is ideally suited to monitor rapid changes in gene activity as well as the dynamics of enhancer landscapes during transcription responses.
Materials
MATERIALS
ReagentMEGAscript® T7 Transcription KitThermo ScientificCatalog #AM1334
ReagentKOD Hot Start DNA PolymeraseMillipore SigmaCatalog #71086-3
ReagentQubit RNA HS Assay KitThermo Fisher ScientificCatalog #Q32852
ReagentQubit assay tubesThermo Fisher ScientificCatalog #Q32856
ReagentERCC RNA Spike-In Mix or order custom-made synthetic sequencesThermo Fisher ScientificCatalog #4456740
ReagentTranscriptor First Strand cDNA Synthesis KitRocheCatalog #04379012001
ReagentQIAquick PCR purification columnsQiagenCatalog #28104
Reagent4-Thio-UTPJena BioscienceCatalog #NU-1156S
ReagentRNase-free AMPure XP beadsBeckman Coulter
Reagent4-thiouridine (4sU)Sigma AldrichCatalog #T4509
ReagentCell scraperCorningCatalog #3011
ReagentChloroformSigma AldrichCatalog #372978
ReagentEthanolMerck MilliporeCatalog #100983
ReagentIsopropanolMerck MilliporeCatalog #109634
Reagent1.5 mL Bioruptor Plus TPX micro tubesDiagenodeCatalog #C30010010-300
ReagentScrew Cap Micro Tube 2 mL polypropylene (PP)SarstedtCatalog #72.694.005
ReagentEZ-Link Biotin-HPDPThermo Fisher ScientificCatalog #21341
Reagent15 mL MaXtract High Density tubesQiagenCatalog #129065
ReagentµMACS Streptavidin KitMiltenyi BiotecCatalog #130-074-101
ReagentDL-dithiothreitol (DTT)Sigma AldrichCatalog #43815
ReagentmiRNeasy Micro KitQiagenCatalog #217084
ReagentRNase-Free DNase SetQiagenCatalog #79254
ReagentSodium Acetate Solution (3 M) pH 5.2Thermo Fisher ScientificCatalog #R1181
ReagentNaCl (5 M) RNase-freeThermo Fisher ScientificCatalog #AM9759
ReagentBioanalyzer RNA 6000 Nano KitAgilent TechnologiesCatalog #5067
ReagentOvation Universal RNA-Seq System (NuGEN)Tecan
ReagentAnyDeplete (formerly InDA-C)Tecan
ReagentKAPA Library Quantification KitKapa Biosystems
ReagentBioanalyzer DNA 1000 ChipAgilent TechnologiesCatalog #5067
All materials, consumables and chemicals must be sterile, RNase-free, molecular biology grade.

It is essential to use RNase-free equipment.
Buffers and Stock Solutions
Buffers and Stock Solutions
Prepare Concentration50 mM 4-thiouridine (4sU) stock solution. Dissolve 4sU in sterile RNase-free PBS. Store in small aliquots at Temperature-20 °C .
Note
Thaw 4sU only once, and use immediately. As 4sU is photoactivatable and crosslinks to proteins at 365 nm, avoid light sources that emit this wavelength. The incorporation of 4sU can be validated by dot blot (see e.g. Radle et al. 2013).


Prepare EZ-link HPDP-biotin stock solution. EZ-link HPDP-biotin is pyridyldithiol-activated and allows thiol-specific biotinylation of labeled RNA. Dissolve in dimethylformamide (DMF) to Concentration1 mg/mL , mix thoroughly and incubate at Temperature37 °C until it is completely dissolved. Repeat mixing if needed. Store in small aliquots in 2 mL PP micro tubes at Temperature-20 °C .
Note
Please refer to safety data sheet for hazardous identification of DMF. Always wear gloves and eye protection. Avoid contact with skin or clothing. Use in a chemical hood. Avoid breathing vapor. DMF should not get in contact with incompatible plastic materials. Eluted plastic might be carried along and causes substantial loss of labeled RNA.

