Feb 01, 2026

Public workspaceSplit-seq with CROP-like gRNA

DOI
https://dx.doi.org/10.17504/protocols.io.dm6gp1x6dgzp/v1
  • Ronghao Zhou1,
  • Tri Nguyen1,
  • Jesse Engreitz1
  • 1Stanford
Ronghao Zhou
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.dm6gp1x6dgzp/v1
Protocol Citation: Ronghao Zhou, Tri Nguyen, Jesse Engreitz 2026. Split-seq with CROP-like gRNA. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gp1x6dgzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 30, 2026
Last Modified: February 01, 2026
Protocol Integer ID: 242361
Keywords: seq with crop, cell rna, transcriptome, like rna polymerase ii transcript, like rna polymerase, rna polymerase ii transcript, crispr, using split, seq combinatorial indexing, seq, split, scalable profiling without droplet, transcript, same cell
Disclaimer
Abstract
Single-cell RNA sequencing is performed using Split-seq combinatorial indexing, enabling scalable profiling without droplets. Both the transcriptome and CRISPR guide identity are captured from the same cell via a CROP-like RNA polymerase II transcript.
Attachments
Icon for Split seq primers.xlsx
Split seq primers.xl...
89KB
Icon for Molecular Chemistry.pdf
Molecular Chemistry....
1.6MB
Troubleshooting
Cell Fixation (Formaldehyde with BS3)
-        set swing bucket centrifuge to 4ºC
-        thaw BS3 powder (Thermo A39266) to room temp for at least 45min 
-        prepare per sample, keep on ice
o  1X PBS + RNase Inhibitor: 
4mL PBS + 10µL Protector (Sigma 3335399001) + 10µL Enzymatics (Y9240L)
o   0.5X PBS + RNase Inhibitor: 0.5mL 1X PBS+RI + 0.5mL H2O
1.     Prepare cells (up to 1M cells, at least 500k) in single cell suspension, put on ice, count 
2.     Centrifuge at 300g at 4ºC for 5min, remove supernatant
3.     Resuspend cells in 187.5µL cold 1X PBS+RI
4.     Pipette cells through a 40µm strainer into a new tube, keep on ice
-        for cells larger than 40µm, can use 70µm or 100µm strainer instead
-        press pipette tip directly against strainer with force
5.     Add 12.5µL fresh 16% Formaldehyde (for final 1%, Thermo 28906) to fix, mix by pipetting 3x, incubate on ice for 10min
-        additional mixing will lead to more doublets
6.     Add 4µL 10% Triton (for final 0.2%, Sigma T8787) to permeabilize, mix by pipetting 5x, incubate on ice for 3min
7.     Add 40µL 1M Tris (Thermo AM9856), and 1mL 1X PBS+RI
8.     Centrifuge at 500g at 4ºC for 5min, remove supernatant 
9.     Resuspend cells in 240µL 1X PBS+RI
10.  Immediately before use, resuspend BS3 in water for 50mM final: 2mg BS3 + 70µL H2O
-        reconstituted BS3 quickly hydrolyzes in water, use immediately
11.  Add 10µL 50mM BS3 to resuspended cells, incubate on ice for 20min
12.  Add 5µL 10% Triton, incubate on ice for 3min
13.  Add 50µL 1M Tris, and 1mL 1X PBS+RI
14.  Centrifuge at 500g at 4ºC for 5min, remove supernatant
15.  Resuspend in 150µL 0.5X PBS+RI
16.  Pass cells through a 40µm strainer into a new tube, keep on ice
17.  Count the number of cells, keep cells on ice during counting and proceed quickly to minimize the time fixed cells are out
18.  To freeze cells: 
1)    add 2.5µL DMSO, gently flick tube 3x to mix, incubate on ice for 1min
2)    repeat twice to add a total of 7.5µL DMSO
3)    mix the final suspension by gently pipetting 5x with P200 pipette without creating bubbles 
o   do NOT vortex cells
4)    split into aliquots (no more than 500k cells per aliquot)
5)    store in Mr. Frosty (cooling at -1ºC/min) at -80ºC
-       Stop: can store at -80ºC 
Prepare Barcodes and Reagents
-       to barcode 100k cells, load ~400k cells (~4X) for Round1 RT
-       to sequence 100k cells, need at least 1M (10X) barcode combinations: 24x96x96 = 220k combinations after 3 rounds of barcoding, and need at least 5 sublibraries
 
