Jan 12, 2026
Terminal PCR for Amplifying the 5' and 3' Termini of the Monkeypox Virus Genome
- Masayasu Misu1,
- Takeshi Kurosu1,
- Tomoki Yoshikawa1,
- Madoka Kawahara1,
- Kohei Oishi1,
- Masayuki Shimojima1,
- Hideki Ebihara1
- 1Department of Virology I, National Institute of Infectious Diseases
Protocol Citation: Masayasu Misu, Takeshi Kurosu, Tomoki Yoshikawa, Madoka Kawahara, Kohei Oishi, Masayuki Shimojima, Hideki Ebihara 2026. Terminal PCR for Amplifying the 5' and 3' Termini of the Monkeypox Virus Genome . protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqdqmxvk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 04, 2025
Last Modified: January 12, 2026
Protocol Integer ID: 119518
Keywords: termini of the monkeypox virus genome, monkeypox virus genome, terminal sequences of the monkeypox virus, monkeypox virus, viral dna, using standard nucleic acid purification method, standard nucleic acid purification method, read depth at the genome termini, genome termini, amplified dna, purified nucleic acid, generation sequencing, illumina dna prep, comprehensive genome coverage, viral suspension, ensuring comprehensive genome coverage, idt for illumina dna, nucleic acid, illumina dna, terminal pcr, using pcr, sequencing, micrococcal nuclease treatment, genome, rna, virus, oxford nanopore technology, pcr
Funders Acknowledgements:
Ministry of Health, Labor and Welfare of Japan
Grant ID: 20HA2005 and 23HA2004
Japan Agency for Medical Research and Development
Grant ID: 21fk0108426j0001, 25fk0108660h0003, 22fk0108502j0101 and 23fk0108581j0701
Japan Society for the Promotion of Science
Grant ID: JP22K085
Abstract
This protocol describes the amplification and purification of the 5' and 3' terminal sequences of the Monkeypox virus (MPXV) genome using PCR. The method is designed to compensate for the reduced read depth at the genome termini observed with the Nuclease-MDA method, ensuring comprehensive genome coverage.
Purified nucleic acids can be obtained either from viral DNA enriched via the Nuclease-MDA method or directly from viral suspensions extracted using standard nucleic acid purification methods, with or without micrococcal nuclease treatment.
This method was initially optimized for Oxford Nanopore Technologies (ONT) MinION sequencing. However, after completing Section 3, the amplified DNA can be used for Illumina Next-Generation Sequencing (NGS), following standard library preparation protocols.
This protocol can be applied using the ONT Native Barcoding Kit(SQK-NBD114.24, SQK-NBD114.96), Rapid Barcoding Kit V14 (SQK-RBK114.24 or SQK-RBK114.96) or Illumina DNA Prep, (M) Tagmentation (24 Samples, IPB) (Cat#20060060), IDT for Illumina DNA/RNA UD Indexes Set A (Cat#20027213), and the iSeq100 system.
Protocol materials
High Pure Viral Nucleic Acid KitRocheCatalog #11858874001
DNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Agencourt AMPure XPBeckman CoulterCatalog #A63880
NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S
Blunt/TA Ligase Master Mix - 50 rxnsNew England BiolabsCatalog #M0367S
Qubit dsDNA BR (Broad Range) assayThermo Fisher ScientificCatalog #Q32850
NEBNext Ultra II End Repair/dA-Tailing Module - 24 rxnsNew England BiolabsCatalog #E7546S
KOD One® PCR Master MixToyoboCatalog #KMM-101
The viral genomic DNA extraction
The viral genomic DNA extraction is performed using High Pure Viral Nucleic Acid KitRocheCatalog #11858874001 .
Add 200 µL of binding buffer, 4 µL PolyA carrier RNA and 50 µL Proteinase K.
Mix well by pipetting and inverting the tube thoroughly, and spin down.
72 °C 00:10:00
Add 100 µL of binding buffer and mix well by pipetting or inverting the tube thoroughly, and spin down.
Transfer the whole sample to a High Pure Filter Tube.
8000 x g, Room temperature, 00:01:00
Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
Add 500 µL of inhibitor removal buffer.
8000 x g, Room temperature, 00:01:00
Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
Add 450 µL of wash buffer.
8000 x g, Room temperature, 00:01:00
Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
Add 450 µL of wash buffer.
