Nov 30, 2021
Targeted ExSeq -- In Situ Sequencing (Illumina Chemistry)
- Yi Cui1,
- Anubhav Sinha2,3,4,
- Ed Boyden5,2,6,7,8,9,4
- 1Massachusetts Institute of Technology;
- 2McGovern Institute, MIT;
- 3Harvard-MIT Program in Health Sciences and Technology;
- 4Human Tumor Atlas Pilot Project;
- 5Department of Media Arts and Sciences, MIT;
- 6Department of Biological Engineering, MIT;
- 7Koch Institute for Integrative Cancer Research, MIT;
- 8Howard Hughes Medical Institute;
- 9Department of Brain and Cognitive Sciences
- Ed Boyden: Corresponding author;
- NCIHTAN
External link: https://pubmed.ncbi.nlm.nih.gov/33509999/
Protocol Citation: Yi Cui, Anubhav Sinha, Ed Boyden 2021. Targeted ExSeq -- In Situ Sequencing (Illumina Chemistry) . protocols.io https://dx.doi.org/10.17504/protocols.io.bgs4jwgw
Manuscript citation:
Alon S*, Goodwin DR*, Sinha A*, Wassie AT*, Chen F*, Daugharthy ER**, Bando Y, Kajita A, Xue AG, Marrett K, Prior R, Cui Y, Payne AC, Yao CC, Suk HJ, Wang R, Yu CJ, Tillberg P, Reginato P, Pak N, Liu S, Punthambaker S, Iyer EPR, Kohman RE, Miller JA, Lein ES, Lako A, Cullen N, Rodig S, Helvie K, Abravanel DL, Wagle N, Johnson BE, Klughammer J, Slyper M, Waldman J, Jané-Valbuena J, Rozenblatt-Rosen O, Regev A; IMAXT Consortium, Church GM***+, Marblestone AH***, Boyden ES***+ (2021) Expansion Sequencing: Spatially Precise In Situ Transcriptomics in Intact Biological Systems, Science 371(6528):eaax2656. (* equal contribution, ** key contributions to early stages of project, *** equal contribution, +co-corresponding authors)
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: May 24, 2020
Last Modified: November 30, 2021
Protocol Integer ID: 37436
Keywords: expansion microscopy, in situ sequencing, expansion sequencing, targeted ExSeq, ExSeq, spatial transcriptomics, spatial omics, spatially resolved transcriptomics
Disclaimer
This protocol is shared under the HTAN Internal Data and Materials Sharing Agreement and is provided as is. See section 14 of full agreement for full details.
This protocol is shared as an Open Access protocol (under HTAN's definitions). This protocol is Subject to IP Restrictions.
Abstract
This protocol accompanies Expansion Sequencing (ExSeq), and describes the process of performing in situ sequencing with the Illumina chemistry.
The steps here are an extension of the protocol used in the original paper and are optimized for reading longer barcodes of up to seven bases. For shorter barcodes (less than four bases) in brain tissue, we recommend using the experimental protocol from the paper (with the imaging conditions as described in this protocol) as it is simpler and slightly faster.
There are two stages to this protocol: (1) sample preparation (steps 5-10), involving anchoring the sample to a glass-bottom plate and preparing the sample for sequencing; and (2) in situ sequencing using the Illumina sequencing-by-synthesis chemistry (steps 11-15). After in situ sequencing is complete, there is an optional antibody staining recovery step (step 16) if antibody staining was performed during tissue preparation.
The relationship between template bases and fluorophores is shown in Fig. 1A. Note that the added base (that bears the fluorophore) is the complementary base, i.e. the modified dCTP from the Illumina reagents bears the most redshifted dye. The specific length 7, Hamming distance 3 logical barcode library used in these protocols is shown in Fig. 1B, with the specific readout strategy for Illumina in situ sequencing shown in Fig. 1C.
