May 06, 2026
TaqMan SNP Genotyping for VAPB variants p.P56S and p.T46I.
This protocol is a draft, published without a DOI.
- Pedro L. de Paiva1,
- Stela S. N. L. de Carvalho 1,
- Angela A. S. Reis1,
- Rodrigo S. Santos1
- 1Center for Neurogenetics Research. Department of Biochemistry and Molecular Biology, Institute of Biological Sciences (ICB II), Federal University of Goiás (UFG), Goiânia, Goiás, Brazil.
Protocol Citation: Pedro L. de Paiva, Stela S. N. L. de Carvalho , Angela A. S. Reis, Rodrigo S. Santos 2026. TaqMan SNP Genotyping for VAPB variants p.P56S and p.T46I.. protocols.io https://dx.doi.org/
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 06, 2026
Last Modified: May 06, 2026
Protocol Integer ID: 316450
Keywords: Amyotrophic Lateral Sclerosis, SNP, SNV, Genotyping Techniques, Genetic Polymorphism, taqman snp, quantitative pcr, single nucleotide variation, qpcr, VAPB, p.P56S, p.T46I, c.C166T, c.C137T, ALS, vapb gene, taqman snp genotyping, taqman snp genotyping assay, using taqman snp genotyping assay, vapb snv, familial amyotrophic lateral sclerosis, genetic marker, genotyping of rs74315431, associated membrane protein, vapb, single nucleotide variation, endoplasmatic reticulum, prognosis in al, membrane protein, note endosomal trafficking, endosomal trafficking, snv, genotyping
Funders Acknowledgements:
Sen. Vanderlan Vieira Cardoso
Grant ID: Parliamentary fund #202440830009
Abstract
The vesicle-associated membrane protein-associated protein B (VAPB) is mainly found in the endoplasmatic reticulum. A large number of functions can be attributed to VAPA or VAPB, of note endosomal trafficking of
calcium and lipids. In the Brazilian population, a single nucleotide variation (SNV) in the VAPB gene, rs74315431 (c.C166T, p.P56S), was found as a causal factor for an atypical form of Familial Amyotrophic Lateral Sclerosis (FALS), known as ALS-8. Another VAPB SNV has been recently associated with FALS, rs281875284 (c.C137T, p.T46I). Since genetic markers are usuful for patient stratification and prognosis in ALS, this protocol aims to standardize the genotyping of rs74315431 and rs281875284 using TaqMan SNP Genotyping Assay.
Materials
Standard personal protective equipment.
Whole blood samples with ethylenediaminetetraacetic acid (EDTA).
Adjustable volume pipettes (200-1000 µL, 20-200 µL, 1-10 µL).
DNA-se free pipette tips (200-1000 µL, 20-200 µL, 1-10 µL).
DNAse-free Cryotubes.
Microcentrifuge.
2 - 8 °C refrigeration unit.
-20 °C refrigeration unit.
PureLink® Genomic DNA Kit (ref. K-1820-02).
Nanodrop® (Thermo Fisher Scientific).
Pre-designed probes TaqMan™ SNP Genotyping Assays® (catalog # 4351379).
Ultrapure or MiliQ water.
2X Master Mix (Thermo Fisher Scientific).
96-well plates (Thermo Fisher Scientific).
MicroAmp Optical Caps for 96-well plates (Thermo Fisher Scientific).
Thermocycler (QuantStudio 6 Pro, Thermo Fisher Scientific).
Before start
Be sure to wear a coat, mask and gloves. Ensure your working station and laminar flow hood are properly clean and decontaminated. Be mindful that TaqMan probes are light sensitive. Avoid unnecessary freeze-thaw cycles.
Materials and Methods
Genomic DNA extraction was performed on whole blood samples with ethylenediaminetetraacetic acid (EDTA). Samples were stored in cryotubes at -20 °C until processing. The genomic DNA was extracted and purified using a silica-based selective DNA-binding method in the presence of chaotropic salts (PureLink® Genomic DNA Kits (ref. K-1820-02)). Manufacturer’s instructions were followed thoroughly for this procedure.
DNA concentration was determined by spectrophotometry using Nanodrop® (Thermo Fisher Scientific). Determining DNA concentration is important for standardizing DNA concentration in each reaction well, ensuring clustering of similar genotypes during the analysis. The standard DNA concentration for this experiment is 10 ng/µL. Extracted samples whose DNA concentration exceeds this threshold were aliquoted and diluted with DNA-free ultrapure water.
Pre-designed probes TaqMan™ SNP Genotyping Assays® (catalog # 4351379) were bought directly from the manufacturer (Applied Biosystems™). See Table 1.
| A | B | C | D | |
| Table 1: Context sequence and Assay ID for VAPB variants rs74315431 and rs281875284. | ||||
| Gene | Variant | Context Sequence (VIC/FAM) | Assay ID | |
| VAPB | rs7431543 | AGCACCACGTAGGTACTGTGTGAGG[C/T] CCAACAGCGGAATCATCGATGCAGG | C_153463889_10 | |
| rs281875284 | CGAAATGTGTGTTTTAAGGTGAAGA[C/T] TACAGCACC ACGTAGGTACTGTGTG | C_348024809_10 | ||
The TaqMan® 2X Genotyping Master Mix solution is ready to use. Its composition includes ultrapure DNA polymerase, deoxyribonucleotide triphosphates (dNTPs), ROX dye (passive reference), and buffer.
The Predesigned TaqMan® SNP Genotyping Assay is 80X or 40X concentrated and must be diluted using ultrapure DNA-free water to 20X Assay Working Stock before use. Ideally, this working solution is aliquoted to prevent early degradation due to freeze-thaw cycles.
