Nov 08, 2023

Testing ER stress induction in Cultured Induced Neurons via measuring ATF4 protein level or XBP-1 mRNA splicing

  • 1Harvard Medical School
  • Harper
  • ASAP
Icon indicating open access to content
QR code linking to this content
Protocol CitationMelissa Hoyer, Harper JW 2023. Testing ER stress induction in Cultured Induced Neurons via measuring ATF4 protein level or XBP-1 mRNA splicing. protocols.io https://dx.doi.org/10.17504/protocols.io.261ged94ov47/v1
Manuscript citation:
Melissa J. Hoyer, Cristina Capitanio, Ian R. Smith, Julia C. Paoli, Anna Bieber, Yizhi Jiang, Joao A. Paulo, Miguel A. Gonzalez-Lozano, Wolfgang Baumeister, Florian Wilfling, Brenda A. Schulman, J. Wade Harper (2024) Combinatorial selective ER-phagy remodels the ER during neurogenesis.Nature Cell Biology doi: 10.1038/s41556-024-01356-4
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 07, 2023
Last Modified: June 01, 2024
Protocol  Integer ID: 90506
Keywords: ASAPCRN, axonal er accumulation within synaptic er bouton, er stress induction in cultured induced neuron, axonal er accumulation, synaptic er bouton, er stress induction, extensive er remodeling during differentiation, deficient neuron, endoplasmic reticulum, er remodeling by autophagy, deficient neurons in vivo, er to degradative autophagy machinery, testing er stress induction, er remodeling during differentiation, cultured induced neuron, induction of er stress program, underlying er remodeling, induced neuron, phagy receptor fam134b, refined tubular er network, embedded receptor, neuron, er proteome, ineurons with different genotype, tractable induced neuron, monitoring extensive er remodeling, degradative autophagy machinery, selective er, vast proteomic landscape, atf4 protein induction, atf4 protein level, er stress program, autophagy, linking er, ineuron, receptor, protein, treated ineuron, measuring atf4 protein level, knockout ineuron, axon, er remodeling
Funders Acknowledgements:
ASAP
Grant ID: ASAP-000282
Abstract
The endoplasmic reticulum (ER) has a vast proteomic landscape to preform many diverse functions including protein and lipid synthesis, calcium ion flux, and inter-organelle communication. The ER proteome is remodeled in part through membrane-embedded receptors linking ER to degradative autophagy machinery (selective ER-phagy). A refined tubular ER network is formed in neurons within highly polarized dendrites and axons. Autophagy-deficient neurons in vivo display axonal ER accumulation within synaptic ER boutons, and the ER-phagy receptor FAM134B has been genetically linked with human sensory and autonomic neuropathy. However, mechanisms and receptor selectivity underlying ER remodeling by autophagy in neurons is limited. Here, we combine a genetically tractable induced neuron (iNeuron) system for monitoring extensive ER remodeling during differentiation. To test if any of our knockout iNeurons lead to induction of ER stress programs, we either left iNeurons with different genotypes untreated or treated them with tunicamycin as a positive control for ER stress induction. We then compared ATF4 protein induction and XBP-1 splicing levels in untreated versus tunicamycin treated iNeurons.
Materials
ABCD
REAGENT or RESOURCE SOURCE IDENTIFIER
Cell line
NGN2 inducible embryonic stem cells See protocol dx.doi.org/10.17504/protocols.io.br9em93e CVCL_9773 (modified from this source line)
Chemicals
Dulbecco’s MEM (DMEM), F12 Thermo Fisher Scientific 11330057
Phosphate Buffered Saline 1X Corning 21-031-CV
E8 components See protocol dx.doi.org/10.17504/protocols.io.bsacnaaw
ND1 and ND2 components See protocol dx.doi.org/10.17504/protocols.io.br9em93e
Tunicamycin Cell Signaling 12819S
RNAeasy Qiagen kit Qiagen 74104
Qiashredder columns Qiagen 79654
DNAseI Thermo Fisher Scientific EN0521
Superscript III reverse transcriptase master mix Invitrogen 18080-051
oligo dT20 primers Invitrogen 79654
dNTP solution mix NEB N0447L
Urea Sigma-Aldrich U5378
Sodium Chloride (NaCl) Sigma-Aldrich S9888
Protease Inhibitor Cocktail Roche 11873580001
PhosSTOP tablets Roche 4906845001
Pierce‱ BCA Protein Assay Kit Pierce 23227
4x Laemmli Sample Buffer Biorad 1610747
2-Mercaptoethanol Sigma-Aldrich M6250
CREB-2/ATF-4 Mouse Monoclonal Antibody (B-3) Santa Cruz SC-390063
Goat anti-Mouse IgG HRP conjugate BioRad 1706516
hFAB‱ Rhodamine Anti-Tubulin Antibody BioRad 12004166
Primers
GAPDH cDNA forward 5′GGATGATGTTCTGGAGAGCC3′,
GAPDH cDNA reverse 5′CATCACCATCTTCCAGGAGC3′
XBP1 cDNA forward 5′ CCTTGTAGTTGAGAACCAGG 3′,
XBP1 cDNA reverse 5′GGGGCTTGGTATATATGTGG 3′
Hardware
NanoDrop2000 Thermo Fisher Scientific
Sonicator
Thermal Cyler BioRad C1000
BioRad ChemiDoc imager BioRad
Software
Image Lab BioRad Software 6.1 BioRad RRID:SCR_014210
Genetically modify Ngn2-inducible embryonic stem (ES) cell H9 line using Cas9
Genetic editing of Ngn2-inducible ES cells is done using the following protocol “Electroporation of Cas9 protein into human pluripotent stem cells” (dx.doi.org/10.17504/protocols.io.br87m9zn)
Differentiate Stable Cell ES H9 line to induced neurons (iN)
Differentiation to induced neurons (iN) is done by following the protocol “Neural differentiation of AAVS1-TREG3-NGN2 pluripotent stem cells (dx.doi.org/10.17504/protocols.io.br9em93e)
iN Treatment
iN Treatment with or without tunicamycin
At day 12, iN with each genotype are left untreated or treated with tunicamycin (variable concentrations and times can be used but we found that optimal ER stress response was 1.0 microgram/ml) tunicamycin, 6h treatment).
After treatment, all iN are scrapped off the dishes, pelleted and washed three times with 1X Phosphate Buffered Saline (PBS)
Determine Number of cells. Pellet cells into two tubes-one for subsequent western blot analysis and the other for mRNA analysis (each pellet should have >1x106 cells)
Snap freeze pelleted cells in liquid nitrogen. Pellets can be stored at -80C for a few days before use.
ATF4 protein level detection
ATF4 protein level detection
Thaw cell pellets and resuspend them in Urea lysis buffer (8M Urea, 75mM NaCl, 150mM Tris pH 7.4, 1X protease inhibitors, 1X phosphatase inhibitors). Approximately 75 µL per sample. Sonicate pellets 2x for 5 sec each.
Clarify the lysate: Spin down 4C for 20,000xg 10min, keep supernatant
Measure protein concentration using a BCA assay (follow kit directions).
Create samples with equal concentrations of protein, add 4x Laemmli Sample Buffer and 2-Mercaptoethanol to 1X in each sample. Heat samples at 65C for 10min
With equal amounts of each sample perform a western blot and probe for ATF-4 (B-3) 1:1000 with Goat anti-Mouse IgG HRP conjugate 1:3000 and hFAB Rhodamine Anti-Tubulin 1:10,000. Image blot on BioRad ChemiDoc imager and quantify levels with Image Lab BioRad Software 6.1
XBP-1 splice isoform detection
XBP-1 splice isoform detection
Thaw cell pellets and resuspend them in freshly prepared RLT buffer (350 µL per sample for 1x106 cells cells) from the RNAeasy Qiagen kit