The process of Illumina sequencing-by-synthesis in situ is shown in Fig. 1D. There are three key steps: an incorporation step, in which the next base of the barcode is synthesized; an imaging step, in which the sample is imaged on a spinning disk confocal microscope; and a cleavage step, in which the dye is cleaved, and the reversible terminator is unblocked, enabling the next round of synthesis to be performed.
This protocol was used to profile human metastatic breast cancer biopsies as a part of the Human Tumor Atlas Pilot Project.
Image Attribution
All images (c) Massachusetts Institute of Technology.
Guidelines
This protocol follows the Tissue Preparation and Library Preparation protocols; those guidelines also apply here.
Materials
Dideoxynucleoside Triphosphate SetMillipore SigmaCatalog #03732738001
MiSeq Reagent Kit v3 (or v2)illumina
200 Proof Ethanol pureSigma AldrichCatalog #E7023
UltraPure™ DNase/RNase-Free Distilled WaterThermofisherCatalog #10977023
Acetic acidMillipore SigmaCatalog #695092-100ML
Bind-silaneMillipore SigmaCatalog #GE17-1330-01
N,N,N′,N′-TetramethylethylenediamineSigmaCatalog #T7024
Ammonium persulfate (APS)Sigma AldrichCatalog #A3678
Acrylamide/Bis 19:1, 40% (w/v) solutionThermo FisherCatalog #AM9022
Tris BaseSigma AldrichCatalog #648310
TetraSpeck™ Microspheres, 0.2 µm, fluorescent blue/green/orange/dark redThermo FisherCatalog #T7280
PBS - Phosphate-Buffered Saline (10X) pH 7.4Thermo Fisher ScientificCatalog #AM9625
SSC (20X) RNase-freeThermo Fisher ScientificCatalog #AM9770
Terminal Transferase - 500 unitsNew England BiolabsCatalog #M0315S
Standard Taq (Mg-free) Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9015S
Zwittergent® 3-12 DetergentMillipore SigmaCatalog #693015-5GM
DAPIThermo Fisher ScientificCatalog #62248
Optional:
MES 0.5M buffer soln. pH 6.0Fisher ScientificCatalog #AAJ62574AE
Streptavidin, Alexa Fluor™ 488 conjugateThermo FisherCatalog #S11223
IMT (IMS), USM (SRE), CMS (CMS), and PR2 (PR2) are harvested from the MiSeq v3 (v2) kit.
Terminal Transferase from NEB includes Terminal Transferase Reaction Buffer Pack and CoCl2 solution.
The Taq (Mg-free) reaction buffer pack includes MgCl2.
Sequencing primer: TCTCGGGAACGCTGAAGACGGC from a DNA synthesis company at >=100 nmol synthesis scale, with HPLC purification.
Other materials:
- Basic lab wetware (pipettes, paintbrushes, lab tape, tweezers)
- Tupperware container (as in tissue preparation protocol)
- Blunt needles
- 24-well glass-bottom plate (may need larger 6-well glass-bottom plate depending on size of gel)
- 10 mm circular coverglasses (may need different size of coverglass depending on size of gel)
Equipment:
- 37 °C and 50 °C incubators
- Access to a spinning disk confocal microscope with 405, 488, 561, 647 and 685 nm laser lines. Alternatives are discussed in the protocol.
Safety warnings
Please carefully read all safety datasheets for all reagents used in the protocol, and perform all steps in accordance with relevant guidelines.
Before start
Before starting, prepare stock solutions/reagents as described in steps 1-4 of the protocol.
Preparation
Preparation
2h
2h
Preparation of Sample
This protocol assumes that samples have been prepared following the Targeted ExSeq Tissue Preparation protocol, and that a sequencing library has been prepared following the Targeted ExSeq Library Preparation protocol. The padlock probes to generate the library should have been prepared following the Targeted ExSeq Probe Generation protocol.
The protocol assumes that the library has been prepared, and if the amplicons were optionally checked, that the detection oligos have been stripped off as described in the Library Preparation protocol.
Pooling ddNTPs
The dideoxynucleotide set contains four tubes at 10 mM each for each of the dideoxynucleotides.