Note
Regarding the use of MTS-biotin (Duffy et al. 2015) in replacement of HPDP-biotin. We performed extensive control experiments to evaluate the described use of MTS-biotin in replacement of HPDP-biotin for our TT-seq protocol. For instance, we used 4sU-free total cellular RNA spiked-in with 0.1 % of 4sU labeled spike-ins, to assess the specificity of both biotins. When using MTS-biotin we found high levels of cross-contamination in the 4sU-pulldown fraction with unlabeled cellular RNA. This is in agreement with Marzi and Nicassio 2018 who detected 10-fold higher background levels for MTS-biotin compared to HPDP-biotin. Recently an improved MTS-biotin protocol including optimized biotin chemistry (MTS-resin) was developed (Duffy et al. 2018). As we have not yet tested this improved biotinylation protocol, we recommend to carry out careful control experiments before using this alternative for TT-seq.

Prepare 10x biotinylation buffer containing Concentration100 mM Tris HCl pH 7.4 and Concentration10 mM EDTA pH 8.0. Store in small aliquots at Temperature4 °C .
Prepare µMACS wash buffer containing Concentration100 mM Tris HCl pH 7.4, Concentration10 mM EDTA pH 8.0, Concentration1 M NaCl, Concentration0.1 % (vol/vol) Tween20.
Prepare Concentration1 M DL-dithiothreitol (DTT) in RNAse-free H2O. Store in small aliquots at Temperature-20 °C . Thaw only once, and dilute to Concentration100 mM before use.

Prepare miRNeasy Micro Kit buffer RWT with isopropanol instead of ethanol (see manufacturer's instructions for “DNase digestion for samples containing <1 μg total RNA approximately”).
Spike-in Pool Preparation (based on Schwalb et al. 2016)
Spike-in Pool Preparation (based on Schwalb et al. 2016)
Six synthetic RNA spike-in controls (three unlabeled and three 4sU labeled spike-ins) were established for validation of labeled RNA enrichment, global normalization and for estimating possible cross-contamination from unlabeled RNA fragments. The spike-ins are derived from selected RNAs of the ERCC RNA Spike-in Mix (Schwalb et al. 2016). We chose six spike-ins of about 1,000 nt length, a GC content between 40 to 60 % and similar uridine content. The IVT simulates the in vivo labeling of the cells, assuming that one out of ten uridine bases is substituted with 4sU. If polyadenylated RNA spike-ins are required, add a poly(A) tailing step after PCR amplification, or perform the IVT directly from custom-made DNA sequences containing poly(A) tails.

Selected RNA spike-ins derived from the ERCC RNA Spike-in Mix.
ERCC IDLength (nt)%UTP%4sUTP%GCName (TT-seq)
00043 985901034Spike-in 1
00170949100035Spike-in 2
001361,014901043Spike-in 3
001451,015100046Spike-in 4
000921,079901052Spike-in 5
000021,037100053Spike-in 6

Note
Steps 8-12 can be omitted by ordering custom-made DNA sequences.

Perform first strand cDNA synthesis using the Transcriptor First Strand cDNA Synthesis Kit with Anchored-oligo (dT) primers. Follow manufacturer’s instructions, use Amount1 µL ERCC RNA Spike-in Mix.
Amplify specific spike-ins from Amount1 µL of 1:4 diluted cDNA using KOD Hot Start DNA Polymerase following manufacturer’s instructions (30 cycles).

Primer sequences to amplify the cDNA template for IVT reaction of RNA spike-ins.
Primer name (TT-seq)Sequence 5'>3'Annealing temperature (°C)
Spike-in 1 forwardTAATACGACTCACTATAGGGTGCTTTAACAAGAGGAAATTGTGT53
Spike-in 1 reverseCCATCTTGTTTATAAAATCCTAATTACTC53
Spike-in 2 forwardTAATACGACTCACTATAGGGGGCACAAGTTGCTGAAGTTGC55
Spike-in 2 reverseTCTGCTGTAATCTCAGCTCC55
Spike-in 3 forwardTAATACGACTCACTATAGGGTTTCGACGTTTTGAAGGAGGG53
Spike-in 3 reverseGTACCCGGGAAAATCCTAGTTC53
Spike-in 4 forwardTAATACGACTCACTATAGGGACTGTCCTTTCATCCATAAGCGG55
Spike-in 4 reverseCGCACGCCGAATGATGAAACG55
Spike-in 5 forwardTAATACGACTCACTATAGGGGATGTCCTTGGACGGGGT55
Spike-in 5 reverseGCTTTCGGAGCAAATCGCG55
Spike-in 6 forwardTAATACGACTCACTATAGGGCCAGATTACTTCCATTTCCGCC55
Spike-in 6 reverseGGGTAAAACGCAAGCACCG55


Purify PCR products with QIAquick PCR purification columns following manufacturer’s instructions. Elute in Amount30 µL .
Control size and purity of PCR products by gel electrophoresis.
Note
Optional cDNA purification: if PCR products show contamination with smaller fragments, isolate the PCR product of the desired size by gel extraction (e.g. by QIAquick Gel Extraction Kit).

