Mar 13, 2024
ssUMI: high-throughput long-read sequencing workflow for highly-accurate near full-length 16S rRNA genes on the ONT platform
- Xuan Lin1,
- Katherine Waring2,
- John Tyson3,4,
- Ryan Ziels2
- 1University of British Columbia;
- 2Civil Engineering, The University of British Columbia, Vancouver, BC, Canada;
- 3Environmental Microbiology, British Columbia Center for Disease Control Public Health Laboratory, Vancouver, BC, Canada;
- 4Pathology and Laboratory Medicine, The University of British Columbia, Vancouver, BC, Canada
Protocol Citation: Xuan Lin, Katherine Waring, John Tyson, Ryan Ziels 2024. ssUMI: high-throughput long-read sequencing workflow for highly-accurate near full-length 16S rRNA genes on the ONT platform. protocols.io https://dx.doi.org/10.17504/protocols.io.6qpvr3qkpvmk/v1
Manuscript citation:
Lin, X., Waring, K., Tyson, J. & Ziels, R. M. High-accuracy meets high-throughput for microbiome profiling with near full-length 16S rRNA amplicon sequencing on the Nanopore platform. 2023.06.19.544637 Preprint at https://doi.org/10.1101/2023.06.19.544637 (2023).
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 05, 2023
Last Modified: March 13, 2024
Protocol Integer ID: 91810
Keywords: length 16s rrna amplicon, length 16s rrna gene, rrna amplicon, oxford nanopore native barcoding kit 96 v12, rrna gene, sequencing library, oxford nanopore native barcoding kit, oxford nanopore community protocol, nanopore platform, sequencing, unique molecule identifier, amplicon, promethion platforms in super high accuracy mode, 1391r
Abstract
This is the online protocol for near full-length 16S rRNA amplicon sequencing with unique molecule identifiers (ssUMI) on the Nanopore platform. Sequencing libraries are prepared with Oxford Nanopore Native Barcoding kit 96 V12 or V14 (SQK-NBD112.96 or SQK-NBD114.96) for sequencing on PromethION platforms in super high accuracy mode (260 bps).
The near full-length 16S rRNA amplicons are generated with primers 8F: AGRGTTYGATYMTGGCTCAG and 1391R: GACGGGCGGTGWGTRCA; the UMI design was adapted from (Karst and Ziels, 2021) and the Oxford Nanopore community protocol.
For more details, please check our preprint: https://www.biorxiv.org/content/10.1101/2023.06.19.544637v1
Materials
Primers and probe (order from IDT)
1. ddPCR
ddPCR-8F: AGRGTTYGATYMTGGCTCAG
ddPCR-1391R: GACGGGCGGTGWGTRCA
ddPCR-515F-FAM: (FAM)-TGYCAGCMG-(ZEN)-CCGCGGTAA-(IBFQ)
2. ssUMI-PCR
ssUMI-8F-UMI: GTATCGTGTAGAGACTGCGTAGG NNNYRNNNYRNNNYRNNNA GRGTTYGATYMTGGCTCAG (PAGE purified)
ssUMI-1391R-UMI: AGTGATCGAGTCAGTGCGAGTG NNNYRNNNYRNNNYRNNN GACGGGCGGTGWGTRCA (PAGE purified)
ssUMI-Universal-F: GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCGTATCGTGTAGAGACTGCGTAGG
ssUMI-Universal-R: GGTGCTGAAGAAAGTTGTCGGTGTCTTTGTGTTAACCAGTGATCGAGTCAGTGCGAGTG
Protocol materials
PCR Plate Heat Seal foil piercableBio-Rad LaboratoriesCatalog #1814040
Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01
NEB Blunt/TA Ligase Master Mix Catalog #M0367
NEBNext Ultra II End Repair/dA-Tailing Module - 96 rxnsNew England BiolabsCatalog #E7546L
NEBNext Quick Ligation Reaction Buffer (5X) - 2.0 mlNew England BiolabsCatalog #B6058S
Quick T4 DNA LigaseNew England BiolabsCatalog #E7180S
Ultrapure WaterThermofisherCatalog #10977023
ddPCR 96-well platesBio-Rad LaboratoriesCatalog #12001925
Before start
This protocol was developed with 96 samples, and we highly recomand using multi-channel pipettes and/or an automatic liquid handler.
