Mar 27, 2023

Standard-S: PCR barcoding of SARS-CoV-2 S gen amplicons for Nanopore sequencing

  • 1Laboratorio de Genómica Microbiana. Institut Pasteur de Montevideo. Uruguay and Centro de Innovación y Vigilancia Epidemiológica (CIVE). Institut Pasteur de Montevideo. Uruguay.
Icon indicating open access to content
QR code linking to this content
Protocol CitationCecilia Salazar 2023. Standard-S: PCR barcoding of SARS-CoV-2 S gen amplicons for Nanopore sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg3pe9pl25/v1
Manuscript citation:
Salazar C, Ferrés I, Paz M, Costábile A, Moratorio G, Moreno P, Iraola G, Fast and cost-effective SARS-CoV-2 variant detection using Oxford Nanopore full-length spike gene sequencing. Microbial Genomics 9(5). doi: 10.1099/mgen.0.001013
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 25, 2021
Last Modified: March 27, 2023
Protocol Integer ID: 55420
Keywords: sequencing amplicon, pcr barcoding of sar, sequencing plataform, mutational surveillance of the spike gene, pcr barcoding, clade assignment, nanopore protocol, reported primer sequence, positive samples for lineage, based lineage assignment, mutational surveillance, spike gene, nanopore, lineage assignment, most of the defining mutation, primer sequence, mutation
Funders Acknowledgements:
FOCEM (MERCOSUR Structural Convergence Fund)
Grant ID: COF03/11
Fondo de Solidaridad para Proyectos Innovadores, Sociedad Civil, Francofonía y Desarrollo Humano (FSPI), Ambassade de France.
Abstract
Most of the defining mutations of the severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) variants of concern (VOCs) have been identified in the S gene sequence. For this reason, S-based lineage assignment is possible using the current nomenclature system. We have developed a protocol for overlapping amplification of the S gene sequence using previously reported primer sequences (V3 primers of ARTIC Network) in combination with a PCR barcoding approach of the samples for Nanopore sequencing plataforms. This protocol allows the screening of multiple COVID-19 positive samples for lineage/clade assignment and mutational surveillance of the spike gene. Additionally, this protocol can be is easily adapted for dual barcoding using the "Ligation sequencing amplicons - dual barcoding (SQK-LSK109 with EXP-NBD104, EXP-NBD114, and EXP-PBC096)" Nanopore protocol to upscale the number of samples per run.


Materials
Reagents:

  • LunaScript® RT SuperMix
  • Nuclease free water
  • Absolute ethanol
  • Q5® Hot Start High-Fidelity 2X Master Mix
  • PCR Barcoding Expansion Pack 1-96 (EXP-PBC096)
  • Ligation Sequencing Kit (SQK-LSK109)
  • Agencourt AMPure XP beads (Beckman Coulter™, A63881)
  • NEBNext FFPE Repair Mix (M6630)
  • NEBNext Ultra II End repair/dA-tailing Module (E7546)
  • NEBNext Quick Ligation Module (E6056)
  • Sequencing Auxiliary Vials (EXP-AUX002).
  • Flow Cell Priming Kit (EXP-FLP002)
  • Qubit™ 1X dsDNA High Sensitivity (HS) and Broad Range (BR) Assay (Q33266)

Plastics:

  • 0.2 ml thin-walled PCR tubes, PCR strips with caps, PCR plate
  • 1.5 ml Eppendorf DNA LoBind tubes
  • Filter tips P2, P10, P20, P100, P200, P1000
  • Qubit™ Assay Tubes (Q32856)

Equipment:

  • Pipettes and pipette tips P2, P10, P20, P100, P200, P1000
  • Thermal cycler
  • Magnetic separator, suitable for 0.2 ml tubes and 1.5 ml tubes.
  • Microfuge
  • Vortex mixer
  • Ice bucket with ice
  • PCR cooler
  • Qubit fluorometer