1.     Generate 3 barcoding stock plates
-        oligos
o   RT Barcode Plate (100µM, /5Phos/ACTGTGG-N8-polyT or -random_hexamer or -direct_capture) 
o    Round2 Barcode Plate (100µM, /5Phos/CATCGGCGTACGACT-N8-ATCCACGTGCTTGAG)
o    Round3 Barcode Plate (100µM, /5Biosg/CAGACGTGTGCTCTTCCGATCT-N10-N8-GTGGCCGATGTTTCG)
o    Round2 Linker (1mM, CCACAGTCTCAAGCACG)
o    Round2 Blocking (1mM, CGTGCTTGAGACTGTGG)
o    Round3 Linker (1mM, TACGCCGATGCGAAACATCG)
o    Round3 Blocking (1mM, GTGGCCGATGTTTCGCATCGGCGTACGACT)
-        prepare:
o   25mM NaCl to help annealing: 250µL 5M NaCl (Thermo J60434) + 49.75mL H2O

1)    Round1 RT barcode stock plate: 12.5µM polyT + 12.5µM random hexamer
+ 6µM direct capture per well
o   12.5µL polyT + 12.5µL random hexamer + 6µL direct capture + (fill to 100µL) H2O
2)    Round2 ligation stock plate: 12µM Round2 Barcode + 11µM Round2 Linker per well
o   overshot for 120 wells:   132µL (1.1µLx120) Round2 Linker (1mM)
+ 10.428mL (86.9µLx120) H2O (with 25mM NaCl)
o   88µL diluted Round2 Linker + 12µL Round2 Barcode (100µM) per well
3)    Round3 ligation stock plate: 14µM Round3 Barcode + 13µM Round3 Linker per well
o   overshot for 120 wells:   156µL (1.3µLx120)  Round3 Linker (1mM)
+ 10.164mL (84.7µLx120) H2O (with 25mM NaCl)
o   86µL diluted Round3 Linker + 14µL Round3 Barcode (100µM) per well
4)    Anneal Round2 and Round3 ligation plates of Barcode+Linker
TempTime
95ºC2min
cool down to 25ºC at -0.1ºC/s 
25ºC10min
4ºCHold
-        each Split-seq experiment only requires 8µL/well of RT Barcode and 10µL/well of Round2 and Round3 Barcode+Linker, store stock plates in -20ºC

2.     Prepare Reverse Transcription Mix:
ABCDEFG
  StorageVolume per well24+4 wells48+7 wells96 + 9 wells
Maxima H Minus RT (200U/µL)Thermo EP0753-20ºC2µL56µL110µL210µL
5X RT Buffer-20ºC8µL224µL440µL840µL
dNTP (10mM)NEB N0447L-20ºC2µL56µL110µL210µL
Protector RNase Inhibitor (40U/µL)Sigma 3335399001-20ºC0.5µL14µL27.5µL52.5µL
Enzymatics RNase Inhibitor (40U/µL)Enzymatic Y9240L-20ºC0.5µL14µL27.5µL52.5µL
H2O room5µL140µL275µL525µL
Total18µL504µL990µL1890µL
3.     Prepare 3 barcoding plates for experiment
-        can prepare in advance, then store at -20ºC
1)    Round1 plate:
o   18µL Reverse Transcription Mix + 8µL primer mix from Round1 RT barcode stock plate
o   final volume should be 26µL per well, will add 14µL cells for total 40µL RT reaction
 
2)    Round2 and Round3 plates: 
o   10µL Barcode+Linker from Round2 and Round3 ligation stock plates

4.     Prepare Spin Additive: 10% Triton X-100
-        1mL Triton X-100 (Sigma T8787, room temp) + 9mL H2O, store at 4ºC

