Sep 25, 2023
  • 1Australian National University
Icon indicating open access to content
QR code linking to this content
Protocol Citation: Alicia Grealy 2023. SSLib v2.0 (Gansauge et al. 2017). protocols.io https://dx.doi.org/10.17504/protocols.io.bp2l6n395gqe/v1
Manuscript citation:
Gansauge MT, Gerber T, Glocke I, Korlevic P, Lippik L, Nagel S, Riehl LM, Schmidt A, Meyer M. 2017. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research, 45, 10: e79. Gansauge MT, Meyer M. 2013. Single-stranded DNA library preparation for the sequencing of ancient or damaged DNA. Nature Protocols, 8, 4: 737-748.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 12, 2020
Last Modified: September 25, 2023
Protocol Integer ID: 34124
Keywords: shotgun library, preparing shotgun library, bench protocol, stranded dna, degraded dna, dna, protocol
Abstract
This bench protocol is based on the work of Gansauge and Meyer (2013) and Gansauge et al (2017), for preparing shotgun libraries from single-stranded DNA, typically for ancient and degraded DNA.

Guidelines
Use at your own risk. You are responsible for double-checking that everything is correct!

Familiarise yourself with the relevent literature (Gansauge and Meyer 2013, and Gansauge et al. 2017) before attempting!

Materials
MATERIALS
T4 RNA Ligase Reaction Buffer - 3.0 mlNew England BiolabsCatalog #B0216L
Tris-HCl, pH 8.0 (UltraPure)Thermo Fisher ScientificCatalog #15568025
5 M Sodium chloride (NaCl)Merck MilliporeSigma (Sigma-Aldrich)Catalog #S5150-1L
DMSO Merck MilliporeSigma (Sigma-Aldrich)Catalog #D8418
Dynabeadsâ„¢ MyOneâ„¢ Streptavidin C1Thermo Fisher ScientificCatalog #65001
UltraPure™ DNase/RNase-Free Distilled WaterThermo FisherCatalog #10977023
AmpliTaq Gold™ DNA Polymerase with Gold Buffer and MgCl2Thermo FisherCatalog #4311806
SDS, 20% Solution, RNase-freeThermo FisherCatalog #AM9820
FastAP Thermosensitive Alkaline Phosphatase (1 U/µL)Thermo FisherCatalog #EF0651
T4 Polynucleotide Kinase (10 U/µL)Thermo FisherCatalog #EK0031
T4 DNA Ligase (5 U/µL)Thermo FisherCatalog #EL0011
T4 DNA Ligase, HC (30 U/µL)Thermo FisherCatalog #EL0013
Klenow Fragment (10 U/µL)Thermo FisherCatalog #EP0051
SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563
UltraPure 0.5M EDTA pH 8.0Invitrogen - Thermo FisherCatalog #15575020
T4 DNA ligase buffer 10 XThermo Fisher ScientificCatalog #Supplied with EL0013
Klenow reaction buffer 10XLife TechnologiesCatalog #Supplied with EP0051
Tween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P2287-100ml
PEG-8000 50% w/vNew England BiolabsCatalog #Supplied w/ B0216L (T4 RNA ligas
Adenosine Triphosphate (ATP) 100 mMThermo Fisher ScientificCatalog #R0441
20X SSCMerck MilliporeSigma (Sigma-Aldrich)Catalog #S6639-1L
Bovine Serum Albumin (BSA)Catalog #BSA-50
dNTPs 100 mM ea.BiolineCatalog #BIO-39025
PEG-4000 50% w/vThermo Fisher ScientificCatalog #Supplied with EL0013 (T4 DNA lig

Note
Note that "N" in the splinter oligo represents any base such that the oligo is a mixture of various random sequences in this place.
In contrast, the "NNNNNN" in the indexing primers represents a specific string of bases (e.g., order "CGCTCAGT" in this place). Each sample will be indexed with a unique combination of indexing primers. Ideally, these combinations should not be reused in the lab. Be sure to follow Illumina's recommendations when chosing primer combinations (e.g., ensure adequate diversity in the bases, ensure each is at least 3 bp different from each other, don't use indexes that will begin with two dark cycles, etc.).

If you can afford it, you can oder all oligos HPLC purified, but I have found it not to have any detectable impact.

Gansauge and Meyer (2013) "strongly recommend checking the synthesis quality [of oligos] using acrylamide gel electrophoresis. Synthesis artifacts and impurities will lower the yield of library preparation. Moreover, incomplete single-stranded adapter oligonucleotides may serve as template for library preparation causing artifact formation". I have not done this before and have observed some artifacts that can be seen after running the CL104 positive oligo library on a gel. If artifacts are observed, re-order oligos.