Add Dnase1 digestion buffer to cells and subsequently lyse via passage through a Qiashredder column
Add One volume of 70% ethanol to the lysate and transfer the lysate-EtOH solution to a RNAeasy spin column
Perform the following spins:
1) on column DNAseI (Thermo EN0521) digestion,
2) buffer washes, and
3) RNA elution via the RNAeasy Qiagen kit directions
Measure final extracted RNA concentration for each condition using a NanoDrop
Perform reverse transcription reactions for each condition (using the same amount of starting µg of RNA, 0.5 µg, in each reaction) with Superscript III reverse transcriptase master mix using oligo dT20 primers and dNTPs to create complementary DNA (cDNA). Incubate at 50 or 55˚C for 50 minutes, then quench the reaction by heating to 85˚C for 5 minutes. Freeze these samples as cDNA at -20 until ready to use.
With the cDNA, perform PCR reactions to amplify cDNA from GAPDH mRNA (forward 5′GGATGATGTTCTGGAGAGCC3′, reverse 5′CATCACCATCTTCCAGGAGC3′) ; or to amplify cDNA from unspliced or spliced XBP1 mRNA (forward 5′CCTTGTAGTTGAGAACCAGG 3′, reverse 5′GGGGCTTGGTATATATGTGG 3′) (as performed in van Schadewijk et al 2012, Yoshida et al 2001).
Perform gel electrophoresis on PCR products using a 2.5 percent agarose gel, run for 30min at 100V. Image gel on BioRad ChemiDoc imager and quantify levels with Image Lab BioRad Software 6.1 GAPDH levels should be even in all samples. The size difference between the spliced and the unspliced XBP1 is 26 nucleotides.
Protocol references
van Schadewijk, A., van’t Wout, E.F.A., Stolk, J. et al. A quantitative method for detection of spliced X-box binding protein-1 (XBP1) mRNA as a measure of endoplasmic reticulum (ER) stress. Cell Stress and Chaperones 17, 275–279 (2012). https://doi.org/10.1007/s12192-011-0306-2

Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 2001 Dec 28;107(7):881-91. https://doi.org/10.1016/s0092-8674(01)00611-0. PMID: 11779464.