Combine 10 μL from each tube to form the final 2.5 mM each ddNTP pool.
5m
Preparing Sequencing Reagents from MiSeq Kit
The Illumina in situ sequencing kit reagents are collected from MiSeq reagent kits. Both MiSeq v3 and v2 reagent kits can be used for in situ sequencing. The terminology below is written for the MiSeq v3, with MiSeq v2 terms in parentheses.
Three reagents are collected:
- IMT: Incorporation Mix (v2: IMS, Incorporation Mix)
- USM: Scan Mix (v2: SRE, Scan Mix)
- CMS: Cleavage Mix (v2: CMS, Cleavage Mix)
Defrost a MiSeq v3 reagent kit (either Overnight at 4 °C or for 01:00:00 in a Room temperature water bath). Invert the kit to mix and ensure that the wells are fully melted.
Wipe a clean laboratory wipe over the foil cover of Wells 1, 2, and 4 of the MiSeq Reagent Kit.
Pierce the foil for Wells 1, 2, and 4 with a 1 mL pipette tip.
Use a transfer pipette to transfer reagents in Well 1 (IMT; v2 IMS), Well 2 (USM; v2 SRE), and Well 4 (CMS; v2 CMS) to individual 50 mL tubes.
Aliquot IMT (IMS), USM (SRE), and CMS (CMS) into 250-300 μL aliquots in microcentrifuge tubes, and store at -20 °C for up to one month.
In addition, also save the bottle of PR2 provided with the reagent kit.
1h
Gelling Materials from ExSeq Tissue Processing Protocol
The following reagents were prepared in the Targeted ExSeq Tissue Processing Protocol and are used again in this protocol.
- 10% TEMED
- 10% APS
Second Re-embedding Gel
Second Re-embedding Gel
5h
5h
Overview of Second Re-embedding
To minimize any movement during the multiple rounds of imaging during in situ sequencing, the sample gel is immobilized to a glass-bottom plate for all subsequent steps. This is accomplished by functionalizing wells of a glass-bottom plate with acryloyl groups (Step 6), and casting a second re-embedding gel to anchor the gel to the plate (Step 7).
Treatment of Glass-Bottom Plate with Bind-Silane
In this step, we treat wells of a 24-well glass-bottom plate with Bind-Silane, a silanization reagent that functionalizes the glass surface with acryloyl groups. The acryolyl groups are incorporated as monomers of the gel formed during the second re-embedding step.
Volumes can be scaled up as is appropriate for 6-well plates.
1h 30m
Cleaning Glass Surfaces
Wash wells briefly with ddH2O, followed by 100% ethanol.
5m
Bind-Silane Reaction
Prepare Bind-Silane reaction mix, scaling up/down total volume as needed.
| A | B | |
| Reagent | Volume | |
| Bind-Silane Reagent | 10 μL | |
| Ethanol | 4000 μL | |
| Glacial Acetic Acid | 100 μL | |
| Water | 890 μL | |
| Total | 5000 μL |
Bind-Silane reaction mix
Treat wells of glass-bottom plate for 00:45:00 at Room temperature .
Remove bind-silane reaction mix and allow well to dry.
Wash twice briefly with 100% ethanol, then remove ethanol and allow wells to dry completely before use.
Directly proceed to casting second re-embedding gel.
1h 15m
Casting Second Re-embedding Gel
This gelling step is similar to the first re-embedding step from the tissue preparation protocol, but does not have an extended pre-incubation step.
The purpose of the second re-embedding gel is to anchor the sample gel to the glass by incorporating the acryloyl groups on the glass surface into the second re-embedding polyacrylamide gel, which penetrates into the sample gel. The re-embedding gel also supports the sample gel around the sides.
In addition, fluorescent beads are added to the gelling solution to help with the color-correction step in the computational processing of ExSeq data.