Verify sequence of PCR products by Sanger sequencing.
Use Amount0.5 µg PCR product (or, custom-made DNA) as input for in vitro transcription (IVT) using the MEGAscript T7 kit. Follow manufacturer’s instructions, except for IVT of labeled RNA spike-ins (referred to as 1, 3, 5) substitute Concentration10 % of UTP with 4-Thio-UTP.
Purify RNA spike-ins with RNase-free AMPure XP beads following manufacturer’s instructions.
Use the Qubit HS RNA Kit and Agilent RNA 6000 Nano Kit for quantification and quality assessment.





For the final RNA spike-in pool containing equimolar amounts of all six RNA spike-ins, add each RNA spike-in to a final concentration of Concentration1 ng/µL .
Assess the actual concentration of your RNA spike-in pool by Qubit HS RNA Kit and use this concentration as your working concentration.
Store RNA spike-in pool in small, one-time use aliquots at Temperature-80 °C (see Step 25 for the required amount of spike-ins per sample).
Cell Treatment and 4sU Labeling
Cell Treatment and 4sU Labeling
The required number of cells depends on the cell line under study. The exact cell count is required to calculate the corresponding amount of RNA spike-ins.
Note
Depending on cell type specific parameters (doubling time, transcriptional activity, and amount of cellular RNA), between 300 to 600 µg total RNA are needed to isolate sufficient amounts of labeled RNA (> 50 ng). To establish a 4sU-labeling experiment, determine first how many cells are needed to yield 300 (or 600 µg) of total RNA and then, how much labeled RNA can be isolate from 300 µg (or 600 µg) input RNA. Based on these results, calculate the required number of cells. Typically, for 5 min of 4sU labeling the required number of cells is 1.5 to 5 x 107. At the time of labeling cells should still be in their exponential growth phase to ensure high transcriptional activity. Therefore, we label cells at around 70 % confluence.

Optional: add treatment prior to 4sU labeling.
Note
Labeling of control and treated cells: when comparing TT-seq of control and manipulated cells it is critical that cell densities and labeling times are kept consistent for comparable 4sU uptake and incorporation.

Labeling of Adherent Cells
24-48 h before the experiment, plate the required number of cells in 15 cm dishes (Amount20 mL culture medium). Seed 1-2 additional plates for cell counting.
Duration00:30:00 before labeling thaw 4sU stock solution on ice and count cells.
For 4sU labeling, incubate cells with a final concentration of Concentration500 µM 4sU at Temperature37 °C , Concentration5 % CO2 for exactly Duration00:05:00 .

Note
4sU labeling of adherent cells: just before labeling, pipet the required amount of 4sU for each plate into a sterile 50 mL tube. Remove half of the culture medium from each plate (it is important to leave some volume behind to not stress the cells) and add to the 50 mL 4sU-tube, mix and immediately pour back. Do not handle more than three plates in parallel.


Note
4sU concentration and labeling time can be adjusted to yield more labeled RNA. However, it is important to balance labeling concentration and time to avoid possible inhibition of rRNA synthesis (Burger et al. 2013) and cell toxicity.



After Duration00:05:00 quickly remove culture medium and add Amount4.5 mL of TRIzol lysis reagent.
Safety information
Please refer to safety data sheet for hazardous identification of TRIzol lysis reagent. Always wear gloves and eye protection. Avoid contact with skin or clothing. Use in a chemical hood. Avoid breathing vapor.

"Wash" cells off the plate by pipetting up and down. If cells are very adherent, use a TRIzol compatible cell scraper.
Transfer cell lysate to 15 mL polypropylene (PP) centrifuge tube and incubate up to Duration00:05:00 .
Note
Use centrifuge tubes for high speed (≥13,000 g) centrifugation.

Note
If several plates are labeled simultaneously, two lysates from the same condition can be pooled into one PP tube (minimizes the number of tubes).