OligosConcentrationWorking concentrationSynthesis scalePurificationSupplierResuspension bufferSequence 5'-3'
CL78200 uMna250 nmolDual HPLCIDTTE/5Phos/AGATCGGAAG/iSp9//iSp9//iSp9//3BioTEG/
Splinter100 uMna200 nmoldesaltedEurogentecTE[SpC12][A][A][A]CTTCCGATCTNNNNNNNN[AmC6]
CL53500 uMna250 nmolHPLCIDTTEACACGACGCTCTTC/3ddC/
CL73500 uMna250 nmolHPLCIDTTE/5Phos/GGAAGAGCGTCGTGTAGGGAAAGAG*T*G*T*A
CL130100 uMna100 nmolHPLCIDTTEGTGACTGGAGTTCAGACGTGTGCTCTTCC*GA*TC*T
CL104100 uM0.1 uM100 nmolHPLCIDTTET buffer/5Phos/TCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA/3Phos/
CL107100 uM10 uM25 nmoldesaltedIDTWaterTCATGTAACTCGCCTTGATCGT
CL108100 uM10 uM25 nmoldesaltedIDTWaterTCGTCGTTTGGTATGGCTTC
IS7100 uM10 uM25 nmoldesaltedIDTWaterACACTCTTTCCCTACACGAC
IS8100 uM10 uM25 nmoldesaltedIDTWaterGTGACTGGAGTTCAGACGTGT
CL72_Custom_Seq_Primer100 uMna25 nmoldesaltedIDTWaterACACTCTTTCCCTACACGACGCTCTTCC
CL72_i5_index100 uMna25 nmoldesaltedIDTWaterGGA AGA GCG TCG TGT AGG GAA AGA GTG T
CL105_CL106_Std100 uMDilute to 10^11 - 10^2 copies/ul4 nmol UltramerdesaltedIDTTET bufferACACTCTTTCCCTACACGACGCTCTTCCTCGTCGTTTGGTATGGCTTCTATCGUATCGATCGATCGACGATCAAGGCGAGTTACATGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
P5-indexing primer100 uM10 uM25 nmoldesaltedIDTWaterAATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTT
P7-indexing primer100 uM10 uM25 nmoldesaltedIDTWaterCAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT
Table 1. Oligos needed. Store all oligos at -20 deg C.


Equipment needed

Thermalcycler
QuantStudio 3 qPCR machine
Thermalshaker
Heat block
Hybridisation oven
Magnetic rack (1.5 ml tubes)
P1000, P200, P100, P20, P10, P2 pipettes and extra-long filter tips
10% Household bleach solution
70% Ethanol
Kimwipes and paper towels
15 ml Falcon tubes
50 ml Falcon tubes
1.5 ml Safelock tubes
1.5 ml Lo-bind Safelock tubes
0.5 ml Lo-bind Safelock tubes
0.2 ml Lo-bind PCR tubes
8-well strip optical qPCR tubes with attached lid (0.1 ml profile)
Sharps container
UV glove box
96-well PCR plate rack
1.5 ml-2.0ml tube racks
15 ml tube racks
50 ml tube racks
Minispin
Vortex



Before start
Note that you will need to adjust steps depending on the equipment you have (e.g., a Thermal shakers and hybridisation ovens can be used interchangably). If you only have heat blocks, you will need to keep beads moving by regular vortexing. For high-throughput, it may be advisable to use a 96-well plate magent coupled with 0.2 ml tubes rather than 1.5 ml tubes.

Always include the positive control oligo CL104 in the library preparation, as well as a no-template control and any extraction controls.

Note that CL78 should have a 5' phosphate, but this is missing in Gansauge and Meyer (2013).

Note that 0.1X BWT is NOT just a diluted version of 1X BWT. It only contains a tenth of the NaCl but is the same for most of the other reagents. Here, I call it WASH A as per Gansauge and Meyer (2013) to avoid confusion.

I have adjusted the volumes of buffers to make only 10 ml of the wash buffers, which is typically enough for a batch of 12 libraries. If you are doing more reactions, scale up the recipe.

Note that some oligos need to be resuspended in a specific buffer.

Note that the splinter oligo used here is not published in Gansauge et al. (2017), but was personally recommended to me by Matthias Meyer.

Store PEG and ATP at -20 deg C and avoid repeated rounds of freeze thawing.

Store MyOne C1 Streptavidin beads at 4 deg C in a fridge.
Preparation
30m

Note
Perform all reaction set-up steps in a reagent-only pre-PCR space inside a dedicated ultraclean environment. Add DNA and subsequent master-mixes to the reaction, and perform wash steps, in a separate pre-PCR space.

"Suit up" in this order: hair net, nitrile gloves, facemask, coveralls, gumboots, booties, second pair of gloves.
Prepare the space by decontaminating surfaces with 10% household bleach followed by 70% ethanol. UV irradiate pipettes and racks. Racks should be bleached between subsequent uses and UV irradiated.
Ensure ice is available. Thaw reagents on ice as needed. Keep enzymes on ice at all times. Do not vortex enzymes to mix but mix by flicking the tube gently. Pulse centrifuge all reagents before opening.
Label tubes.