5.     Prepare Dilution Buffer: 0.5X PBS + RNase Inhibitor
-       can be prepared in advance, then store at -20ºC, keep on ice after thaw
ABCD
  StorageVolume
10X PBSThermo AM9625room100µL
Protector RNase Inhibitor (40U/µL)Sigma 3335399001-20ºC7.5µL
Enzymatics RNase Inhibitor (40U/µL)Enzymatic Y9240L-20ºC7.5µL
H2O room1.9mL
Total2mL

6.     Prepare Resuspension Buffer: NEBuffer r3.1 + RNase Inhibitor
-       can be prepared in advance, then store at -20ºC, keep on ice after thaw
ABCD
  StorageVolume
10X NEBuffer r3.1NEB B6003S-20ºC200µL
Protector RNase Inhibitor (40U/µL)Sigma 3335399001-20ºC20µL
Enzymatics RNase Inhibitor (40U/µL)Enzymatic Y9240L-20ºC20µL
H2O room1.8mL
Total2.04mL

7.     Prepare Ligation Mix: T4 Ligase + BSA + RNase Inhibitor
-        for 96 wells, 2.04mL total
-        if want to prepare in advance, do NOT add T4 DNA Ligase, store at -20ºC
ABCD
  StorageVolume
T4 DNA Ligase (2,000U/µL)NEB M0202M-20ºC20µL
10X T4 Ligase BufferNEB B0202S-20ºC500µL
BSA (Recombinant Albumin, 20mg/mL)NEB B9200S-20ºC50µL
Protector RNase Inhibitor (40U/µL)Sigma 3335399001-20ºC40µL
Enzymatics RNase Inhibitor (40U/µL)Enzymatic Y9240L-20ºC40µL
H2O room1.39mL
Total2.04mL

8.     Prepare Round2 Stop Mix: 26.4µM Round2 Blocking
-       can be prepared in advance, then store at -20ºC, keep on ice after thaw
-        37µL Round2 Blocking (1mM) + 350µL 10X Ligase Buffer + 1013µL H2O -> total 1.4mL

9.     Prepare Round3 Stop Mix: 11.5µM Round3 Blocking, 125mM EDTA
-       can be prepared in advance, then store at -20ºC, keep on ice after thaw
-        37µL Round3 Blocking (1mM) + 800µL 0.5M EDTA + 2363µL H2O -> total 3.2mL

10.  Prepare Pre-Lyse Wash Buffer: 0.1% Triton X-100/PBS + RNase Inhibitor
-       can be prepared in advance, then store at -20ºC, keep on ice after thaw
ABCD
  StorageVolume
10X PBSThermo AM9625room400µL
10% Triton X-100Sigma T8787room40µL
Protector RNase Inhibitor (40U/µL)Sigma 3335399001-20ºC10µL
Enzymatics RNase Inhibitor (40U/µL)Enzymatic Y9240L-20ºC10µL
H2O room3.6mL
Total4.06mL
Barcoding Single Cells
-        use swing bucket centrifuge for all spins, fixed-angle centrifuge will lead to substantial cell loss
-        use polypropylene tubes, polystyrene tubes will lead to substantial cell loss
-        maximize cell retention during pooling by pipetting up and down several times (in the middle and on the front & back sides) in each well before pooling
-        avoid excess bubble formation (not affect quality) by pipetting up and down with pipette set to 10µL less volume, pooling, then collecting any remaining liquid
 
1.     Thaw Round1, Round2, Round3 plates in a thermocycler
o   Lid Temperature: 70ºC
o   Reaction Volume: 26µL for Round1, 10µL for Round2 & Round3
TempTime
25ºC10min
4ºCHold

2.     Sample Counting and Loading Setup
1)    thaw fixed cell samples at 37ºC until all ice crystals dissolve, then put on ice
o   important to fully thaw samples before placing on ice
2)    count the number of cells in each sample
3)    dilute samples with Dilution Buffer (0.5X PBS + RNase Inhibitor), put on ice

