Jan 20, 2022

Public workspaceStep by step guide to tag endogenous genes with split-wrmScarlet and/or split-sfGFP in C. elegans V.2

DOI
dx.doi.org/10.17504/protocols.io.b34vqqw6
  • 1Calico Life Sciences
Jerome F Goudeau
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.b34vqqw6
Protocol Citation: Jerome F Goudeau, Cynthia Kenyon, Maria Ingaramo 2022. Step by step guide to tag endogenous genes with split-wrmScarlet and/or split-sfGFP in C. elegans. protocols.io https://dx.doi.org/10.17504/protocols.io.b34vqqw6Version created by Jerome F Goudeau
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: January 20, 2022
Last Modified: January 20, 2022
Protocol Integer ID: 57205
Keywords: split-sfGFP, split GFP, split-wrmScarlet, split wrmScarlet, CRISPR, Cas9, C. elegans, fluorescent tag,
Abstract
Here is a step by step protocol describing our strategy to label endogenous proteins with split-sfGFP and/or split-wrmScarlet in C. elegans. See our manuscript "Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans " for more details.
Guidelines
Here is a step by step protocol describing our strategy to label endogenous proteins with split-sfGFP and/or split-wrmScarlet in C. elegans. See our manuscript "Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans " for more details.
Materials
Microinjection practices and equipment, see wormbook chapter:
http://www.wormbook.org/chapters/www_transformationmicroinjection/transformationmicroinjection.html

Evans, T. C., ed. Transformation and microinjection (April 6, 2006), WormBook, ed. The C. elegans Research Community, WormBook. doi/10.1895/wormbook.1.108.1, http://www.wormbook.org.


Before start
If you are not already, get familiar with CRISPR/Cas genome editing, and general guidelines.

Kohler S, Dernburg A. (2016) C. elegans injection: Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System. [Online] Coralville, Integrated DNA Technologies. [December, 2017.]
CITATION
Farboud B, Severson AF, Meyer BJ (2019). Strategies for Efficient Genome Editing Using CRISPR-Cas9.. Genetics.
LINK
https://doi.org/10.1534/genetics.118.301775

CITATION
Alexandre Paix, Andrew Folkmann, Dominique Rasoloson and Geraldine Seydoux. Direct delivery CRISPR-HDR editing protocol for C. elegans.
LINK
dx.doi.org/10.17504/protocols.io.dri54d

CITATION
Paix A, Folkmann A, Rasoloson D, Seydoux G (2015). High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes.. Genetics.
LINK
https://doi.org/10.1534/genetics.115.179382




Select a C. elegans strain expressing the split-fluorescent protein1-10 of your choice
Select a C. elegans strain expressing the split-fluorescent protein1-10 of your choice
Select a C. elegans strain expressing wrmScarlet1-10 and/or sfGFP1-10 in your tissue of interest

Somatic split-sfGFP1-10:
CF4587 muIs253[(Peft-3::sfGFP1-10::unc-54 3'UTR, Cbr-unc-119(+)] II; unc-119(ed3) III

Somatic split-wrmScarlet1-10:
CF4582 muIs252[Peft-3::wrmScarlet1-10::unc-54 3'UTR, Cbr-unc-119(+)] II; unc-119(ed3) III

Dual Somatic split-sfGFP1-10 and split-wrmScarlet1-10:
CF4588 muIs253[Peft-3::sfGFP1-10::unc-54 3'UTR, Cbr-unc-119(+)], muIs252[Peft-3::wrmScarlet1-10::unc-54 3'UTR, Cbr-unc-119(+)] II; unc-119(ed3) III

Muscle-specific split-wrmScarlet1-10:
CF4610 muIs257[Pmyo-3::wrmScarlet1-10::unc-54 3'UTR] I
Select a guide sequence and order a crRNA and tracrRNA
Select a guide sequence and order a crRNA and tracrRNA
Download the DNA sequence of your gene and transcript of interest from Wormbase.
Identify the desired insertion or knock-in site in the genomic DNA.
Using ~50 nucleotides flanking Identify DNA sequence(s) followed by a PAM site (5' NGG 3') in your target gene using a CRISPR/Cas9 target online predictor, such as CCTop.

When using CCTop, use the default parameters and adjust the following two criteria:
PAM type: NGG (Streptococcus pyogenes)
Species: C. elegans

Insert the DNA sequence in the query section, then submit.
Select the crRNA target site with a high score, the closest to your editing site, with no off- targets.
Order the crRNA corresponding to your selected guide sequence from IDT.
Note: Do not include the PAM in the query
Typically, we order 10 nmol of each Alt-R® CRISPR-Cas9 crRNA that we ressuspend in 14.5 μL TE.
Order the universal 67 mer tracrRNA from IDT under the section "CRISPR-Cas9 tracrRNA".
https://www.idtdna.com/pages/products/crispr-genome-editing/alt-r-crispr-cas9-system
Typically, we order 20 nmol.
Design and order a single-stranded donor oligonucleotides (ssODN) of 200 mers
Design and order a single-stranded donor oligonucleotides (ssODN) of 200 mers
Design the sequence of a single-stranded donor oligonucleotides (ssODN) with the Fluorescent Protein11 of choice, (ie. wrmScarlet11 or sfGFP11), a linker and homology arms.