Optional: store lysates at Temperature-80 °C .
Labeling of Suspension Cells
Dilute cells 48 h before the labeling experiment and exchange growth medium one day before labeling.
Duration00:30:00 before labeling thaw 4sU stock solution on ice and count cells.
Add Amount500 µL of 4sU stock solution to cells in Amount50 mL of growth medium to a final concentration of Concentration500 µM , and incubate at Temperature37 °C , Concentration5 % CO2.

Exactly after Duration00:05:00 of labeling, centrifuge at Temperature37 °C and 500-1,500 x g for Duration00:02:00 . Discard supernatant by decanting.
Add Amount5 mL of TRIzol lysis reagent to cell pellet. Vortex until no cells are visible (Duration00:00:30 ).
Incubate for Duration00:05:00 . Transfer to 15 mL PP centrifuge tubes.
Note
Use centrifuge tubes for high speed (≥13,000 x g) centrifugation.


Optional: store lysates at Temperature-80 °C .
RNA Spike-in Pool Addition and Total RNA Extraction
RNA Spike-in Pool Addition and Total RNA Extraction
If lysates were frozen, thaw quickly at Temperature65 °C (water bath), then cool on ice for Duration00:05:00 .
Thaw RNA Spike-in mix at Temperature65 °C for Duration00:02:00 , cool on ice for Duration00:01:00 and mix gently by pipetting.

Add Amount2.4 ng spike-in mix per 106 cells to TRIzol cell lysate.
Note
RNA spike-in addition to cell lysate: the amount of RNA spike-ins depends on the complexity and concentration of the final sample, but also on how deep the library is sequenced. In general, a balance between detecting the spike-ins and not having too many sequencing reads for spike-ins is recommended.

Vortex gently and incubate for Duration00:05:00 .
Add Amount0.2 mL of chloroform per Amount1 mL of TRIzol lysis reagent.
Shake vigorously for Duration00:00:15 and incubate for Duration00:03:00 .
Centrifuge at Temperature4 °C and Centrifigation13000 x g for Duration00:15:00 .
Carefully transfer upper, aqueous phase into new 15 mL centrifuge tube.
Add an equal volume of isopropanol to precipitate RNA, vortex gently.
Incubate for Duration00:10:00 .

Centrifuged at Temperature4 °C and Centrifigation13000 x g for Duration00:10:00 .
Wash RNA pellet twice, first using an equal volume, then Amount1 mL of Concentration75 % ethanol. Spin in-between at Temperature4 °C and Centrifigation13000 x g for Duration00:10:00 .
Remove supernatant with 1 mL pipette. Spin down briefly and use 200 μL pipette to remove remaining ethanol. Eventually, spin down again and use 10 μL pipette.
Dissolve pellet in 200-1,000 µL H2O (aim for a final concentration of ≥ 750 ng/μL).
Transfer RNA to 1.5 mL tube.
Note
Optional: pool samples from the same condition into one tube.

Determine concentration and purity by NanoDrop spectrophotometer; 260/280 value should be >2.
Save Amount1 µL of total RNA for quality control on Agilent Bioanalyzer RNA 6000 Nano Chip (Step 45).
Optional: store at Temperature-80 °C .
Mild RNA Fragmentation (based on Schwalb et al. 2016)
Mild RNA Fragmentation (based on Schwalb et al. 2016)
Cool Bioruptor Plus to Temperature4 °C before use. Transfer Amount300 µg of total RNA to 1.5 mL Bioruptor Plus TPX microtubes, adjust to Concentration750 ng/µL .
Note
If processing Amount600 µg RNA: use two 1.5 mL Bioruptor Plus TPX microtubes (Amount300 µg each).


Note
RNA fragmentation using Covaris S220: transfer two-times Amount150 µg of total RNA (each in a final volume of Amount130 µL ) to 130 µL microTUBE AFA Fiber Snap-Cap tubes. Use the following settings: water level 12, temperatureTemperature7 °C , peak incident power 100 W, duty factor 1 %, cycles per burst 200, treatment time 10-60 sec.