TubeQtyFor ...
1.5 ml Safelock Tube105X SYBR
0.5 ml Safelock Tube825 mM dNTPs
1.5 ml Safelock Tube10.1 uM CL104
1.5 ml Safelock Tube10.1 uM CL105 1/500
1.5 ml Safelock Tube110 uM IS7
1.5 ml Safelock Tube110 uM IS8
1.5 ml Safelock Tube110 uM CL107
1.5 ml Safelock Tube110 uM CL108
1.5 ml Safelock Tube10CL105_106 STD dilution series 10^11 - 10^2
15 ml Falcon Tube1TE Buffer
15 ml Falcon Tube1Bead binding buffer
15 ml Falcon Tube1Wash A
15 ml Falcon Tube1Wash B
15 ml Falcon Tube1EBT buffer
1.5 ml Safelock Tube11% Tween 20
1.5 ml Safelock Tube12% Tween 20
50 ml Falcon Tube1TET buffer
0.2 ml Lo-bind PCR Tube1Purify CL78
0.2 ml Lo-bind PCR Tube1Purify Splinter
0.2 ml Lo-bind PCR Tube1CL78/Splinter (DS1)
0.2 ml Lo-bind PCR Tube1CL53/CL73 (DS2)
0.2 ml Lo-bind PCR Tube# of samples + 2Reaction tubes
1.5 ml Lo-bind Tube4Step 16, Step 20, Step 38, Step 48 master mixes
1.5 ml Lo-bind Tube1Beads wash
15 ml Falcon Tube1Beads resuspension
1.5 ml Lo-bind Tube# of samples + 2Reaction tubes 2
0.5 ml Lo-bind Tube# of samples + 2Final library
0.5 ml Lo-bind Tube# of samples + 21/20 dilution of library
1.5 ml Safelock Tube2Assay A and B master mixes
8-strip optical qPCR Tubes(((# of samples + 2)*2)+26)/8Assay A and B

Prepare all necessary buffers and UV decontaminate where appropriate.
Note
Only add the SDS to the Bead Binding Buffer right before us. Discard Bead Binding Buffer after use.

Aliquot 5X SYBR into 500-ul batches and store at -20 deg C in foil.

Aliquot dNTPs into 50-ul batches and store at -20 deg C.

ABCD
(Discard after use)1 M Tris-HCl100 ul0.01 M
(Exp. 1 month)1 M Tris-HCl100 ul0.01 M
(Exp. 1 month)20% SDS50 ul0.1%
(Exp. 1 year)1 M Tris-HCl100 ul0.01 M
(Exp. 1 year)1 M Tris-HCl100 ul0.01 M
(Exp. 1 year)0.5 M EDTA100 ul0.001 M
1% Tween 20100% Tween 2010 ul1%
2% Tween 20100% Tween 2020 ul2%
25 mM dNTPs100 mM dATP100 ul25 mM
5X SYBR10,000X SYBR2.5 ul5X
Bead Binding Buffer5 M NaCl2 ml1 M
BufferReagentVolume to addFinal concentration in solution
EBT1 M Tris-HCl100 ul0.01 M
Stringency wash20X SSC50 ul0.1X
TE BufferUltrapure water9.88 mlna
TET buffer1 M Tris-HCl500 ul0.01 M
Wash A5 M NaCl200 ul0.1 M
Wash B5 M NaCl200 ul0.1 M
0.5 M EDTA20 ul0.001 M
0.5 M EDTA10 ul0.0005 M
100% Tween 205 ul0.05%
20% SDS250 ul0.5%
Ultrapure water7.635 mlna
0.5 M EDTA20 ul0.001 M
100% Tween 205 ul0.05%
20% SDS250 ul0.5%
Ultrapure water9.425 mlna
Ultrapure water9.9 mlna
0.5 M EDTA20 ul0.001 M
100% Tween-205 ul0.05%
Ultrapure water9.675 mlna
100% Tween 205 ul0.05%
Ultrapure water9.895 mlna
Ultrapure water990 ulna
Ultrapure water980 ulna
100% Tween 2025 ul0.05%
Ultrapure water49.375 mlna
DMSO997.5 ulna
DMSO4 mlna
100 mM dTTP100 ul25 mM
100 mM dCTP100 ul25 mM
100 mM dGTP100 ul25 mM

Before resuspending oligos, pulse centrifuge to collect the pellet at the bottom of the tube. Add the appropriate buffer (see Materials) and vortex thoroughly. Store at -20 deg C. Dilute out the working concentrations (below) and store at -20 deg C when not in use. Thaw on ice. Vortex and pulse centrifuge after each thaw. Before beginning library preparation, make sure you have enough of each working stock prepared!


Note
Note: Do not store oligos and adapters in the same box as enzymes or reagents!

The standards should be diluted in a totally different space, such as a teaching lab to ensure it does not contaminate the lab at extremetly high concentration.

Also take extreme care with the positive control oligo as it will become a template for library preparation!


Working stockReagentVolume to add
10 uM CL104100 uM CL10450 ul
TET buffer450 ul
0.1 uM CL10410 uM CL1045 ul
TET buffer495 ul
0.1 uM CL104 1/5000.1 uM CL1041 ul
(i.e., 0.0002 uM)TET buffer499 ul
10 uM IS7100 uM IS750 ul
Ultrapure water450 ul
10 uM IS8100 uM IS850 ul
Ultrapure water450 ul
10 uM CL107100 uM CL10750 ul
Ultrapure water450 ul
10 uM CL108100 uM CL10850 ul
Ultrapure water450 ul
10 uM CL105_106_STD100 uM CL105_106_STD50 ul
TET buffer450 ul
10^11 copies CL105_106_STD10 uM CL105_106_STD10 ul
TET buffer592.25 ul
10^10 copies CL105_106_STD10^11 copies CL105_106_STD50 ul
TET buffer450 ul
10^9 copies CL105_106_STD10^10 copies CL105_106_STD50 ul
TET buffer450 ul
10^8 copies CL105_106_STD10^9 copies CL105_106_STD50 ul
TET buffer450 ul
10^7copies CL105_106_STD10^8 copies CL105_106_STD50 ul
TET buffer450 ul
10^6 copies CL105_106_STD10^7copies CL105_106_STD50 ul
TET buffer450 ul
10^5 copies CL105_106_STD10^6 copies CL105_106_STD50 ul
TET buffer450 ul
10^4 copies CL105_106_STD10^5 copies CL105_106_STD50 ul
TET buffer450 ul
10^3 copies CL105_106_STD10^4 copies CL105_106_STD50 ul
TET buffer450 ul
10^2 copies CL105_106_STD10^3 copies CL105_106_STD50 ul
TET buffer450 ul