Time can be saved by preparing master mixes first, before PCR steps. The master mix for PCR steps should be prepared in a Master Mix (PCR) Hood. To avoid cross-contamination make sure that your original stock reagents have no contact with any amplified DNA material.
A Negative Control (nuclease-free H2O) should be included.
Keep the enzymes on ice and thaw the other reagents at room temperature, mix, then spin down before placing on ice.
All steps after ssUMI-EarlyPCR2 should be performed in post-PCR area.
Sample pre-dilution and ddPCR quantification of starting material
12h
Estimate the full-length 16S rRNA concentration in the DNA extract (e.g., sample), and dilute the sample to 20000 copies/μL with Ultrapure WaterThermofisherCatalog #10977023 .
Note
The concentration of full-length 16S rRNA copy numbers can be estimated based on previous experiments, literature, or qPCR. It's important to pre-dilute the DNA sample to ensure the 16S rRNA copy number is within the dynamic range of ddPCR instrument (1-125,000 copies/μl).
2h
Run ddPCR quantification with 2.5 µL diluted DNA sample.
Prepare the ddPCR mastermix in a PCR hood, vortex to mix and dispense 19.5 µL into each well of the ddPCR 96-well platesBio-Rad LaboratoriesCatalog #12001925 . Each component is thawed at Room temperature , vortexed to mix, then spun down. A 10% pipetting loss should be included when preparing mastermix for multiple samples.
| A | B | C | |
| Component | Volume (per rxn) | Volume (96 rxn) | |
| ddPCR-8F (10 μM) | 1.98 μL | 217.8 μL | |
| ddPCR-1391R (10 μM) | 1.98 μL | 217.8 μL | |
| ddPCR-515F-FAM (10 μM) | 0.55 μL | 60.5 μL | |
| Nuclease-free water | 3.99 uL | 438.9 μL | |
| ddPCR Supermix for Probes (No dUTP) | 11 μL | 1210 μL | |
| Total volume | 19.5 μL | 2145 μL |
10m
Add 2.5 µL diluted DNA sample to each well, seal the plate with PCR Plate Heat Seal foil piercableBio-Rad LaboratoriesCatalog #1814040 , vortex to mix, and spin down.
10m
Load the plates on the QX200 AutoDG Droplet Digital PCR System, and run droplet generation.
40m
Run PCR in a deep-well thermalcycler using the following program (set total volume as 40 µL ) :
| A | B | C | D | E | |
| Step | Temperature | Ramp rate | Time | Cycles | |
| Enzyme Activation | 95°C | 2°C/sec | 10 min | 1 | |
| Denaturation Annealing Extension | 94°C 60°C 72 °C | 2°C/sec | 30 sec 1 min 4 min | 50 | |
| Enzyme Deactivation | 98 °C | 2°C/sec | 10 min | 1 | |
| Hold | 4°C | 2°C/sec | ∞ | - |
Note
ddPCR requires using a doubled reaction volume to prevent droplet burst during the PCR reaction
6h
Count droplets in QX200 AutoDG Droplet Digital PCR System using manufacturer's protocols.
2h
ssUMI-PCR1: UMI tagging and cleanup
2h 10m
In this step, the near full-length 16S rRNA gene primers containing UMIs are annealed to both ends of the DNA template using 2 rounds of PCR. Only one copy of a dual-end UMI-tagged amplicon will be generated for each input molecule.
1h 10m
Adjust the input DNA concentration to 5000 copies/μL with nuclease-free water (100,000 16S rRNA gene copies in 20 µL) based on the ddPCR measured near full-length 16S rRNA gene copy numbers (see Step 2.5).