Primers sequences

This primers used in this protocol are from the V3 scheme of the ARTIC primers for whole genome sequences. This primers span the S gene region of the SARS-CoV-2 genome and have the ONT tag at the 5' end for compatibility with the PCR Barcoding Expansion Pack 1-96 (EXP-PBC096).
NameSecuencia 5'-3'ARTIC Network V3 primers
ONT_Sseq_1_LEFT TTTCTGTTGGTGCTGATATTGC ACAAAAGAAAATGACTCTAAAGAGGGTTTnCoV-2019_70_LEFT
ONT_Sseq_1_RIGHT ACTTGCCTGTCGCTCTATCTTC ACTCTGAACTCACTTTCCATCCAACnCoV-2019_72_RIGHT
ONT_Sseq_3_LEFT TTTCTGTTGGTGCTGATATTGC AGAGTCCAACCAACAGAATCTATTGTnCoV-2019_75_LEFT
ONT_Sseq_3_RIGHT ACTTGCCTGTCGCTCTATCTTC ACCTGTGCCTGTTAAACCATTGAnCoV-2019_76_RIGHT_alt0
ONT_Sseq_5_LEFTTTTCTGTTGGTGCTGATATTGC CAACTTACTCCTACTTGGCGTGTnCoV-2019_78_LEFT
ONT_Sseq_5_RIGHT ACTTGCCTGTCGCTCTATCTTC TGGAGCTAAGTTGTTTAACAAGCGTGGAGCTAAGTTGTTTAACAAGCG
ONT_Sseq_7_LEFTTTTCTGTTGGTGCTGATATTGC GGGCTATCATCTTATGTCCTTCCCTnCoV-2019_82_LEFT
ONT_Sseq_7_RIGHT ACTTGCCTGTCGCTCTATCTTC AGGTGTGAGTAAACTGTTACAAACAACnCoV-2019_84_RIGHT
ONT_Sseq_2_LEFTTTTCTGTTGGTGCTGATATTGC ACACGTGGTGTTTATTACCCTGACnCoV-2019_72_LEFT
ONT_Sseq_2_RIGHT ACTTGCCTGTCGCTCTATCTTC GCAACACAGTTGCTGATTCTCTTCnCoV-2019_74_RIGHT
ONT_Sseq_4_LEFTTTTCTGTTGGTGCTGATATTGC CCAGCAACTGTTTGTGGACCTAnCoV-2019_77_LEFT
ONT_Sseq_4_RIGHT ACTTGCCTGTCGCTCTATCTTC TGTGTACAAAAACTGCCATATTGCAnCoV-2019_78_RIGHT
ONT_Sseq_6_LEFTTTTCTGTTGGTGCTGATATTGC TTGCCTTGGTGATATTGCTGCTnCoV-2019_80_LEFT
ONT_Sseq_6_RIGHT ACTTGCCTGTCGCTCTATCTTC TGCCAGAGATGTCACCTAAATCAAnCoV-2019_82_RIGHT
ONT_Sseq_8_LEFTTTTCTGTTGGTGCTGATATTGC TGCTGTAGTTGTCTCAAGGGCTnCoV-2019_84_LEFT
ONT_Sseq_8_RIGHT ACTTGCCTGTCGCTCTATCTTC ACGAAAGCAAGAAAAAGAAGTACGCnCoV-2019_86_RIGHT
ARTIC Network primers with a universal tag for PCR barcoding using ONT sequencing plataforms
Odd and pair primers are equimolar aliquoted to a final concentration of 100 μM, separately in a pool A and pool B scheme, as described for whole genome sequencing. The working primer pool stock for the odd and pair pool used in this protocol were at a concentration of 30 μM.
Reverse transcription
1h
Keeping the SARS-CoV-2 extracted RNA samples on ice all the time and spin down the tubes.



Set up the RT-PCR reaction tubes in a clean pre-PCR cabinet by adding 2 μL of LunaScript® RT SuperMix to each PCR tube. Include a RT-PCR negative control by replacing RNA sample with nuclease free water.

Note
Add positive and negative controls if available for results validation.