13000 x g, Room temperature, 00:01:00 and discard the flow-through liquid.
Discard the Collection Tube and insert the Filter Tube into a 1.5 ml tube -DNA LoBind Tube 1.5ml EppendorfCatalog #022431021 .
Add 50 µL elution Buffer.
13000 x g, Room temperature, 00:01:00
Note
The purified 50 µL viral genomic DNA can be stored at -80℃.
PCR reaction
The purified viral genomic DNA is amplified by PCR using the following primer set.
| Target | 5' Primer Name | 5' Primer sequence | 3' Primer name | 3' Primer seuence | Approx. product size (kb) | |
| 5’ terminal | MPXV term | GTGTGACCCACGACCGTAG | MPXV_5-inner | TCCATCTCCCTCTGGACCAC | 8 | |
| 3’ terminal | MPXV_3-inner | AATCGTTCTCCTCGGTGTCA | MPXV term | GTGTGACCCACGACCGTAG | 9 |
PCR reaction components are as follows:
For 5' terminal: total 30 µL reaction
- 15 µL KOD One® PCR Master MixToyoboCatalog #KMM-101
- 1.5 µL 5 micromolar (µM) MPXV term
- 1.5 µL 5 micromolar (µM) MPXV_5-inner
- 11 µL H2O
- 1 µL purified viral genomic DNA
For 3' terminal: total 30 µL reaction
- 15 µL KOD One® PCR Master MixToyoboCatalog #KMM-101
- 1.5 µL 5 micromolar (µM) MPXV term
- 1.5 µL 5 micromolar (µM) MPXV_3-inner
- 11 µL H2O
- 1 µL purified viral genomic DNA
PCR Conditions are as follows (same as 5' and 3' terminals):
| Step | Temperature (°C) | Time (sec) | Cycles | |
| Initial Denaturation | 98 | 15 | ||
| Denaturation | 98 | 10 | 5 | |
| Annealing | 65 (-1°C per cycle) | 5 | ||
| Extension | 68 | 90 | ||
| Denaturation | 98 | 10 | 35 | |
| Annealing | 60 | 5 | ||
| Extension | 68 | 90 |
Note
Expected PCR product sizes are ~8 kb for the 5' end and ~9 kb for the 3' end, which can be confirmed using gel electrophoresis or a Bioanalyzer.
DNA purification by AMpure XP
The DNA is purified using Agencourt AMPure XPBeckman CoulterCatalog #A63880
Add 15 µL (X0.5 volume) AMPure beads
Incubate00:05:00 Room temperature
Spin down and pellet on a magnet.
Wait for00:01:00 and pipette off the supernatant.
Wash twice by 100 µL 70 % ethanol, remove the ethanol using a pipette, and discard.
Spin down and pipette off any residual ethanol.
Resuspend pellet in40 µL nuclease-free H2O.
Incubate00:05:00 37 °C and tapping occasionally.
Spin down and pellet the beads on the magnet until the elute is clear and colorless.
Remove and retain40 µL elute into a new tube.
DNA concentration is measured using a Qubit 4 Fluorometer with Qubit dsDNA BR (Broad Range) assayThermo Fisher ScientificCatalog #Q32850 .
- 199 µL 1X working solution
- 1 µL DNA
Mix by vortexing.
Incubate 00:02:00 Room temperature and measure.
Note
At this step, whole-genome sequencing using the ONT Rapid Barcoding Kit V14 (SQK-RBK114.24 or SQK-RBK114.96) or Illumina's next-generation sequencer is also possible. In this case, the subsequent steps should follow the ONT Rapid Barcoding Kit or Illumina's library preparation protocol. We have confirmed that this protocol works using the Illumina DNA Prep, (M) Tagmentation (24 Samples, IPB) (Cat#20060060) and IDT for Illumina DNA/RNA UD Indexes Set A, Tagmentation (Cat#20027213).
DNA end-prep
10m
The purified DNA is end-prepped using
NEBNext Ultra II End Repair/dA-Tailing Module - 24 rxnsNew England BiolabsCatalog #E7546S
Note
The molar concentration of the DNA sample can be converted based on the amplicon length (9 kb).