30m
Prepare ssUMI-PCR1 mastermix in a PCR hood, flick the tube to mix and dispense 30 µL into each well of a 96-well PCR plate. Each component is thawed On ice , mixed by flicking the tube, then spun down. A 10% pipetting loss should be included when preparing mastermix for multiple samples.
| A | B | C | |
| Component | Volume (per rxn) | Volume (96 rxn) | |
| 2X Platinum™ SuperFi™ II Green PCR Master Mix | 25 μL | 2750 μL | |
| 100 µM UMI_8F (500 nM final) | 0.25 μL | 27.5 μL | |
| 100 µM UMI_1391R (500 nM final) | 0.25 μL | 27.5 μL | |
| Nuclease-free water | 4.5 μL | 495 μL | |
| Total volume | 30 μL | 3300 μL |
10m
Add 20 µL DNA samples from step 3.1 (100,000 full-length 16S rRNA gene copies) into each well of a 96-well PCR plate,
5m
Run PCR in a thermocycler using the following program (total volume: 50 µL ) :
| A | B | C | D | E | |
| Step | Temperature | Ramp rate | Time | Cycles | |
| Initial denaturation | 98°C | max | 3 min | 1 | |
| Denaturation Annealing Extension | 98°C Touchdown from 66°C to 60°C 72°C | max 0.2°C/sec max | 30 sec 90 sec 3 min | 2 | |
| Final extension | 72 °C | max | 5 min | 1 | |
| Hold | 4 °C | max | ∞ | - |
22m
ssUMI-PCR1 cleanup using Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 with a bead-to-sample ratio of 0.6.
1h
Homogenize Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 solution by vortexing.
Add 30 µL bead solution to the 50 µL ssUMI-PCR1 product (ratio 0.6) and mix by pipetting or brief vortexing.
Spin down, and then incubate at Room temperature for 00:10:00 .
10m
Place the plate on a magnetic rack to pellet the beads, and wait until the solution is clear on the side of each well (~5 min).
Keep the plate on the magnetic rack, carefully discard the supernatant.
Wash beads by adding 200 µL fresh 80% ethanol along the opposite side of the beads.
Wait 30 seconds and discard the ethanol.
Repeat the washing steps (Steps 4.5-4.7).
Spin down and place the plate back on the magnetic rack, then remove residual ethanol with a smaller pipette.
Note
Not removing residual ethanol could cause primer and UMI carryover and high chimera rates.
Let the beads air dry for a maximum of 2 min (but do not overdry the beads to the point of cracking).
Remove the plate from the magnetic rack and elute the purified DNA by adding 20 µL nuclease-free water and mix by pipetting.
Incubate at Room temperature for 00:05:00 .
5m
Place the plate on the magnetic rack to pellet the beads and wait until the eluate is clear and colourless.
Pipette off the 18 µL supernatant to a new 96-well PCR plate.
ssUMI-EarlyPCR2: amplification of UMI-tagged amplicons
2h 20m
In this step, the dual-UMI-tagged near full-length 16S rRNA gene amplicons are further amplified with PCR.
1h 20m
Prepare ssUMI-PCR2 mastermix in PCR hood, flick the tube to mix. Each component is thawed On ice , mixed by flicking the tube, then spun down. A 10% pipetting loss should be included when preparing mastermix for multiple samples.
| A | B | C | |
| Component | Volume (per rxn) | Volume (96 rxn) | |
| 2X Platinum™ SuperFi™ II Green PCR Master Mix | 25 μL | 2750 μL | |
| 100 µM UMI_8F (500 nM final) | 0.5 μL | 55 μL | |
| 100 µM UMI_1391R (500 nM final) | 0.5 μL | 55 μL | |
| 25 mM MgCl (1mM final) | 2 μL | 220 μL | |
| Nuclease-free water | 4 μL | 440 μL | |
| Total volume | 32 μL | 3520 μL |
10m
Dispense 32 µL into each well of the 96-well PCR plate containing 18 μL cleaned ssUMI-PCR1 product.
5m
Spin down and run PCR in a thermocycler using the following program (total volume: 50 µL ) :
| A | B | C | D | E | |
| Step | Temperature | Ramp rate | Time | Cycles | |
| Initial denaturation | 98°C | max | 3 min | 1 | |
| Denaturation Annealing Extension | 98°C Touchdown from 70°C to 63°C 72°C | max 0.2°C/sec max | 20 sec 45 sec 3 min 30s | 5 | |
| Denaturation Extension | 98°C 72°C | max max | 20 sec 4 min | 5 | |
| Final extension | 72 °C | max | 5 min | 1 | |
| Hold | 4 °C | max | ∞ | - |
1h 5m
ssUMI-EarlyPCR2 cleanup using Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 with a bead-to-sample ratio of 0.6.
Note
This step should be conducted in a post-PCR area to prevent amplicon contamination.