Fill empty positions in the tube holder with tubes containing Amount400 µL water.
Settings: 1 cycle, 30 sec ON, 30 sec OFF at HIGH power.
Transfer (optional: pool) samples to 2 mL PP microtubes. Continue immediately with the biotinylation reaction.
After fragmentation, use Amount1 µL of total fragmented RNA for quality control on Agilent Bioanalyzer RNA 6000 Nano Chip and compare to Amount1 µL of total RNA. For expected results see Step 94.
Biotinylation of 4sU Labeled RNA (based on Dölken et al. 2008)
Biotinylation of 4sU Labeled RNA (based on Dölken et al. 2008)
Denature total fragmented RNA at Temperature65 °C for Duration00:10:00 , then place on ice for Duration00:05:00 .
Save Amount5 µL of total fragmented RNA for DNase I digest (Step 75).
Split remaining total fragmented RNA in two 2 mL PP microtubes (Amount150 µg /reaction) and process in parallel in Steps 49-53.
Note
If processing Amount600 µg RNA: split total fragmented RNA in four 2 mL PP microtubes (Amount150 µg /reaction) and process in parallel (Steps 49-53).



Add water up to Amount700 µL .
Prepare biotin master mix in the stated order: Amount100 µL of 10x biotinylation buffer, Amount200 µL of EZ-link HPDP-Biotin stock solution.
Add Amount300 µL biotin master mix to each sample and mix immediately.
Incubate in the dark with rotation for Duration02:00:00 .
Shortly before use, prepare 15 mL MaXtract High Density tubes following the manufacturer's instruction.
Transfer biotin-RNA mix to MaXtract High Density tubes, pool reactions from the same condition.
Add an equal volume of chloroform. Mix vigorously for Duration00:00:15 and incubate for Duration00:03:00 .
Centrifuge at Centrifigation1500 x g for Duration00:05:00 .
Transfer upper phase into 15 mL PP centrifuge tube.
For RNA precipitation, add 1/10 volume of Concentration5 M NaCl and an equal volume of isopropanol. Vortex gently.
Centrifuge at Temperature4 °C and Centrifigation13000 x g for Duration00:30:00 . Remove supernatant.
Wash RNA pellet twice, first using an equal volume, then Amount1 mL of Concentration75 % ethanol. Spin in-between at Temperature4 °C and Centrifigation13000 x g for Duration00:10:00 .
Remove supernatant with 1 mL pipette. Spin down briefly and use 200 μL pipette to remove remaining ethanol. Optionally, spin down again and use 10 μL pipette.
Resuspend RNA in Amount100 µL H2O per Amount300 µg biotinylation reaction: chill on ice Duration00:10:00 , then heat at Temperature65 °C for Duration00:10:00 , put on ice and carefully resuspend by pipetting. Transfer to 2 mL LoBind tubes.
Continue immediately with 4sU pull-down.
Pull-down of 4sU Labeled RNA Using Streptavidin-Beads
Pull-down of 4sU Labeled RNA Using Streptavidin-Beads
Use one µMACS column per Amount300 µg (Amount200 µL ) RNA.
Note
If processing Amount600 µg RNA: use two µMAC columns with Amount300 µg (Amount200 µL ) RNA each.



Heat µMACS wash buffer (Amount3 mL /µMAC column) to Temperature65 °C .
Add Amount100 µL of µMACS streptavidin beads to Amount200 µL RNA.
Incubate at Temperature4 °C with rotation for Duration00:15:00 .
In the meantime, equilibrate µMACS columns with Amount100 µL of nucleic acids equilibration buffer (equilibrate at RT Duration00:10:00 before use).
Transfer RNA-bead-mix to the µMACS column, collect the flow-through in LoBind tubes and reapply to the µMACS column. Discard flow-through.
Wash 3-times with Amount900 µL of µMACS wash buffer (Temperature65 °C ). Discard flow-through.
Wash 3-times with Amount900 µL of µMACS wash buffer (TemperatureRoom temperature ). Discard flow-through.


Place 1.5 ml LoBind tubes underneath the columns.
Elute labeled RNA in Amount100 µL of Concentration100 mM DTT.



After Duration00:05:00 elute in additional Amount100 µL of Concentration100 mM DTT.



Final RNA Clean-up and DNase Digest
Final RNA Clean-up and DNase Digest
Prepare Amount1 µg total fragmented RNA (Step 47). Mix samples thoroughly by shaking for Duration00:00:15 .

Total fragmented RNA (1 µg)200 µL
3 M NaAc pH 5.215 µL
100 % ethanol300 µL

Note
From here on use low binding pipette tips. Process labeled RNA and Amount1 µg of total fragmented RNA in parallel.




Prepare labeled RNA (Step 74). Mix samples thoroughly by shaking for Duration00:00:15 .