Pre-program the thermal cycler and thermalshaker.
Purify and ligate adapters
1h
Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
CL7820 ul200 uM20 uM2 ul
T4 RNA ligase buffer20 ul10 X1 X2 ul
Klenow fragment20 ul10 U/ul0.5 U/ul1 ul
T4 PNK20 ul10 U/ul0.5 U/ul1 ul
Ultrapure water20 ulnana14 ul

Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge.

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
Splinter20 ul100 uM40 uM8 ul
T4 RNA ligase buffer20 ul10 X1 X2 ul
Klenow fragment20 ul10 U/ul0.5 U/ul1 ul
T4 PNK20 ul10 U/ul0.5 U/ul1 ul
Ultrapure water20 ulnana8 ul

Incubate both reactions for 20 minutes at 37 deg C, followed by 1 min at 95 deg C in a thermal cycler with heated lid.
Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge. This makes 10/20 uM of CL78/Splinter (DS1).

ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
CL78 (purified)40 ul20 uM10 uM20 ul
Splinter (purified)40 ul40 uM20 uM20 ul

Combine the following in a 0.2 ml Lo-bind PCR tube. Vortex and pulse centrifuge. This makes 200 uM of CL53/CL73 (DS2).


ReagentV2 (reaction volume)C1 (stock concentration)C2 (concentration in reaction)V1 (volume to add)
CL5350 ul500 uM200 uM20 ul
CL7350 ul500 uM200 uM20 ul
TE buffer50 ulnana9.5 ul
NaCl50 ul5 M0.05 M0.5 ul

Incubate for 10 sec at 95 deg C, followed by a ramp down to 10 deg C at 0.1 deg C/sec in a thermal cycler with a heated lid.

Add 50 ul of TE buffer to DS2 to make 100 uM of DS2 (CL53/CL73).
Dephosphorylation, heat denaturation, and ligation of first adapter
1h 15m

Note
Note: on personal recommendation, I do not do the cleavage at abasic sites step using Endonuclease VIII as in Gansauge and Meyer (2013).

I also do not perform UDG treament as I find it beneficial to see the damage patterns in ancient DNA as a gauge of authenticity. However, some people prepare two libraries, one UDG treated and other other not.

Set a heat block or thermal shaker to 45 deg C and set another thermal shaker to 35 deg C.
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.



ReagentV2C1C2V1x _______ rxn
T4 RNA ligation buffer46 ul10 X1.74 X8 ul
Tween 2046 ul2 %0.087%2 ul
FastAP46 ul1 U/ul1 U1 ul
Ultrapure water46 ulnana23 ul

Aliquot 34 ul per reaction into a 0.2 ml Lo-bind PCR tube.
To make the total reaction volume up to 46 ul, add:

Up to 12 ul DNA to each sample reaction. Make up the remainder with Ultrapure water. Typically input 3x10^8 - 3x10^11 double-stranded molecules; 1 fmol-1pmol single-stranded DNA; 13 pg-14 ng of ca. 40 bp DNA--this is typically 20% of the extract.

1 ul of 0.1 uM CL104 positive control oligo to the positive conrol reaction + 11 ul Ultrapure water. We are inputing 3.01x10^10 molecules of single-stranded CL104 into the library preparation.

12 ul of Ultrapure water to the no-template control reaction.
Incubate for 10 min at 37 deg C in a thermal cycler with a heated lid followed by 2 min at 95 deg C. Place immediately into an ice water bath.
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.


ReagentV2C1C2V1x _______ rxn
PEG-800080 ul50%20%32 ul
ATP80 ul100 mM0.5 mM0.4 ul
DS1 (CL78/Splinter)80 ul10/20 uM0.125/0.25 uM1 ul
T4 DNA ligase80 ul30 U/ul30 U1 ul

Aliquot 34.4 ul to the reactions from Step 19. Vortex and pulse centrifuge.
Incubate 1 hr at 37 deg C in a thermal cycler, followed by 1 min at 95 deg C. Transfer immediately to ice.


Note
While incubating, you can make up the wash buffers if they have not been prepared earlier.

Pause point: Reactions can be frozen at -20 deg C for several days before proceeding. If you proceed immediately, skip Step 30 below.
Immobilisation of ligation products on bead
30m
Allow MyOne C1 Streptavidin beads to come to room temperature. Vortex.
For every sample (including controls) aliquot 20 ul of MyOne C1 Streptavidin beads to a 1.5 ml Lo-bind tube. Include 20 ul extra for pipetting error. (e.g., if you have 5 samples + 2 controls, aliquot 160 ul of beads).