3h
Preparation of Re-embedding Gelling Solution and Gelling Chamber
Prepare re-embedding gelling solution as follows. Add reagents in the following order: Water, Acrylamide/Bis, Tris Base, 10% TEMED, 10% APS, TetraSpeck beads. Mix by vortexing after adding each chemical reagent. Do not vortex after adding TetraSpeck beads -- mix by pipetting up and down.
| A | B | C | D | |
| Solution | Stock Concentration | Volume | Final Concentration | |
| Acrylamide/Bis 19:1 solution | 40% (w/v) | 100 μL | ~3.8% (w/v) acrylamide; 0.2% (w/v) N-N'-Methylenebisacrylamide | |
| Water | 875 μL | |||
| Tris Base | 1 M | 5 μL | 5 mM | |
| 10% TEMED | 10% (w/v) | 5 μL | 0.05% | |
| 10% APS | 10% (w/v) | 5 μL | 0.05% | |
| 0.2 μm TetraSpeck beads | 10 μL | |||
| Total | 1000 μL |
Re-embedding gelling solution
Pipette a droplet of the re-embedding solution to a well of a Bind-Silane treated plate.
Transfer the sample gel to the well with a paintbrush and place the gel on top of the droplet of re-embedding solution. Orient the sample so that the tissue is on the top of the sample (farthest from the glass)*
Pipette another droplet of the re-embedding solution on top of the sample.
Place a 10 mm circular coverglass on top with tweezers (or larger coverglass if the sample is larger).
Using a pipette, backfill the remaining volume under the coverglass and around the gel.
*The sample orientation can be checked before the second re-embedding by staining with DAPI, imaging the sample, taking note of the in-focus Z-position, then flipping the gel and noting the in-focus Z-position again. The orientation with the higher in-focus Z-position is the orientation to use when gelling.
10m
Nitrogen Purge and Second Re-embedding Gelation
Place 24-well plate into a humidified Tupperware container with two small holes in the lid and close the container.
Purge Tupperware container with nitrogen gas. To do this, start a slow flow of nitrogen gas into a nitrogen line connected to tubing with a blunt needle at the end. The flow rate should be barely perceivable when pointed at skin.
Insert the needle through one of the holes in the lid of the container. Ensure that the other hole is open, allowing for airflow out of the container. Ensure that the container does not immediately bulge or pop-open, which would be indicative of too high of a flow rate.
Purge for 00:10:00 .
After purging, withdraw the needle, and seal both holes by covering with tape.
Cast re-embedding by incubating for 01:30:00 at 37 °C .
1h 40m
Post-Gelation Wash
Remove coverglass with tweezers.
Wash sample with 1X PBS for 00:20:00 x 3 times at Room temperature .
--- Pause Point ---
The plate can be stored at 4 °C for up to two weeks.
1h
TdT treatment & Primer Hybridization
TdT treatment & Primer Hybridization
5h
5h
Overview of Sequencing Preparation
In this step, we prepare the glass-anchored sample for in situ sequencing with the Illumina chemistry. There are two primary steps here: (1) capping terminal 3' DNA ends of cellular DNA with dideoxy nucleotides; and (2) hybridization of the Illumina sequencing primer.
4h 30m
Dideoxy Capping of 3' DNA Strands
To minimize background from base addition to exposed 3' ends of cellular DNA during the Illumina incorporation, Terminal deoxynucleotidyl transferase (TdT) is used to add dideoxynucleotides to block further extension.
2h 30m
Pre-incorporation
Prepare TdT pre-incorporation mix and add to sample for 00:20:00 atRoom temperature .
| A | B | C | D | |
| Reagent | Stock Concentration | Volume | Final Concentration | |
| TdT buffer | 10X | 20 μL | 1X | |
| CoCl2 | 2.5 mM | 20 μL | 250 μM | |
| ddNTP | 2.5 mM each ddNTP | 4 μL | 50 μM each ddNTP | |
| ddH2O | 156 μL | |||
| Total | 200 μL |
TdT pre-incorporation mix
20m
TdT Capping
Prepare TdT reaction mix, add to sample, and incubate for 01:30:00 at 37 °C .