Total 15 μl reaction
- 12.5 µL amplicon DNA (1100 ng for 9 kb amplicoms)
- 1.75 µL Ultra II end-prep reaction buffer
- 0.75 µL Ultra II end-prep reaction Mix
Mix by pipetting and spin down.
20 °C 00:05:00
65 °C 00:05:00
10m
The DNA is purified using Agencourt AMPure XPBeckman CoulterCatalog #A63880 .
Add 7.5 µL (X0.5 volume) AMPure beads
Resuspend pellet in 6 µL nuclease-free H2O.
Note
The DNA can be stored at 4℃ overnight.
Native barcode ligation
The end-prepped DNA is ligated with native barcode using Native Barcoding Kit V14 - Oxford Nanopore Technologies Catalog #SQK-NBD114.24 or#SQK-NBD114.24 with Blunt/TA Ligase Master Mix - 50 rxnsNew England BiolabsCatalog #M0367S .
Total 13 μl reaction
- 5 µL End-prepped DNA
- 1.5 µL native barcode
- 6.5 µL Blunt/TA ligase master mix
Mix by pipetting and spin down.
Room temperature 00:20:00
Add the following volume of EDTA to each well and mix thoroughly by pipetting and spin down briefly.
Note
Ensure you follow the instructions for the cap colour of your EDTA tube.
| EDTA cap colour | Volume per well | |
| For clear cap EDTA | 1.3 µl | |
| For blue cap EDTA | 2.6 µ |
EDTA is added at this step to stop the reaction.
Pool all the barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.
The DNA is purified using Agencourt AMPure XPBeckman CoulterCatalog #A63880
Add 5.7 or 6.5 µL (X0.4 volume) AMPure beads multiply by the original number of tubes.
Incubate on rotor mixer.
00:05:00 Room temperature
Spin down and pellet on a magnet.
Wait for00:01:00 and pipette off the supernatant.
Wash twice by 700 µL 70 % ethanol, remove the ethanol using a pipette, and discard.
Spin down and pipette off any residual ethanol.
Resuspend the pellet in 15 µL of nuclease-free H₂O when the number of pooled samples is fewer than 8.
If 8 or more samples are pooled, resuspend the pellet in 35 µL of nuclease-free H₂O.
Incubate on a rotor mixer.
00:10:00 37 °C
Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
Spin down and pellet the beads on the magnet until the elute is clear and colorless.
Remove and retain the elute into a new tube.
Adapter ligation and clean-up
Adaptor Ligation with pooled samples is performed using
Ligation Sequencing Kit - Oxford Nanopore Technologies Catalog #SQK-NBD114.24 or #SQK-NBD114.96 with NEBNext Quick Ligation Module - 20 rxnsNew England BiolabsCatalog #E6056S
Total 20 μl reaction
- 12 µL DNA
- 2 µL Native Adapter (NA)
- 4 µL NEB Next Quick Ligation Reaction Buffer(5X)
- 2 µL Quick T4 DNA ligase
Mix gently and incubate.
Room temperature 00:20:00
The adaptor-ligated DNA is purified using Agencourt AMPure XPBeckman CoulterCatalog #A63880 .
Prepare AMpure XP beads for use; resuspend by vortexing.
Transfer amplified DNA sample to 1.5ml low binding tube.
Add 10 µL (X0.5 volume) AMPure XP reagent and mix by pipetting.
Incubate 00:05:00 Room temperature
Spin down and pellet on a magnet. Wait for 00:01:00 and pipette off the supernatant.
- Wash twice by 100 µL Long Fragment Buffer (LFB) and remove the LFB using a pipette and discard.
Spin down and pipette off any residual LFB.
- Resuspend pellet in 15 µL Elution Buffer (EB)
00:05:00 37 °C and tapping occasionally.
Spin down and pellet the beads on the magnet until the elute is clear and colourless.
Remove retain 15 µL elute into a new tube.
DNA concentration is measured using a Qubit 4 Fluorometer with Qubit dsDNA BR (Broad Range) assayThermo Fisher ScientificCatalog #Q32850 .
- 199 µL 1X working solution
- 1 µL DNA
Mix by vortexing.
Incubate 00:02:00 Room temperature and measure.
Note
The molar concentration of the DNA sample can be converted based on the amplicon length (9 kb).
Make up the library to 12 µL at 10-20 fmol
Sequencing by MinION
Sequencing according to the manufacturer's instructions.