1h
Homogenize Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 solution by vortexing.
Add 30 µL bead solution to the 50 µL ssUMI-PCR1 product (ratio 0.6) and mix by pipetting or brief vortexing.
Spin down, and then incubate at Room temperature for 00:10:00 .
10m
Place the plate on a magnetic rack to pellet the beads, and wait until the solution is clear on the side of each well (~5 min).
Keep the plate on the magnetic rack, carefully discard the supernatant.
Wash beads by adding 200 µL fresh 70% ethanol along the opposite side of the beads.
Wait 30 seconds and discard the ethanol.
Repeat the washing steps (Steps 6.5-6.7).
Spin down and place the plate back on the magnetic rack, then remove residual ethanol with a smaller pipette.
Let the beads air dry for a maximum of 2 min (but do not overdry the beads to the point of cracking).
Remove the plate from the magnetic rack and elute the purified DNA by adding 20 µL nuclease-free water and mix by pipetting.
Incubate at Room temperature for 00:05:00 .
5m
Place the plate on the magnetic rack to pellet the beads and wait until the eluate is clear and colourless.
Pipette off the 18 µL supernatant to a new 96-well PCR plate.
Note
This is a safe stopping point.
For short-term storage, samples can be stored at 4 °C overnight;
For long-term storage, samples should be stored at -20 °C .
ssUMI-LatePCR2: amplification of UMI-tagged amplicons
2h 40m
Similar to ssUMI-EarlyPCR2, the dual-UMI-tagged near full-length 16S rRNA gene amplicons are further amplified with 15 cycles of PCR.
Prepare the same mastermix as in Step 5.1 (ssUMI-PCR2 mastermix) in PCR hood, flick the tube to mix. Each component is thawed On ice , mixed by flicking the tube, then spun down. A 10% pipetting loss should be included when preparing mastermix for multiple samples.
| A | B | C | |
| Component | Volume (per rxn) | Volume (96 rxn) | |
| 2X Platinum™ SuperFi™ II Green PCR Master Mix | 25 μL | 2750 μL | |
| 100 µM UMI_8F (500 nM final) | 0.5 μL | 55 μL | |
| 100 µM UMI_1391R (500 nM final) | 0.5 μL | 55 μL | |
| 25 mM MgCl (1mM final) | 2 μL | 220 μL | |
| Nuclease-free water | 4 μL | 440 μL | |
| Total volume | 32 μL | 3520 μL |
10m
Dispense 32 µL into each well of the 96-well PCR plate containing 18 μL cleaned ssUMI-EarlyPCR2 product.
Note
This step should be conducted in a post-PCR area to prevent amplicon contamination.
5m
Spin down and run PCR in a thermocycler using the following program (total volume: 50 µL ) :
| A | B | C | D | E | |
| Step | Temperature | Ramp rate | Time | Cycles | |
| Initial denaturation | 98°C | max | 3 min | 1 | |
| Denaturation Extension | 98°C 72°C | max max | 20 sec 4 min | 15 | |
| Final extension | 72 °C | max | 5 min | 1 | |
| Hold | 4 °C | max | ∞ | - |
1h 25m
ssUMI-LatePCR2 cleanup using Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 with a bead-to-sample ratio of 0.6.
Note
This step should be conducted in a post-PCR area to prevent amplicon contamination.
1h
Homogenize Mag-Bind® TotalPure NGS beadsOmega BiotekCatalog #M1378-01 solution by vortexing.
Add 30 µL bead solution to the 50 µL ssUMI-PCR1 product (ratio 0.6) and mix by pipetting or brief vortexing.
Spin down , and then incubate at Room temperature for 00:10:00 .
10m
Place the plate on a magnetic rack to pellet the beads, and wait until the solution is clear on the side of each well (~5 min).
Keep the plate on the magnetic rack, carefully discard the supernatant.
Wash beads by adding 200 µL fresh 70% ethanol along the opposite side of the beads.
Wait 30 seconds and discard the ethanol.
Repeat the washing steps (Steps 8.5-8.7).
Spin down and place the plate back on the magnetic rack, then remove residual ethanol with a smaller pipette.
Let the beads air dry for a maximum of 2 min (but do not overdry the beads to the point of cracking).
Remove the plate from the magnetic rack and elute the purified DNA by adding 20 µL nuclease-free water and mix by pipetting.