Note
Note that I have heard some find that beads do not stick well to Lo-bind tubes; I have not personally had an issue with this using a Dynamag, but if there is an issue, use non-Lo-bind tubes.

Allow the beads to separate from solution on a magnetic rack for 1-2 minutes. Discard the supernatant. Add 500 ul of Bead Binding Buffer. Vortex.


Note
Do not forget to add the SDS to the Bead Binding Buffer directly before use.

Repeat Step 26.
Discard the supernatant. Resuspend beads in 250 ul Bead Binding Buffer per sample including controls and pipetting error (e.g., if you have 5 samples + 2 controls, resuspend the beads in 2 ml of Bead Binding Buffer). Pipette up and down gently to resuspend to avoid generating excessive bubbles.
Aliquot 250 ul of bead suspension to new 1.5 ml Lo-bind Safelock tubes (1 per sample + controls).
Incubate ligation reactions from Step 22 for 1 min at 95 deg C and transfer to an ice water bath for 2-5 min.


Note
Remember to skip this step if you did not pause at Step 23.

Add the ligation reactions from Step 22 to the bead suspension. Vortex.
Incubate for 20 min at room temperature with inversion. Pulse centrifuge.

Note
Note that this step can be performed in a rotating hybridisation oven at room temperature or using a nutator / rocker.

Pellet the beads with the magnetic rack and discard the supernatant.
Add 200 ul of Wash A to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Add 100 ul Stringency Wash Buffer. Vortex. Incubate 3 min at 45 deg C in a heat block (or thermal shaker), vortexing every 30 sec. Pulse centrifuge. Pellet beads with a magenetic rack and discard the supernatant.

Note
While the samples are incubating, you can begin to make up the master mix at Step 38.

Set the heat block to 65 deg C so it has time to heat up before needed.

Note
Note that if you have several thermal shakers and heat blocks, these can all be pre-set to avoid having to wait for temperatures to change. Heat blocks take a very long time to cool down, so thermal shakers are preferred.

Add 200 ul of Wash B to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Primer annealing and extension
45m
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.



ReagentV2C1C2V1x _______ rxn
Ultrapure water48 ulnana39.1 ul
Klenow reaction buffer48 ul10 X1.04 X5 ul
dNTPs48 ul25 mM0.21 mM0.4 ul
Tween 2048 ul1%0.052 %2.5 ul
CL13048 ul100 uM2.083 uM1 ul

Add 48 ul of the master mix to each reaction from Step 37. Vortex and pulse centrifuge.
Incubate 2 min at 65 deg C in a heat block (or thermal shaker), and place immediately in an ice water bath for 2-5 min. Transfer the rack to room temperature.
Set the heat block back to 45 deg C so that it has time to cool down before needed.
Add 2 ul of Klenow fragment (10 U/ul) to the reactions from Step 40. Vortex and pulse centrifuge.
Incubate 5 min at 25 deg C (or room temperature), followed by 25 min at 35 deg C in a thermo shaker, with shaking at 1000 rpm. Do not allow beads to settle.
Remove the reactions and pellet the beads on a magnetic rack. Set the thermo shaker to 22 deg C.
Post-extension washes
10m
Add 200 ul of Wash A to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Add 100 ul Stringency Wash Buffer. Vortex. Incubate 3 min at 45 deg C in a heat block (or thermal shaker), vortexing every 30 sec. Pulse centrifuge. Pellet beads with a magenetic rack and discard the supernatant.
Add 200 ul of Wash B to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Ligation of second adapter
1h 5m
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.


ReagentV2C1C2V1x _______ rxn
Ultrapure water100 ulnana73.5 ul
T4 DNA ligase buffer100 ul10 X1 X10 ul
PEG-4000100 ul50%5%10 ul
Tween 20100 ul1%0.025%2.5 ul
DS2 (CL53/CL73)100 ul100 uM2 uM2 ul
T4 DNA ligase100 ul5 U/ul0.1 U/ul2 ul

Add 100 ul of master mix to each tube. Vortex and pulse centrifuge.
Incubate for 1 hr at 22 deg C in the thermo shaker, shaking at 1000 rpm.

Note
Note: if the shaker has not cooled to 22 deg C yet, perform this step by hand vortexing at room temperature until the shaker is cool.

Remove samples and set shaker to 95 deg C. Pellet the beads in a magnetic rack and discard the supernatant.
Post-ligation washes
10m
Add 200 ul of Wash A to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Add 100 ul Stringency Wash Buffer. Vortex. Incubate 3 min at 45 deg C in a heat block (or thermal shaker), vortexing every 30 sec. Pulse centrifuge. Pellet beads with a magenetic rack and discard the supernatant.
Add 200 ul of Wash B to each sample. Vortex. Pulse centrifuge. Pellet beads with a magnetic rack and discard the supernatant.
Elution of the final library
5m
Add 25 ul EBT buffer to each sample. Vortex and pulse centrifuge.
Incubate for 2 min at 95 deg C in a thermo shaker (without shaking).
Transfer tubes immediately to the magnetic rack and pellet the beads. Transfer the supernatant to a clean 0.5 ml Lo-bind tube.
Create a 1in20 dilution of each library in Ultrapure water (1 ul library + 19 ul Ultrapure water). Vortex and pulse centrifuge.
Libraries can be stored at -20 deg C until amplification. For long-term storage, store at -80 deg C.
Quant the library
2h 30m
Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.