| A | B | C | D | |
| Reagent | Stock Concentration | Volume | Final Concentration | |
| TdT buffer | 10X | 20 μL | 1X | |
| CoCl2 | 2.5 mM | 20 μL | 250 μM | |
| ddNTP | 2.5 mM each ddNTP | 4 μL | 50 μM each ddNTP | |
| TdT enzyme | 20 U/μL | 4 μL | 0.4 U/μL | |
| ddH2O | 152 μL | |||
| Total | 200 μL |
TdT Reaction Mix
1h 30m
PBS Washes
Wash gels with 1X PBS for 00:10:00 x 3 times at Room temperature .
30m
Sequencing Primer Hybridization
In this step, the sequencing primer is hybridized to the amplicons. The sequence for the Illumina sequencing primer used for the padlock probes designed in the probe design protocol is TCT CGG GAA CGC TGA AGA CGG C, and should be ordered with HPLC purification (see materials).
2h
Sequencing Primer Hybridization
Prepare the sequencing primer hybridization mix by diluting the 100 μM sequencing primer stock by 1:40 in 4X SSC, forming a 2.5 μM sequencing primer mix.
Incubate gel with the sequencing primer hybridization mix in 4X SSC for 01:00:00 at 37 °C .
1h
SSC Washes
Wash gels with 4X SSC for 00:10:00 x 3 times at 37 °C .
30m
PR2 Washes
Wash gel with PR2 buffer for 00:10:00 x 3 times at Room temperature .
30m
In Situ Illumina Sequencing: Overview
In Situ Illumina Sequencing: Overview
5h
5h
Overview
The next three sections cover the process of in situ Illumina sequencing-by-synthesis.
The first step is elongation, the addition of a new base (Step 12). The second step is imaging (Step 13). The third step is cleavage (Step 14). These steps are repeated for each base of the barcode. For the barcode structure described by this protocol, a total of seven rounds of sequencing are required.
Illumina Sequencing: Elongation
Illumina Sequencing: Elongation
3h
3h
Overview
In this step, the next base of the barcode is synthesized. This base is complementary to the template base of the barcode in the amplicon.
1h 45m
Incorporation Mix Pre-incubation
Prepare ISS Incorporation Mix: 0.5X IMT and 2.5 mM MgCl2 in 1X Taq Reaction Buffer.
| A | B | C | D | |
| Reagent | Stock Concentration | Volume | Final Concentration | |
| IMT (from Illumina kit) | 1X | 500 μL | 0.5X | |
| MgCl2 | 25 mM | 100 μL | 2.5 mM | |
| Taq Reaction Buffer | 10X | 100 μL | 1X | |
| ddH2O | 300 μL | |||
| Total | 1000 μL |
ISS Incorporation Mix
Wash sample with ISS Incorporation Mix for 00:15:00 x 2 times at Room temperature .
30m
Incorporation
Treat sample with ISS Incorporation Mix for 00:10:00 at50 °C .
10m
Post-incorporation Washes
Wash with 2% Zwittergen (w/v) in PR2 for 00:15:00 x 2 times at50 °C .
If harsher washing is needed, add 0.1 M MES buffer, pH 6.
Then, wash with PR2 for 00:15:00 at 50 °C .
45m
DAPI Staining
Stain with DAPI (1 mg/L) in PR2 for 00:15:00 atRoom temperature .
15m
Illumina Sequencing: Imaging
Illumina Sequencing: Imaging
15m
15m
Overview
In this step, we transfer the sample to the Illumina imaging buffer and image the current round of the barcode.
Washing with Imaging Buffer
Wash samples with USM buffer (from Illumina kit) for 00:15:00 x 2 times at Room temperature .
The sample is now ready for imaging. Keep the sample in USM buffer.
30m
Overview of Imaging
The specifics of imaging vary significantly from microscope to microscope.
In general, users will be performing tiled array imaging, where each tile is a multicolor Z-section.