3.     Round1 Reverse Transcription Barcoding
1)    centrifuge Round1 plate at 100g for 1min, put on ice
2)    add 14µL diluted cells to each well of Round1 plate according to the Loading Table; immediately after adding cells, mix gently by pipetting up and down exactly 3x
o   when pipetting same sample into many wells, periodically mix sample by gentle pipetting to avoid cell settling; do NOT vortex cells
o   use different tips when pipetting cells into each well
3)    reverse transcription (~40min)
o   Lid Temperature: 70ºC
o   Reaction Volume: 40µL (14µL cells + 18µL RT Mix + 8µL Primer Mix)
ABC
CyclesTempTime
150ºC10min
38ºC12s
15ºC45s
20ºC45s
30ºC30s
42ºC2min
53ºC3min
153ºC5min
155ºC5min
14ºCHold
4)    pool all wells from Round1 Plate into a 2mL tube on ice
o   set pipette to 30µL, mix up and down at least 3x on each side to retain settled cells
o   both Round1 Plate and 2mL tube with pooled cells should be kept on ice during pooling
5)    discard Round1 Plate
6)    add 9.6µL (for 24-well) or 19.2µL (for 48-well) Spin Additive (10% Triton X-100) for final concentration of 0.1% to the pooled cells, gently invert once to mix
7)    centrifuge the pooled cells at 200g at 4ºC for 10min in a swinging bucket
o   proceed to the next step immediately, avoid dislodging the cell pellet
8)    remove supernatant with P1000 and P200 pipettes, leave ~40µL of liquid
o   do not disturb the pellet
9)    gently resuspend with 1mL Resuspension Buffer (NEBuffer r3.1 + RNase Inhibitor), once cells are fully resuspended, add an additional 1mL for 2mL total, keep on ice

4.     Round2 Ligation Barcoding
1)    make sure 20µL T4 DNA Ligase (2,000U/µL) have been added to the Ligation Mix
o   do not vortex
2)    add 2mL of cells in Resuspension Buffer into 2.04mL Ligation Mix, mix 10x with P1000, keep on ice
3)    centrifuge Round2 Plate at 100g for 1min, keep at room temp
4)    add entirety of cells to a basin, add 40µL cell mix to each well of Round2 plate; as adding cells, pipetting up and down exactly 2x to ensure proper mixing
o   avoid cells settling in basin by gently pipetting up and down 2x before transferring cells
o   if volume is insufficient to fill every well, a few wells can be left empty
o   use different tips when pipetting cells into each well
5)    incubate at 37ºC for 30min while shaking (15s at 900RPM, 1min45s pause)
o   Lid Temperature: 50ºC
o   Reaction Volume: 50µL (40µL cell + 10µL R2 primer)
6)    vortex Round2 Stop Mix briefly, add all to a basin
7)    transfer Round2 Plate from thermocycler, keep at room temp
8)    add 10µL Round2 Stop Mix to each well of Round2 Plate, pipette up and down exactly 3x to ensure proper mixing
o   use different tips when pipetting Stop Mix into each well
9)    incubate at 37ºC for 30min while shaking (15s at 900RPM, 1min45s pause)
o   Lid Temperature: 50ºC
o   Reaction Volume: 60µL (40µL cell + 10µL R2 primer + 10µL R2 Stop)
10) transfer Round2 Plate from thermocycler, keep at room temp
11) pool all wells from Round2 Plate into a new basin
o   set pipette to 50µL, mix up and down at least 3x on each side to retain settled cells
12) discard Round2 Plate
13) pass all cells through a 40µm strainer into a new basin
o   press the tip of pipette against the filter to ensure all liquid passes