ReagentV2C1C2V1x _______ rxn
Ultrapure water25 ulnana15.9 ul
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
IS725 ul10 uM0.2 uM0.5 ul
IS825 ul10 uM0.2 uM0.5 ul
Assay A master mix

Make up the following master mix in a 1.5 ml Lo-bind tube. Vortex and pulse centrifuge.

ReagentV2C1C2V1x __16___ rxn
Ultrapure water25 ulnana15.9 ul254.4 ul
BSA25 ul10 mg /ml0.4 mg/ml1 ul16 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul40 ul
MgCl225 ul25 mM2.5 mM2.5 ul40 ul
dNTPs25 ul25 mM0.25 mM0.25 ul4 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul4 ul
SYBR Green25 ul5 X0.12 X0.6 ul9.6 ul
CL10725 ul10 uM0.2 uM0.5 ul8 ul
CL10825 ul10 uM0.2 uM0.5 ul8 ul
Assay B master mix

Add 24 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Add 1 ul of DNA sample to the corresponding PCR tubes according to the scheme below. Pulse centrifuge the tubes.
PCR NTCCL105_106_STD 10^3ssLib001 NeatssLib005 Neat
PCR NTCCL105_106_STD 10^3ssLib001 1in20ssLib005 1in20
CL105_106_STD 10^6CL105_106_STD 10^2ssLib002 Neat...etc.
CL105_106_STD 10^6CL105_106_STD 10^2ssLib002 1in20
CL105_106_STD 10^5ssCL104 +VE NeatssLib003 Neat
CL105_106_STD 10^5ssCL104 +VE 1in20ssLib003 1in20
CL105_106_STD 10^4ssNTC -VE NeatssLib004 Neat
CL105_106_STD 10^4ssNTC -VE 1in20ssLib004 1in20
Assay A Plate set-up

0.1 uM CL104 1/500CL105_106_STD 10^4
0.1 uM CL104 1/500CL105_106_STD 10^4
PCR NTCCL105_106_STD 10^3
PCR NTCCL105_106_STD 10^3
CL105_106_STD 10^6CL105_106_STD 10^2
CL105_106_STD 10^6CL105_106_STD 10^2
CL105_106_STD 10^5
CL105_106_STD 10^5
Assay B Plate set-up

Take the strip tubes to a post-PCR space. Place in thermal cycler and run the following program:

95 deg C for 10 min

Followed by 50 cycles of:
95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec
Electrophorese 10 ul of the PCR product from the libraries (not standards) and controls on a 2% agarose gel.


Protocol
2% Agarose Gel Electrophoresis
CREATED BY
Alicia Grealy

Make up 2 L of 1X TAE buffer:
50 ml of 40X TAE buffer
1950 ml of MilliQ water

Mix by inversion.
Using an electronic balance, weigh out 2.2 g of agarose powder on to a weigh boat using a spatula.
Note
Note that gel concentration can be adjusted. The more concentrated the gel, the greater the resolution of small fragment sizes.

Transfer the powder to a 200 ml conical flask.
Using the graduated measurng cylinder, measure out 110 ml of 1xTAE buffer. Add to the conical flask containing the agarose powder. Swirl the flask gently to mix.
Microwave the flask uncovered for 1 minute.

Safety information
A lid can loosly be placed over the flask but DO NOT tighten--allow steam to escape. Do not microwave for more than 1 minute at a time.

Do not fill flasks or beakers/Schott bottles more than half full with liquid!

Remove the flask from the microwave using oven mitts and swirl gently.
Safety information
The liquid is boiling! Use oven mitts to handle flask. Do not put your face over the opening to the flask as liquid can splash out!

Microwave the flask for a further minute but remove from the microwave if the agarose appears to boil excessively. Swirl to mix and examine near a light source to ensure the agarose has melted. Allow to cool for 5 minutes.
Place the gel casting tray into a rubber vice that will seal the ends tightly, or tape the ends with masking tape.
Place the assembly on a flat bench and use the spirit level to check it is level--adjust if needed.
Place a 20-well comb into the casting tray.
When the flask is cool to the touch, add 5 ul of SYBR Safe and swirl gently to mix. Avoid generating bubbles.
Safety information
Wait until the liquid is warm (not boiling) to cast the gel, or the tray may crack!

Pour the liquid gel slowly into the casting tray. Pop any bubbles that have formed using a clean pipette tip.
Let the gel set for 20-30 minutes at room temperature.
Allow residual gel to set in the flask, then scrape into the bin. Fill the flask half full with water and microwave until the water boils. Pour the water down the sink and clean the flask using a bottle brush.
When the gel is set, remove the combs gently.
Place the casting try and gel in the electrophoresis tank.
Fill the electrophoresis tank with 1 X TAE buffer to the fill line indicated on the tank.
Pipette 3 ul of 50 bp DNA ladder into the first well of the gel.