4sU labeled RNA200 µL
100 % ethanol300 µL

Transfer samples onto miRNeasy MinElute spin column in a 2 mL collection tube.
Note
If processing labeled RNA isolated from Amount600 µg total fragmented RNA: pool samples from the same condition onto one RNeasy MinElute spin column by repeating Step 78.


Centrifuge at Centrifigation8000 x g for Duration00:00:15 . Reload flow-through.


Wash with Amount350 µL of RWT buffer by centrifugation at Centrifigation8000 x g for Duration00:00:30 .


Prepare DNase mix: Amount70 µL RDD buffer and Amount10 µL RNase-free DNase I, mix by pipetting or inverting.
Add Amount80 µL DNase master mix to each column and incubate for Duration00:15:00 .


Add Amount500 µL of RWT buffer.

Centrifuge at Centrifigation8000 x g for Duration00:00:30 . Reload flow-through.


Centrifuge at Centrifigation8000 x g for Duration00:00:30 . Discard flow-through.


Add Amount500 µL of RPE buffer.

Centrifuge at Centrifigation8000 x g for Duration00:00:30 .


Place column into a new 2 mL collection tube.
Wash with Amount500 µL of Concentration80 % ethanol. Centrifuge at Centrifigation8000 x g for Duration00:02:00 . Place column into new 2 mL collection tube.
To dry the membrane, open the lid and centrifuge at full speed for Duration00:05:00 .
Place column into new 1.5 mL LoBind tube.
Elute with Amount15 µL of nuclease free H2O (not DEPC treated) by centrifugation at full speed for Duration00:01:00 . Reload flow-through for a second elution. If a low labeled RNA yield is expected: use Amount11 µL of H2O and incubate Duration00:01:00 before centrifugation.

Transfer RNA to a new 1.5 mL LoBind tube.
Measure RNA concentration with Qubit RNA HS Kit and analyze RNA integrity on Agilent Bioanalyzer RNA 6000 Pico Chip.
Expected Result
Expected Result
Examples of RNA integrity profiles of total, total fragmented and labeled RNA isolated from human cell lines.
Expected result
Total fragmented RNA should be in a range between 0.2 and 15 kbp. Fragmentation efficiency might differ for RNA from another organisms. Thus, it is recommended to perform initial trials with your cell lines. Be aware that after sonication it is expected that the RIN value drops since rRNA is also fragmented.
Agilent Bioanalyzer profiles of total RNA (a) and total fragmented RNA (b) on a RNA 6000 Nano Chip. Agilent Bioanalyzer profiles of labeled RNA on a RNA 6000 Pico Chip from a cell line with high (c) and low (d) amounts of labeled RNA.
Agilent Bioanalyzer profiles of total RNA (a) and total fragmented RNA (b) on a RNA 6000 Nano Chip. Agilent Bioanalyzer profiles of labeled RNA on a RNA 6000 Pico Chip from a cell line with high (c) and low (d) amounts of labeled RNA.

Highly recommended: validation of labeled RNA enrichment by reverse transcription PCR (RT-qPCR) of RNA spike-ins.

Note
Control of labeled RNA enrichment by RT-qPCR. Prepare cDNA from Amount400 ng total fragmented RNA and Amount1 µL labeled RNA, and perform RT-qPCR. Use primer pairs for RNA spike-ins to estimate labeled RNA enrichment, and (optional) for endogenous model genes of your choice to measure the intron enrichment.

Primer sequences for RT-qPCR of RNA spike-ins to control enrichment of labeled RNA.
Primer name (TT-seq)Sequence 5'>3'Annealing temperatureAmplicon size (bp)
Spike-in 1 forwardACAATTCCAAATAGCGACCACATCA59150
Spike-in 1 reverseTACCTCAACCCTTCCAGTGTCTAAG58
Spike-in 2 forwardAGACTGGCATTCCCGTGATA5797
Spike-in 2 reverseGCTAAAACCCCTGCCTGCAA60
Spike-in 3 forwardCCGAGTTCGCCTTACTGCTC6095
Spike-in 3 reverseAATCGATCGGAATCACGCCG60
Spike-in 4 forwardCATAAGCGGAGAAAGAGGGAATGAC59103
Spike-in 4 reverseGCTAAATAGAGAGCATCCACACCTC58
Spike-in 5 forwardCGTTAATGCAGAGGCTAAGGACAAT59103
Spike-in 5 reverseGATCGTTACAAACCCACTACGTGTC59
Spike-in 6 forwardGTCCTGATTTACTGGACTCGCAAC58118
Spike-in 6 reverseTCTGTATAAGGTGATCGCAGGTTGT59

Expected result
For total fragmented RNA, the Ct values of labeled and unlabeled RNA spike-ins are very similar. Labeled RNA shows a Ct value difference of 6-10 for labeled and unlabeled RNA spike-ins. For the selected model gene, intron levels should be enriched in labeled RNA compared to total fragmented RNA.