Incubate at Room temperature for 00:05:00 .
5m
Place the plate on the magnetic rack to pellet the beads and wait until the eluate is clear and colourless.
Pipette off the 18 µL supernatant to a new 96-well PCR plate.
Quantify 1 µL of the cleaned ssUMI-LatePCR2 product using a Qubit fluorometer with Qubit dsDNA HS Assay Kit. Amplicons should have concentration higher than 4 ng/μL
Note
This is a safe stopping point.
For short-term storage, samples can be stored at 4 °C overnight;
For long-term storage, samples should be stored at -20 °C .
Nanopore sequencing library preparation using Native Barcoding Kit 12/14
4h
DNA End-prep with NEBNext Ultra II End Repair/dA-Tailing Module - 96 rxnsNew England BiolabsCatalog #E7546L
Reagent preparation before starting this step
1. Thaw the NEBNext Ultra II End Prep Reaction Buffer On ice , check for any visible precipitate; vortexing for at least 30 seconds may be required to solubilise all precipitate.
2. Place the Ultra II End Prep Enzyme Mix On ice
Note
Do NOT vortex the Ultra II End Prep Enzyme Mix.
1h 30m
In a clean 96-well plate, aliquot 50 fmol (46.4 ng ) of amplicon per sample (based on quantification in Step 9).
Make up each sample to 12.5 µL using nuclease-free water. Mix gently by pipetting and spin down.
Prepare End-prep mastermix, mix by pipetting 10-20 times. A 10-15% pipetting loss should be included when preparing mastermix for multiple samples.
| A | B | C | |
| Reagent | Volume (per rxn) | Volume (96 rxn) | |
| Ultra II End-prep Reaction Buffer | 1.75 μl | 210 μl | |
| Ultra II End-prep Enzyme Mix | 0.75 μl | 90 μl | |
| Total | 2.5 μl | 300 μl |
Add 2.5 µL End-prep mastermix to each well containing DNA amplicons, pipetting 10-20 times to mix and spin down briefly.
Using a thermocycler, incubate at 20 °C for 00:05:00 and 65 °C for 00:05:00 .
Note
Take forward the end-prepped DNA into the native barcode ligation step.
If users want to pause the library preparation here, we recommend cleaning up your sample with 1X AMPure XP Beads (AXP) and eluting in nuclease-free water before storing at 4 °C .
10m
Native barcode ligation with Native Barcoding Kit 12 or Kit 14.
Reagent preparation before starting this step
1. Thaw NEB Blunt/TA Ligase Master Mix Catalog #M0367 at Room temperature , spin down and mix by performing 10 full volume pipette mixes, then place On ice .
2. Thaw the AMPure XP Beads (AXP) at Room temperature and mix by vortexing. Keep the beads at Room temperature .
3. Thaw the EDTA (provided with the sequencing kit) at Room temperature and mix by vortexing. Then spin down and place On ice .
4. Thaw the Native Barcodes NB01-96 at Room temperature . Individually mix the barcodes by pipetting, spin down, and place them On ice .
1h
In a new 96-well plate, add the reagents in the following order per well (select unique barcode for each sample on the plate). Between each addition, pipette mix 10 times.
| A | B | |
| Reagent | Volume | |
| End-prepped DNA | 3.75 μL | |
| Native Barcode (NB01-96) | 1.25 μL | |
| Blunt/TA Ligase Master Mix | 5 μL | |
| Total | 10 μL |
Thoroughly mix the reaction by gently pipetting 10 times and then briefly spin down.
Incubate for 00:20:00 at Room temperature .
20m
Add 1 µL EDTA to each well and mix thoroughly by pipetting and spin down briefly.
Pool all barcoded samples in a 1.5 ml Eppendorf DNA LoBind tube.
Native Barcoding reaction cleanup with 0.4x AMPure XP Beads.
Before start of this step:
1. Prepare 2 mL fresh 80% ethanol in nuclease-free water.
2. Pre-heat an incubator to 37 °C .
30m
Resuspend the AMPure XP Beads (AXP) by vortexing.
Add 422 µL (for 96 samples) AMPure XP Beads (AXP) to the pooled reaction, and mix by pipetting for a 0.4x clean.