Note
The recommended volume will depend on the concentration of the ladder. Check the manufacterer's recommendations. If the ladder is not pre-mixed with loading dye, be sure to add 1-2 ul of loading dye before loading into the gel.

Place some Parafilm across a 96-well PCR plate rack and press down firmly to create small wells.
For each sample, pipette 1-2 ul of loading dye onto the Parafilm, taking care not to pierce the Parafilm.
Mix 10 ul of PCR product with the loading dye by pipetting gently up and down.

Transfer the 12 ul of PCR product/loading dye to the wells of the gel, taking care not to pierce the bottom of the well with the pipette tip.
Note
The volume each well can take will depend on the size of the comb used. Be sure not to overload the wells or product will float out the top of the well.

Place the lid on the gel tank and plug the electrodes into the appropriate power slots. Ensure the positive electrode is at the base of the gel.



Safety information
Take care when working with electricity and water!

Check electrical cords of all equipment and ensure none are damaged and that cords are not a tripping hazard. Do not use if the electrical cord is damaged in any way. Tag the instrument with warnings, make the area safe, and notify your line manager and anyone else in the immediate area that may be affected.

Use electrical equipment indoors only in an area free of explosive material, corrosive gas, powerful vibrations, direct exposure to sunlight, and temperature fluctuations. Use in a space where cables will not come into contact with liquids, be manually damaged, or interfere with other workplace operations.

Do not use electrical equipment with any other power adapter or cord than the one supplied.

Switch the power pack on a set the voltage to 80 V and the time to 1 hr and 10 min.
Note
Note that the voltage and time can be adjusted to suit what you are running on the gel. For amplicons (one small product), I will run the gel at 96 V for 30-40 min. For shotgun libraries, I will run the gel as above. The lower the voltage and longer it is run, the greater the separation of fragments will be.

Press 'Run' or 'Start' on the power pack and check to see that bubbles are rising from electrodes.
When the run is over, switch of the power pack, remove the lid, and remove the gel from the tank, taking care not to let it slide off the tray.
Safety information
Do not remove the lid to the electrophoresis tank until the power pack is switched off.

Place the gel on the UV transilluminator and photograph using the attached camera. Follow the manufactuerer's instructions to use the equipment.


Safety information
Take care working with UV. You should have UV safety training. Do not open the transilluminator while the UV is on! Use signage to warn others when the UV is on.

Discard the gel into a designated biohazard bin, and clean the UV dock with 70% ethanol.
Dispose of used tips into a designated sharps container.
Dispose of gel waste into a biohazard bag.
Used combs, beakers, flasks, and tray should be washed with warm water and placed on a rack to dry.
Gloves and chemical waste should be sealed in a biohazard bag for incineration.
Use the CT values from the qPCR to generate a standard curve for the standards in order to calculate how many template copies are present in each library. The positive control is used to calculate the efficiency of the library prep:

(# Copies of CL104 from Assay A / # copies CL104 from Assay B) * 100


Expected result
Library preparation efficiency should typically be between 30-70% according to Gansauge and Meyer (2013).

Molecule counts from the library preparation blank control should be less than 1x10^9, usually 1x10^8.

The relationship between input volume of DNA extract and out of library molecules should be linear. If it is not, either too much DNA was used for library preparation or the DNA extract is inhibited. Gansauge et al. (2017) recommend to create a few preps with various input amounts to determine this; however, most of the time, this is not feasible because it is expensive to prepare multiple libraries for one sample.

The Neat and 1in20 dilution of libraries should show be approximately 4.33 cycles apart. If they are not, there might be too much input DNA in the qPCR. Dilute futher and run the qPCR to get a more accurate estimate of library molecules.

Insert sizes typically range from 20-120 bp.

Indexing PCR will typically require 10-15 cycles of amplification.



This assay is also used to determine the number of cycles to give the indexing PCR, which needs to be stopped during the linear phase. See my library amplification protocol to proceed with the next step.
Index/amplify the library
2h 30m
Make up the following master mix in a 1.5 ml Lo-bind tube. Ensure to prepare enough master mix for 4 reactions per library plus pipetting error. Vortex and pulse centrifuge.

Note
Remember that each library will have it's own unique combination of forward and reverse indexing primers. Do not add these to the master mix, but add each to each reaction individually! Take great care not to cross-contaminate primers: only have one tube open at a time. Use qPCR tubes with individual capped lids (not strip lids!).

Note
Ideally, indexing combinations should never be reused in the lab. Be sure to follow Illumina's recommendations when chosing primer combinations (e.g., ensure adequate diversity in the bases, ensure each is at least 3 bp different from each other, don't use indexes that will begin with two dark cycles, etc.). For instance, the NextSeq cannot read "GG" a the start of an index (so indexes should not end in "CC" as they are sequenced in the reverse complement).