We recommend a 2% overlap between tiles to minimize photobleaching of amplicons at the edges of tiles. We recommend a spacing of 0.4 μm between adjacent Z-sections, and we recommend setting up the image acquisition to image all Z-places for a color channel before moving on to the next color channels. Imaging should be performed from longest to shortest excitation wavelength. Take care when setting up the image acquisition to ensure that the sample will be fully covered in Z across the entire XY region, since a small sample tilt can result in a significant fraction of the sample being out of the imaged volume.
This protocol is optimized for imaging on a Dragonfly spinning disk confocal microscope, using a Nikon 40X water immersion, long working distance, NA 1.15 objective (MRD77410). The key elements are shown in the following table. All lasers are set to 100% output power.
| A | B | C | D | E | |
| Channel Description | Excitation (nm) | Excitation Laser Power (mW) | Emission Range (nm) | Exposure time (ms) | |
| Template Base G | 685 | 30 | 705-845 | 400 | |
| Template Base T | 640 | 160 | 663-737 | 200 | |
| Template Base A | 561 | 150 | 575-590 | 200 | |
| Template Base C | 488 | 150 | 500-550 | 400 | |
| DAPI | 405 | 100 | 440-460 | 300 |
Summary of imaging parameters.
If a 685 laser is not available, the 640 laser can be used to excite template base G (added base C), and the signal can be separated from Template Base T (added base A) using a 775/140 emission filter (or similar). This will have slightly lower signal to background.
Illumina Sequencing: Cleavage
Illumina Sequencing: Cleavage
1h
1h
Overview
In this step, the Illumina reversible terminator is unblocked, allowing for synthesis of the next base. The fluorophore added with the last base is also cleaved off the sequencing product.
1h 40m
Post-Imaging Washes
Wash with PR2 buffer for 00:10:00 x 2 times at Room temperature .
20m
Pre-incubation with Cleavage Buffer
Wash with CMS (cleavage buffer from Illumina Kit) for 00:10:00 x 2 times at Room temperature .
20m
Cleavage
Treat sample with CMS (cleavage buffer from Illumina Kit) for 00:20:00 at 50 °C .
20m
Post-Cleavage Washes
Wash with PR2 buffer for 00:10:00 x 2 times at 50 °C .
Then, wash with PR2 buffer for 00:10:00 x 2 times at Room temperature .
40m
Iteration
If more bases need to be sequenced, go to step #12 .
[OPTIONAL] Antibody Signal Recovery and Imaging
[OPTIONAL] Antibody Signal Recovery and Imaging
1h
1h
Recovery of Antibody Staining
If antibody staining with a biotinylated secondary antibody was previously performed in the tissue processing step, this section recovers and images that signal.
For imaging the antibody staining: if sub-voxel resolution registration to the in situ sequencing data will be performed, skip the final cleavage step after the last base of sequencing and image the antibody staining signal with the last base of sequencing. The puncta signal can be used in the computational processing to co-register this dataset.
If another feature (i.e. DAPI) will be used to coregister the antibody staining, the cleavage can be performed before antibody staining signal recovery.
1d
[Only if Final Cleavage is Skipped] PR2 Wash
Wash the samples with PR2 buffer for 00:30:00 at Room temperature .
30m
Stain with Fluorophore-Labeled Streptavidin
Incubate the samples with 10 μg/mL fluorophore-labeled Streptavidin (i.e. Streptavidin-Alexa 488) in PR2 for Overnight at 4 °C .
The next day, wash samples with PR2 for 00:30:00 x 3 times at Room temperature .
1d
DAPI Staining
Stain with DAPI (1 mg/L) in PR2 for 00:15:00 atRoom temperature .
15m
Washing with Imaging Buffer
Wash samples with USM buffer (from Illumina kit) for 00:15:00 x 2 times at Room temperature .
Add USM buffer to the sample again.
15m
Imaging
The precise imaging parameters depend on the specifics, but the imaging protocol for sequencing may serve as a template.