Library Preparation
Library Preparation
We recommend using Amount100 ng (at least Amount50 ng ) labeled RNA and Amount100 ng total fragmented RNA as library input.
Note
We recommend using the Ovation Universal RNA-Seq System (NuGEN). The option of using only random primers for cDNA synthesis omits the 3' bias generated by poly-(dT) primers. Also, the NuGEN kit depletes ribosomal RNA by sequence-specific probes (AnyDeplete technology, formerly known as InDA-C).

Note
Total fragmented RNA samples are needed to estimate RNA half-lives and correct the cross-contamination using RNA spike-ins. If the cross-contamination rate is similar across your libraries (which can be estimated from the RNA spike-ins), labeled RNA might be sufficient.

For ‘First Strand Primer Pre-mix Preparation’, use only Random primer mix. Substitute poly-d(T) primers with Amount0.4 µL H2O.
Follow the User guide’s instruction from ‘First Strand Synthesis Using DNase-treated RNA’ to ‘Second Strand cDNA Synthesis’.
For ‘cDNA fragmentation’ (200-400 bp) using a Bioruptor Plus device: Aliquot Amount100 µL cDNA in Qubit assay tubes. Fill up empty positions in the tube holder with tubes containing Amount100 µL water. Do 15 cycles, 30 sec ON, 30 sec OFF at LOW power. Spin down samples and add another 10 cycles. If the Bioruptor is not connected to an automated cooling system. Cool the water bath with ice in-between the 15 and 10 cycles.

Note
cDNA fragmentation using Covaris S220 (200-400 bp): transfer cDNA to 130 µL microTUBE AFA Fiber Snap-Cap tube. Use the following settings: water level 12, temperatureTemperature7 °C , peak incident power 145 W, duty factor 10 %, cycles per burst 200, treatment time 50-180 sec.

Follow the User guide’s instruction from ‘cDNA Concentration After Fragmentation’ to ‘Adaptor Cleavage’.
Before ‘PCR amplification’: To avoid over-amplification determine the precise number of PCR cycles by the KAPA HIFI Library Amp Real Time kit following manufacturer’s instructions. As input, use Amount4.2 µL (~10 %) of the library, Amount5 µL of 2x Kapa HiFi Hot Start Master Mix and Amount0.8 µL Amplification Primer Mix P2 (NuGEN).
For ‘PCR amplification’ of the remaining Amount45 µL of library use the determined number of PCR cycles and follow the User guide’s instructions for amplification as described in the Appendix ‘Using qPCR to determine the Number of PCR Cycles’.

Proceed from ‘Bead Purification of the Amplified Material’ to ‘Quantitative and Qualitative Assessment of the Library’.
Assess the quality of the library on Bioanalyzer DNA 1000 Chip and send to sequencing service providers for high throughput sequencing.
Paired-end Illumina Sequencing
Paired-end Illumina Sequencing
Universal RNA-Seq with NuQuantThe read length for human transcriptomes should be between 35 to 150 bp depending on the desired application. For alternative splicing detection, longer reads are recommended, i.e. 150 bp paired-end sequencing. Recommended coverage: in general, 25 to 50 million reads per sample are sufficient for an initial analysis of highly expressed transcripts. 100 million reads is the required sequencing depth for annotation of enhancer RNAs or antisense RNAs in TT-seq (labeled RNA) samples (see Deveson et al. 2017 for review). If the focus of a study is on newly synthesized RNA fragments, total fragmented RNA-seq libraries can be sequenced with a lower coverage, i.e. 30 million reads. If a study aims to study RNA stability, TT-seq and total fragmented RNA-seq libraries should be sequenced at similar coverage.
Computational analysis
Computational analysis
The bioinformatics workflow used to analyze TT-seq data is presented in Villamil et al. 2019. The pre-print describe pre-processing steps, including a reliable and robust normalization strategy, and several downstream analysis tools that enable the user to quantify RNA synthesis, splicing and degradation activities.