Incubate on a Hula mixer (rotator mixer) for 00:10:00 at Room temperature .
10m
Spin down the sample and pellet on a magnet for 00:05:00 . Keep the plate on the magnetic rack until the eluate is clear and colourless, and pipette off the supernatant.
5m
Keep the tube on the magnetic rack and wash the beads with 700 µL freshly prepared 80% ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Note
If the pellet was disturbed, wait for beads to pellet again before removing the ethanol.
Repeat the previous step (step 12.5).
Spin down and place the tube back on the magnetic rack. Pipette off any residual ethanol. Allow the pellet to dry for ~30 seconds, but do not overdry the pellet to the point of cracking.
Remove the tube from the magnetic rack and resuspend the pellet in 35 µL nuclease-free water 35 μl nuclease-free water by gently flicking or pipetting.
Incubate for 00:10:00 at 37 °C . Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
10m
Pellet the beads on a magnetic rack until the eluate is clear and colourless.
Remove and retain 35 µL of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µL of the eluted sample using a Qubit fluorometer with Qubit dsDNA HS Assay Kit.
Note
This is a safe stopping point.
Samples can be stored at 4 °C overnight
Nanopore sequencing adapter ligation
Reagent preparation before starting this step
1. Thaw theNEBNext Quick Ligation Reaction Buffer (5X) - 2.0 mlNew England BiolabsCatalog #B6058S at Room temperature , spin down and mixed by performing 10 full volume pipette mixes.
2. Spin down the Adapter Mix II (AMII H, Kit 12) or Native Adapter (NA, Kit 14) and Quick T4 DNA LigaseNew England BiolabsCatalog #E7180S , pipette mix and place on ice.
3. Thaw the Elution Buffer (EB) and Short Fragment Buffer (SFB) at Room temperature and mix by vortexing. Then spin down and place On ice .
Note
Do NOT vortex the Quick T4 DNA Ligase.
30m
In a 1.5 ml Eppendorf LoBind tube, mix in the following order. Between each addition, pipette mix 10 times.
| A | B | |
| Reagent | Volume | |
| Pooled barcoded sample | 30 μL | |
| Native Adapter (NA) | 5 μL | |
| NEBNext Quick Ligation Reaction Buffer (5x) | 10 μL | |
| Quick T4 DNA Ligase | 5 μL | |
| Total | 50 μL |
Thoroughly mix the reaction by gently pipetting and briefly spinning down.
Incubate the reaction for 00:20:00 at Room temperature .
20m
Adapter Ligation reaction cleanup with 0.4x AMPure XP Beads.
Before start of this step:
Pre-heat an incubator to 37 °C .
30m
Resuspend the AMPure XP Beads (AXP) by vortexing.
Add 20 µL of resuspended AMPure XP Beads (AXP) to the reaction and mix by pipetting.
Incubate on a Hula mixer (rotator mixer) for 00:10:00 at Room temperature .
10m
Spin down the sample and pellet on the magnetic rack. Keep the tube on the magnet and pipette off the supernatant.
Wash the beads by adding 125 µL Short Fragment Buffer (SFB). Flick the beads to resuspend, spin down, then return the tube to the magnetic rack and allow the beads to pellet. Remove the supernatant using a pipette and discard.
Repeat the previous step (Step 15.5).
Spin down and place the tube back on the magnet. Pipette off any residual supernatant.
Remove the tube from the magnetic rack and resuspend pellet in 25 µL Elution Buffer (EB).
Spin down and incubate for 00:10:00 at 37 °C . Every 2 minutes, agitate the sample by gently flicking for 10 seconds to encourage DNA elution.
10m
Pellet the beads on a magnet until the eluate is clear and colourless, for at least 1 minute.
Remove and retain 25 µL of eluate containing the DNA library into a clean 1.5 ml Eppendorf DNA LoBind tube.
Quantify 1 µL of the eluted sample using a Qubit fluorometer with Qubit dsDNA HS Assay Kit. Then make up the library to 32 μl at 10-20 fmol (18.4 ng).
Note
This is a safe stop point.
For short-term storage, sequencing libraries can be stored in Eppendorf DNA LoBind tubes at 4 °C
For single use and long-term storage of more than 3 months, we recommend storing libraries at -80 °C in Eppendorf DNA LoBind tubes.