ReagentV2C1C2V1x _____ rxn
Ultrapure water25 ulnana10.9
BSA25 ul10 mg /ml0.4 mg/ml1 ul
ABI Gold PCR Buffer25 ul10 X1 X2.5 ul
MgCl225 ul25 mM2.5 mM2.5 ul
dNTPs25 ul25 mM0.25 mM0.25 ul
ABI Taq Gold DNA polymerase25 ul5 U/ul0.05 U/ul0.25 ul
SYBR Green25 ul5 X0.12 X0.6 ul
P5_indexing_primer25 ul10 uM0.2 uM0.5 ulDon't add to master mix
P7_indexing_primer25 ul10 uM0.2 uM0.5 ulDon't add to master mix


Add 19 ul of master mix to the corresponding PCR tubes. Pulse centrifuge the tubes.
Add 0.5 ul of the corresponding forward indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 0.5 ul of the corresponding reverse indexing primer to the appropriate reaction tube. Pulse centrifuge the tubes.
Add 5 ul of DNA sample to the corresponding reaction tubes according to the scheme below. Pulse centrifuge the tubes.

e.g.,
ssLib001ssLib003ssLib005
ssLib001ssLib003ssLib005
ssLib001ssLib003ssLib005
ssLib001ssLib003ssLib005
ssLib002ssLib004...etc.
ssLib002ssLib004
ssLib002ssLib004
ssLib002ssLib004

Note
These indexing reactions can be performed in larger reaction volumes using more of the library or indeed the entire library (as in Gansauge and Meyer 2013), and giving the reaction fewer PCR cycles. I am not sure which way would introduce less bias to the final results, but I feel that "putting all your eggs into one basket" may not be the best idea in case the reaction fails for an unforseen reason.

Take the strip tubes to a post-PCR space. Place in qPCR machine and run the following program:

95 deg C for 10 min
Followed by _________ cycles of:
95 deg C for 30 sec
60 deg C for 30 sec
72 deg C for 30 sec

Note
Note that the number of cycles to give should be determined based on the Assay A qPCR: stop while amplification is in the linear phase (before plateau). This PCR can be performed on a standard thermal cycler (and with your reagents of choice) but I prefer to run it on a qPCR as Assay A and B so I can monitor the amplification in real time. Ensure that you use a high-fidelity polymerase. You can use a proof-reading polymerase if doing standard PCR but do not use one with qPCR.

Purify the libraries
Pulse centrifuge the PCR tubes. Combine replicate PCR reactions into a 1.5 ml Lo-bine Safelock tube. Vortex and pulse centrifuge.
Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 1.6X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:

https://www.gelifesciences.co.jp/catalog/pdf/SeraMagSelect_UserGuide.pdf

Elute in 35 ul of Ultrapure water.
Quantitate the libraries
Dilute the libraries 1 in 10 in Ultrapure water (i.e., 1 ul library in 9 ul Ultrapure water).
Use a LabChip GXII or equivalent fragment analyser (HiSense kit) to measure the molarity of the libraries between 160-500 bp.


Expected result
Libraries will be insert size + 136 bp, so the smallest fragments of interest will be ca. 166 bp (30 bp insert).

Pool libraries
Pool libraries in equimolar concentrations such that the total amount of DNA per library does not exceed 500-1000 ng.
Note
If you are proceeding directly with hybridisation capture, STOP HERE and move to (e.g.) the protocol below. Try to pool libraries such that the total amount of DNA per library does not exceel 500 ng (the recommended input amount per capture).

Use a Vivaspin 500 (MWCO 30,000 Da) centrifugal column to concentrate each library to 20-40 ul. Centrifuge at 15,000 rcf with the membrane facing outwards for 30 sec at a time.


Alternatively, concentrate the libraries using a SpeedyVac system, following the manufacturer's instructions.

Size select and purify
Run each pool in duplicate across two lanes (20 ul each) of a PippinHT electrophoresis system (2% gel, Marker 20B), selecting fragments between 160-500 bp and following the manufacturer's instructions:

Combine replicates. Purify the libraries using SeraMag Speed Beads or SeraMag Select using a 2X beads : reaction volume (i.e., 160 ul). Follow the guidelines below:


Elute in 25 ul of Ultrapure water.
Quantitate the final library
Dilute the libraries 1/2, 1/5, 1/10 in Ultrapure water (i.e., create a serial dilution in 10 ul volume).
Measure the concentration of the neat library and these dilutions in duplicate on the Qubit following the manufacturer's instructions.

Measure the molarity of the neat library and dilutions on a LabChip GXII Hisense kit (or equivalent fragment analyser) following the manufacturer's instructions:

Based on the average fragment length and Qubit measurement, calculate the molarity of the library dilutions. Create a standard curve to check that the concentrations are linear. If they can be "trusted", extrapolate the neat concentration based on the dilutions. Average all the measurements of the neat concentration to get the best estimate of the library molarity.
Sequencing
Dilute the library to between 2-4 nM in Ultrapure water.
Note
Note you will need CL72_custom_sequencing_primer to sequence. This can be spiked into well 12 (but select 'no custom primer' in the run set up) or into well 18 (select 'custom primer' in the run set up). Spiking the custom primers into the run is preferable so that the remaining Illumina primers are present and can sequence PhiX.

You do not need custom i5_indexing_primer to sequence off a MiSeq or NovaSeq because these instruments prime off P5. You do not need a custom i7 indexing primer because it uses primers already included in the kit. Note that for the NextSeq you will need custom i5_indexing_primer in addition to the CL72_custom_sequencing_primer.

Follow the manufacturer's instructions to perform the sequencnig run on your platform of choice.