Add 8 uL of sample to the tube containing the LunaScript® RT SuperMix and mix gently. The final volume of the reaction is 10 μL.
Incubate in a thermal cycler using the the following instructions:

StepTemperature (ºC)TimeCycles
Primer annealing 252 min1
cDNA Synthesis5510 min
Heat inactivation951 min
Hold10-
Table 1: SARS-CoV-2 RT-PCR thermal profile.

S gene tiled amplification
2h
Set up the first round PCR reaction in a pre-PCR cabinet for primer pool A and primer pool B

ReagentPCR master mix pool APCR master mix pool B
Nuclease free water400 μL400 μL
Primer pool A (30 μM)25 μL--
Primer pool B (30 μM)25 μL
Q5® Hot Start High-Fidelity 2X Master Mix625 μL625 μL
Final volume1050 μL1050 μL
Table 2: S gene PCR amplification master mixes pool A an B.

Note
Keep the reversed transcribed sample on a PCR cooler or ice.

Transfer 10,5 μL of the PCR Master mix Pool A to the PCR tube set A and 10,5 μL of the PCR Master mix Pool B to the PCR tube set B, respectively.
Using a multichannel pipette, transfer 2 μL of reversed transcribed product from the Reverse Transcription step to the corresponding Pool A and Pool B PCR tube. Carry over the negative and positive controls.

Note
Store at -20 ºC the remaining reverse transcribed sample for further characterization, if needed.

Spin down the PCR tubes and incubate in the thermal cycler with the following program:

StepTemperature (ºC)TimeCycles
Initial denaturation9830 sec1
Denaturation9815 sec20
Annealing and extension633 min
Hold10----
Table 3: S gene PCR amplification using the Q5® Hot Start High-Fidelity polymerase.

Remove the tubes from the thermal cycler and spin down briefly. Mix the volume of pool A and pool B in the PCR tube set B.


Note
Up to this point it is highly recommended to check pool A and pool B amplification of
the positive and negative controls and some random samples in a 1% agarose gel
electrophoresis. Amplicons are expected to have ~1 Kb.

Prepare a set of PCR tubes with 9 μL of nuclease free water for a 1:10 dilution of the first round PCR amplification.
PCR barcoding of S gene amplicons
1h 15m
Set up the second round PCR reaction in a pre-PCR cabinet for primer pool A and primer pool B as follows:
ReagentVolume (µL)
Q5® Hot Start High-Fidelity 2X Master Mix6.00
PCR Barcodes (BC01-BC96)1.00
Final volume6.75
Table 4: S gene PCR barcoding mix using the Q5® Hot Start High-Fidelity polymerase.

Using a multichannel pipette, add 5 µL of the dilution 1:10 of the first round amplification of each sample. Spin down and incubate in the thermal cycler as follows:


StepTemperature (ºC)TimeCycles
Initial denaturation9830 s1
Denaturation9815 s15
Annealing 6215 s
Extension721m
Final extension7210 m1
Hold4----
Table 5: PCR barcoding thermal cycling profile

Pooling and clean-up
50m
Spin down the tubes and pool all samples in a 1.5 mL LoBind tube.

Note
If barcode balance is desired, barcoded samples should be individually purified using AMPure XP beads 0.5X and then equimolar pooled.

Add 0.5X volume of Ampure XP beads. Incubate 5 minutes in a rotator mixer. Spin down and rest the tubes in a magnetic rack for PCR tubes for 5 minutes.

Note
Make sure AMPure XP beads reached room temperature before use.

Discard the supernatant by aspiration, taking care not to disturb the pellet beads.

Wash the beads with Ethanol 70%. Repeat this step.
Let the pellet air dry for ~30 seconds and add 50 uL of nuclease free water. Incubate for 2 minutes at room temperature, spin down and place the PCR tubes in the magnetic rack for 5 minutes. Recover the supernatant.

Quantify the clean barcoded pool using a suitable fluorometric assay.
Prepare 1 µg of clean barcoded pool in 48 µL.
Note
Take the barcoded pool the repair and end-prep step or store the DNA at 4 ºC overnight or -20 ºC for long term storage.