The Reaction Mix solution is composed of the TaqMan® Genotyping Master Mix, 20X Assay Working Stock and ultrapure water. The proportions of each reagent can be seen in Table 2. This Reaction Mix was prepared for 106 reactions, which includes a 10% safety margin recommended by the manufacturer (96 reactions + 10% margin). A volume of 9 µL of the reagent mixture and 1 µL of genomic DNA diluted to 10 ng/µL was dispensed into each well of the reaction plate, totaling 10 µL to fill each of the 96 wells of the optical plate.
| A | B | C | |
| Table 2: Reaction protocol for rs74315431 and rs281875284. Final volume 10 µL. | |||
| Component | Volume for one reaction (µL) | Volume for 106* reactions (µL) | |
| 2X Master Mix | 5.0 | 530 | |
| 20X Assay Working Stock | 0.5 | 53 | |
| Ultrapure or MiliQ water | 3.5 | 371 | |
| DNA sample/control (10 ng/µL) | 1.0 | - | |
* 106 reactions include a 10% margin for a full 96-well plate.
Each plate was used to genotype 93 samples, along with two positive controls, one heterozygous (C/T) and one wild (C/C), and one no-template control (NTC). The Working Mix was prepared and distributed in each reaction well inside a laminar flow hood. Prediluted samples were then pipetted into their respective reaction well. After distributing the samples to all wells, the plate was coated with MicroAmp Optical Caps for 96-well plates.
The cycling protocol followed the standard conditions provided by the manufacturer of the TaqMan® hydrolysis probes, as detailed in Table 3. We used QuantStudio Design and Analysis Software 2.6.0 to setup the run. See Figure 2 for details on the setup using a QuantStudio 6 Pro.
| A | B | C | D | |
| Table 3: Cycling protocol for rs74315431 and rs281875284 TaqMan Genotyping Assay in QuantStudio 6 Pro. | ||||
| Stage | Temperature (ºC) | Duration | Cycles | |
| Pre-read | 60 | 30 seconds (data collection on) | 1 | |
| Enzyme activation | 95 | 10 minutes | 1 | |
| Denaturation | 95 | 15 seconds | 40 | |
| Anneal / Extend | 60 | 60 seconds (data collection on) | ||
| Post-read | 60 | 30 seconds | 1 | |
Figure 2: Standard run for rs113247976 genotyping using QuantStudio Design and Analysis Software 2.6.0. It is important to check for the correct selection of the instrument, block size, run mode, analysis module and reaction volume before programming the steps.
Interpretation of results
Genotyping results were analyzed using QuantStudio Design and Analysis Software. The software can display the results in scatter plots, which show genotype clusters, each occupying a specific position and represented by a unique color. Red indicates samples with the wild-type genotype, C/C, at the lower right quadrant of the plot. Green represents heterozygous samples, C/T, positioned in the upper central region. Blue corresponds to mutant genotypes, T/T, which should appear in the upper left quadrant. Unknown samples are represented as circles, while control samples are denoted by squares as long as they are marked as controls during plate setup in the software. Orange plots indicate samples that failed to amplify, which is expected only for NTC. This visualization method enhances the interpretation of genotyping results and facilitates the assessment of data quality recorded by the software. The expected allelic clustering is presented in Figure 3.
Figure 3: Expected allelic discrimination clustering when genotyping using TaqMan® probes.
We hereby present our results when applying this technique in samples from our studied population (see Figure 4 and Figure 5). We used a QuantStudio 6 Pro for these experiments.
Figure 4: Allelic discrimination plot for variant rs74315431 using samples from our study population. One carrier of the variant allele T was detected in one of the experiments (C), while the other experiments showed only C/C genotypes. No homozygous carriers of the mutant allele were found.
Figure 4: Allelic discrimination plot for variant rs281875284 using samples from our study population. No carriers of the mutant allele T were found.
Protocol references
1. Thermo Fisher Scientific. (2024). NanoDrop One User Guide. ThermoFisherScientific. Revision Edition I, March 2023. Wilmington: USA. https://assets.thermofisher.com/TFS-Assets/MSD/manuals/nanodrop-one-c-user-guide-EN_20211102.pdf
2. Thermo Fisher Scientific. (2017). TaqMan® SNP Genotyping Assays. User Guide. Publication Number MAN0009593. Revision B.0, Life Technologies Corporation. Carlsbad, CA 92008 USA, 2017. https://assets.thermofisher.com/TFSAssets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf
3. Thermo Fisher Scientific (2025). QuantStudio 6 and 7 Pro Real-Time PCR Systems. https://www.thermofisher.com/br/en/home/life-science/pcr/real-time-pcr-instruments/quantstudio-systems/models/quantstudio-6-7-pro.html
4. NCBI (2024) rs281875284 RefSNP Report - dbSNP. https://www.ncbi.nlm.nih.gov/snp/rs281875284
5. NCBI (2024) rs74315431 RefSNP Report - dbSNP. https://www.ncbi.nlm.nih.gov/snp/rs74315431
6. Nishimura AL, Mitne-Neto M, Silva HCA, et al (2004) A Mutation in the Vesicle-Trafficking Protein VAPB Causes Late-Onset Spinal Muscular Atrophy and Amyotrophic Lateral Sclerosis. Am J Hum Genet 75:822. https://doi.org/10.1086/425287
7. Chen HJ, Anagnostou G, Chai A, et al (2010) Characterization of the properties of a novel mutation in VAPB in familial amyotrophic lateral sclerosis. Journal of Biological Chemistry 285:40266–40281. https://doi.org/10.1074/jbc.M110.161398