Feb 16, 2019
The estimation of the relative gene expression in the hypothalamus and liver of agouti mice using quantitative reverse transcription PCR
- Kira V. Derkach1,
- Irina O. Zakharova1,
- Inna I. Zorina1,
- Andrey Bakhtyukov1,
- Irina V. Romanova1,
- Liubov V. Bayunova1,
- Alexander O. Shpakov1
- 1Sechenov Institute of Evolutionary Physiology and Biochemistry, Russian Academy of Sciences, Saint Petersburg, Russia
External link: https://doi.org/10.1371/journal.pone.0213779
Protocol Citation: Kira V. Derkach, Irina O. Zakharova, Inna I. Zorina, Andrey Bakhtyukov, Irina V. Romanova, Liubov V. Bayunova, Alexander O. Shpakov 2019. The estimation of the relative gene expression in the hypothalamus and liver of agouti mice using quantitative reverse transcription PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.xrnfm5e
Manuscript citation:
Derkach KV, Zakharova IO, Zorina II, Bakhtyukov AA, Romanova IV, Bayunova LV, Shpakov AO. (2019) The evidence of metabolic-improving effect of metformin in Ay/a mice with genetically-induced melanocortin obesity and the contribution of hypothalamic mechanisms to this effect. PLoS ONE
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 05, 2019
Last Modified: February 16, 2019
Protocol Integer ID: 19982
Keywords: Quantitative reverse transcription polymerase chain reaction, qPCR, rt-PCR, qRT-PCR
Abstract
Female C57Bl/6J mice have a mutation in the Ay locus associated with overexpression of ASIP1, an antagonist of the types 3 and 4 melanocortin receptors. This mutation is characterized by the development of the melanocortin-type obesity. After treatment of the agouti mice with metformin (MF) in the different doses for 10 days, the hypothalamus and liver sections of wild-type mice, untreated agouti-mice and MF-treated agouti-mice were dissected, and the expression of the genes encoding the components of the hypothalamic signaling systems and the liver proteins were estimated by a quantitative reverse transcription PCR (qRT-PCR). The total RNA was isolated using ExtractRNA Reagent. The reverse transcription reaction was carried out using MMLV RT kit. The polymerase chain reaction was performed using the qPCRmix-HS SYBR + LowROX, and the amplified signals were detected with the Applied Biosystems® 7500 Real-Time PCR System (“Life Technologies, Thermo Fisher Scientific Inc.”, Waltham, Massachusetts, USA). The primers for the genes of signal proteins were selected using the Primer-BLAST web application. The genes encoding 18S rRNA and hypoxanthine-guanine phosphoribosyl transferase (Hprt) were used as an endogenous control. Relative expression was calculated using the ddCt method compared with the control group.
Materials
For qRT-PCR of signaling and effector proteins, the following reagents were used:
- ExtractRNA Reagent (TRIzol analogue) (“Evrogen”, Moscow, Russia)
- MMLV RT kit (“Evrogen”, Moscow, Russia)
- qPCRmix-HS SYBR+LowROX ("Evrogen", Moscow, Russia)
- Set of the forward and reverse primers for mice genes encoding the leptin receptor (Lepr), types 3 and 4 melanocortin receptors (Mc3r and Mc4r), pro-opiomelanocortin (Pomc), agouti-related peptide (Agrp), neuropeptide Y (Npy), BAX (Bax), BCL-2 (Bcl-2), interleukin 1β (IL1beta), TNF-α (TNFalpha), 18S RNA (18SRna) and hypoxanthine-guanine phosphoribosyl transferase (Hprt).
Before start
Primers were selected using literature and the web application Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Then, a verification of the efficiency of the primers was carried out at the specified annealing temperature. The 18S Rna and Hprt genes were used as an endogenous controls.
Preparation of samples
Preparation of samples
In the end of experiment animals were decapitated, and the hypothalamus and liver sections were removedand frozen immediately at -80°C before the analysis and then used for qRT-PCR
Total RNA was isolated from the sections of the hypothalamus and liver using the ExtractRNA Reagent (TRIzol analogue) (“Evrogen”, Moscow, Russia) according to the manufacturer‘s protocol. (http://evrogen.com/)
The samples containing 1 μg of RNA were reverse-transcribed to cDNA using the MMLV RT kit (“Evrogen”, Moscow, Russia) and the random oligodeoxynucleotide primers were used according to the manufacturer‘s protocol. (http://evrogen.com/)
Preparation of reaction mixture in the 96-well plate
Preparation of reaction mixture in the 96-well plate
The 51µl of distillated water add to a 200 µl PCR-tube.
Add 15µl of qPCRmix-HS SYBR+LowROX ("Evrogen", Moscow, Russia).
Add 6µl of the forward and reverse primer mixture until 0.4 µМ of each.