End prep and clean-up
50m
Prepare the end prep mix as follows:

Sample/ReagentVolume (µL)
Clean barcoded pool (1 µg)48
NEBNext FFPE DNA Repair Buffer3.5
NEBNext FFPE DNA Repair Mix2
Ultra II End-prep reaction buffer3.5
Ultra II End-prep enzyme mix3
Final volume60
Table 6: End prep reaction mix.


Incubate the End-prep mix in the thermal cycler as follows:

StepTemperature (ºC)Time
Enzymes incubation205 min
Enzymes inactivation655 min
Hold4--
Table 7: End prep and DNA repair thermal incubation

(Optional) Add 1X volume of AMPure XP beads to the reaction and incubate in the rotator mixer for 5 minutes. Spin down and rest the tubes in the magnetic rack for 5 minutes.

Discard the supernatant by aspiration, taking care not to disturb the pellet beads.

Wash the pellet with Ethanol 70% twice.
Let the pellet air dry for ~30 seconds and add 61 µLof nuclease free water and incubate at room temperature for 2 minutes.
Spin down and rest the tubes in the magnetic rack for 5 minutes and recover the supernatant.
Note
Take forward the end-prepped DNA into the adapter ligation step or store the sample at 4 ºC overnight

ONT adapter ligation and final clean-up
1h 20m
Prepare the following adapter ligation mix:

ReagentVolume (uL)
Clean end-prepped DNA60
Ligation Buffer (LNB)25
NEBNext Quick T4 DNA Ligase10
AMX adapter5
Final volume100
Table 8: Adapter (AMX) ligation mix.

Incubate the reaction for 10 minutes at room temperature.

Note
Do not incubate the reaction for longer than 10 minutes if the AMPure XP beads purification was omitted.

Spin down the tubes and add AMPure XP beads 0.4X volume. Incubate in the rotator mixer for 5 minutes at room temperature.
Spin down the tubes and rest the tubes in the magnet rack for 5 minutes. Pipette off the supernatant.
Add 200 µL of Short Fragment Buffer (SFB) and mix gently. Spin down and place the tube in the magnet rack for 5 minutes. Discard the supernatant.

Repeat the previous step.
Spin down the tube and place it in the magnet rack. Remove any residual SFB and let it air dry for ~30 seconds.
Remove the tubes from the magnet and add 15 µL of Elution Buffer (EB). Flick the tube, spin down briefly and incubate the tube for 10 minutes at 37 ºC.

Note
The final library can be stored for up to 3 days at 4 ºC.

Quantify the final library using a fluorometric assay.
Flow cell priming and loading
15m
Use the Nanopore standard procedure for priming the FLO-MIN106D or FLO-FLG001 flow cells.
Once the flow cell is correclty primer proceed to load the library mixing the following:

Sample/ReagentVolume (uL)
Sequencing Buffer (SQB)37.5
Loading Beads (LB)25.5
DNA library (~300 ng)12
Final volume75
Table 9: DNA library to load in a FLO-MIN106D.


Sample/ReagentVolume (uL)
Sequencing Buffer (SQB)15
Loading Beads (LB)10
DNA library (~200 ng)5
Final Volume30
Table 9: DNA library to load in a FLO-FLG001.

Note
We recommend to load initially 300 ng for the FLO-MIN106D and 200 ng for the FLO-FLG001 and monitor the pore occupancy over the first 20 minutes and reload if the pore occupancy is lower than 60%. Additionally, a refuel after 12 hours of the sequencing run is recommended.
Note that the amount of DNA library is significantly higher than the amount recommended by Oxford Nanopore (20-50 fmol). If not sure, begin from this number and upscale accordingly to reach a satisfactory pore occupancy.


Data analysis
1h
Use epi2me-labs/wf-artic V1 scheme for consensus generation
Software
wf-artic
NAME
hedgehog for lineage set assignment using maximum ambiguity
Software
hedgehog
NAME

Use president for S gene completeness
and samtools for average sequencing depth
Software
samtools
NAME