Sequences:
wrmScarlet11:
5' TACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGA 3'

sfGFP11:
5' CGTGACCACATGGTCCTTCATGAGTATGTAAATGCTGCTGGGATTACA 3'

Linker:
5' GGAGGAGGATCC 3'

Note
The linker should be inserted at the 5' end or 3' end of the FP11 depending on the site chosen to insert it in your gene of interest, for example:

- When tagging the N-terminal of your gene of interest, the final ssODN sequence should look like this:
Left homology arm :: endogenous START codon (ATG) :: Fluorescent Protein11 :: Linker :: Right homology arm

- When tagging the C-terminal of a gene of interest, the final ssODN sequence should look like this:
Left homology arm :: Linker:: Fluorescent Protein11 :: endogenous STOP codon :: Right homology arm

Note:
If C-terminus tagging is required, we suggest the alternative wrmScarlet11(MDELYK) sequence:

Protein sequence: YTVVEQYEKSVARHCTGGMDELYK

Nucleotide sequence:
5' TACACCGTCGTCGAGCAATACGAGAAGTCCGTCGCCCGTCACTGCACCGGAGGAATGGATGAGTTATACAAG 3'


Note
Ensure that the linker and the Fluorescent Protein11 sequences are in frame with the coding sequence of your gene of interest

Note
Linker length and flexibility may need to be optimized depending on the protein structure and function

Note
The final ssODN can be up to 200 mers, allowing each homology arms to be 67 nucleotides when tagging a gene with wrmScarlet11 and the suggested linker

Order the ssODN from IDT in the section "Ultramer DNA Oligos".
We typically order up to 4 nmol at 100 μM in IDTE buffer

Design oligos to amplify the insertion site
Design oligos to amplify the insertion site
Design and order oligos that will be used to perform the genotyping and sequencing of the insertion site.
Note
• 18-24 bases in length
• Melting temperature (Tm) between 50 and 60ºC
• GC content ranging from 45 to 55%
• G or C on the 3’ end
• Design primers 200 nt upstream and downstream from the sequence of interest

Prepare and inject CRISPR/Cas9 ribonucleoprotein mix
Prepare and inject CRISPR/Cas9 ribonucleoprotein mix
Assemble CRISPR/Cas9 ribonucleoproteins complex and ssODN into injection mix:

AB
Nuclease-free Water (Final volume = 10 μL)5.25 μL
HEPES pH 7.5 (117 mM) + KCl (1.53M)0.75 μL
tracrRNA (8 μg/μL)1 μL
crRNA designed at step #4 (8 μg/μL)1 μL
ssODN (100 μM) (designed at step #6)0.5 μL
Purified Cas9 Nuclease (10 μg/μL)1.5 μL
Protocol without co-CRISPR

Alternatively:
AB
Nuclease-free Water (Final volume = 10 μL)3.75 μL
HEPES pH 7.5 (117 mM) + KCl (1.53M)0.75 μL
tracrRNA (8 μg/μL)1.5 μL
crRNA designed at step #4 (8 μg/μL)1 μL
crRNA dpy-10 (8 μg/μL)0.5 μL
ssODN with FP11 - designed at step #6 - (100 μM)0.5 μL
ssODN dpy-10(cn64) (100 μM)0.5 μL
Purified Cas9 Nuclease (10 μg/μL)1.5 μL
Protocol with co-CRISPR dpy-10(cn64)

Pipet up and down a few times without introducting air in the mix.
Incubate Temperature37 °C 15 min
Quick spin Centrifigation13000 rpm
Load 0.5 to 1 μL of the mix in injection needles and inject 10 to 20 day-1 adult worms successfully, ideally in both gonad arms.

Single injected worms in a drop of M9 buffer on NGM plates seeded with OP50, and place them in a Temperature25 °C incubator DurationOvernight .
Step F - Screen for successful FP11 integrants
Step F - Screen for successful FP11 integrants
Starting 3 days post injections, screen daily until identifying fluorescent progeny in the F1 and/or F2 of singled injected worms.
Perform PCR genotyping and sequencing using regular worm protocols with the primers designed in step C.
Citations
Farboud B, Severson AF, Meyer BJ. Strategies for Efficient Genome Editing Using CRISPR-Cas9.
https://doi.org/10.1534/genetics.118.301775
Alexandre Paix, Andrew Folkmann, Dominique Rasoloson and Geraldine Seydoux. Direct delivery CRISPR-HDR editing protocol for C. elegans
dx.doi.org/10.17504/protocols.io.dri54d
Paix A, Folkmann A, Rasoloson D, Seydoux G. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes.
https://doi.org/10.1534/genetics.115.179382