Add 3µl sample containing 30 ng of cDNA or distilled water in control sample.
Mix the solution by pipetting and quick spin.
Dispend the PCR tube containing the reaction mixture (75 µl) into three wells (25 µl in each) in the 96-well plate. Cover the plate with the seal for qPCR plates.
Briefly mix and centrifuge 96-well plate in the centrifuge/vortex for the PCR plates and confirm that reaction mixture is at the bottom of the wells, with no bubbles.
Place the 96-well plate into the Applied Biosystems® 7500 Real-Time PCR System (“Life Technologies, Thermo Fisher Scientific Inc.”, Waltham, Massachusetts, USA).
PCR analysis
PCR analysis
The following qPCR amplification protocol is used: an initial denaturation at 95 °C for 5 min; a three-step amplification andquantification program consisting of 38 cycles of 95 °C for 30 s, 55–58 °C for10 s (annealing temperature depends on the specific pair of the primers), and 72 °C for 30 s; and the ABI Melt Curve program to verify the presence of a single peak and the absence of primer-dimer formation in eachtemplate-containing reaction. The expression of each gene from all the studied groups of animals is determined on the same plate.
| No | Gene | Localization | Primer | NCBI Reference Sequence | Temperature of annulling | |
| 1 | Pomc | For 5’–3’ | CAGTGCCAGGACCTCACC | NM_008895.4 | 55 | |
| Rev 5’–3’ | CAGCGAGAGGTCGAGTTTG | |||||
| 2 | Agrp | For 5’–3’ | ACAACTGCAGACCGAGCAGAA | NM_001271806.1 | 58 | |
| Rev 5’–3’ | CGACGCGGAGAACGAGACT | |||||
| 3 | Npy | For 5’–3’ | CGGGAGAACAAGTTTCATTTCC | NM_023456.3 | 56 | |
| Rev 5’–3’ | ACAGAAAACGCCCCCAGAAC | |||||
| 4 | Lepr | For 5’–3’ | GCATGCAGAATCAGTGATATTTGG | NM_146146.2 | 56 | |
| Rev 5’–3’ | CAAGCTGTATCGACACTGATTTCTTC | |||||
| 5 | Mc3r | For 5’–3’ | CAAGGAGATTCTCTGCGGCT | NM_008561.3 | 56 | |
| Rev 5’–3’ | TCCCGTCTGAGCGTTGTTTT | |||||
| 6 | Mc4r | For 5’–3’ | GGGTCGGAAACCATCGTCAT | NM_016977.4 | 56 | |
| Rev 5’–3’ | TGCAAATGGATGCGAGCAAG | |||||
| 7 | Bax | For 5’–3’ | TGGAGCTGCAGAGGATGATTG | NM_007527.3 | 56 | |
| Rev 5’–3’ | GAAGTTGCCGTCAGAAAACATG | |||||
| 8 | Bcl2 | For 5’–3’ | GTGGATGACTGAGTACCTGAAC | NM_009741.5 | 55 | |
| Rev 5’–3’ | GAGACAGCCAGGAGAAATCAA | |||||
| 9 | IL1beta | For 5’–3’ | TCCAGGATGAGGACATGAGCAC | NM_008361.4 | 56 | |
| Rev 5’–3’ | GAACGTCACACACCAGCAGGTTA | |||||
| 10 | TNFalpha | For 5’–3’ | TATGGCCCAGACCCTCACA | NM_013693.3 | 56 | |
| Rev 5’–3’ | GGAGTAGACAAGGTACAACCCATC | |||||
| 11 | Hprt | For 5’–3’ | AGCCGACCGGTTCTGTCAT | NM_013556.2 | 57 | |
| Rev 5’–3’ | GGTCATAACCTGGTTCATCATCAC | |||||
| 12 | 18S rRNA | For 5’–3’ | GGGAGCCTGAGAAACGGC | NR_003278.3 | 57 | |
| Rev 5’–3’ | GGGTCGGGAGTGGGTAATTT |
qRT-PCR amplification continues about 2 hours.
The melting curve analysis should show the presence of a single peak and the absence of the primer dimers in each reaction containing the sample.
Data analysis
Data analysis
Data analysis is performed using the 7500 Software v2.0.6 and the Expression Suite Software v1.0.3. All the data are presented as relative mRNA level of the target gene (RQ). The calculation of the expression level of the target gene produced by the method of ΔΔCT (Schmittgen, Livak, 2008):
ΔCT =CT gene of interest – CT endogenous control
ΔΔCT = ΔCT sample or control – ΔCT control mean
RQ= 2-ΔΔCT
To calculate the RQ values for the control and experimental groups, the mean ΔCT control is calculated, which is subtracted from all the control and experimental ΔCT.