5.     Round3 Ligation Barcoding
-        keep on ice: T4 DNA Ligase (2,000U/µL, NEB M0202M, store at -20ºC)
1)    add 20µL T4 DNA Ligase (2,000U/µL) to the basin with strained cells, mix by gently pipetting up and down ~20x
2)    centrifuge Round3 Plate at 100g for 1min, keep at room temp
3)    add 50µL cell mix to each well of Round3 plate; as adding cells, pipetting up and down exactly 2x to ensure proper mixing
o   avoid cells settling in basin by gently pipetting up and down 2x before transferring cells
o   if volume is insufficient to fill every well, a few wells can be left empty
o   use different tips when pipetting cells into each well
4)    incubate at 37ºC for 30min while shaking (15s at 900RPM, 1min45s pause)
o   Lid Temperature: 50ºC
o   Reaction Volume: 60µL (50µL cell + 10µL R3 primer)
5)    vortex Round3 Stop Mix briefly, add all to a basin
6)    transfer Round3 Plate from thermocycler, keep at room temp
7)    add 20µL Round3 Stop Mix to each well of Round3 Plate, pipette up and down exactly 3x to ensure proper mixing
o   use different tips when pipetting Stop Mix into each well
o   no incubation required, proceed directly to pooling
8)    pool all wells from Round3 Plate into a new basin
o   set pipette to 70µL, mix up and down at least 3x on each side to retain settled cells
9)    discard Round3 Plate
10) pass all cells through a 40µm strainer into a new 15mL tube
o   press the tip of pipette against the filter to ensure all liquid passes
 
6.     Lysis and Sublibrary Generation
-        keep on ice: Proteinase K (20mg/mL, Thermo 25530049, store at -20ºC)
1)    prepare 2X Lysis Buffer: 20mM Tris, 400mM NaCl, 100mM EDTA, 4.4% SDS
o   can be prepared in advance, store at 4ºC, keep at 37ºC until use to dissolve precipitate
ABCD
  StorageVolume
1M Tris, pH8Thermo AM9856room20µL
5M NaClThermo J60434room80µL
0.5M EDTA, pH8Thermo 15575020room200µL
10% SDSSigma 71736room440µL
H2O room260µL
Total1mL
2)    add 60µL Spin Additive (10% Triton X-100) for final concentration of 0.1% to the pooled cells, gently invert once to mix
3)    centrifuge the pooled cells at 200g at 4ºC for 10min in a swinging bucket
4)    remove supernatant with P1000 and P200 pipettes, leave ~40µL of liquid
5)    gently resuspend with 1mL Pre-Lyse Wash Buffer (0.1% Triton X-100/PBS + RNase Inhibitor), pipette slowly to prevent mechanical damage to cells; once cells are fully resuspended, add an additional 3mL for 4mL total
6)    centrifuge the pooled cells at 200g at 4ºC for 10min in a swinging bucket
7)    remove supernatant with P1000 and P200 pipettes, leave ~40µL of liquid
8)    gently resuspend pellet with 100µL Dilution Buffer to bring the volume to ~100µL,     transfer to a 1.5mL tube, keep on ice
9)    set pipette to 80µL, gently pipette up and down 5x, immediately use 6µL to count
o   6µL cells + 6µL 2.4nM YOYO-1 (Thermo Y3601, 2.4µL 1mM stock + 997.6µL PBS, 4ºC)
o   some level of debris is normal
10) aliquot sublibraries, record sublibrary sizes and labels, add Dilution Buffer to 25µL, keep on ice
o   each sublibrary will have separate sequencing index
o   useful to have at least one sublibrary with few cells (200-500) with deep sequence (>50,000 reads per cell), this sublibrary provides good estimate of transcript detection per cell that would be expected if other sublibraries were also sequenced deeply
o   do not overload a sublibrary, 12,500 cells/sublibrary is the maximum
11) per sublibrary, add 25µL 2X Lysis Buffer and 5µL Proteinase K, keep at room temp
12) vortex for 10s to initiate lysis, briefly centrifuge
13) incubate at 65ºC for 60min while shaking (15s at 900RPM, 1min45s pause)
o   Lid Temperature: 80ºC
o   Reaction Volume: 55µL (25µL cell + 25µL Lysis Buffer + 5µL Proteinase K)
-       Stop: can store sublibrary lysates at -80ºC for up to 6 months
 
Amplification of Barcoded cDNA
1.     Prepare reagents
1)    prepare 2X Binding&Washing Buffer: 10mM Tris, 2M NaCl, 1mM EDTA
o   keep at room temp
ABCD
  StorageVolume
1M Tris, pH8Thermo AM9856room500µL
5M NaClThermo J60434room20mL
0.5M EDTA, pH8Thermo 15575020room100µL
H2O room29.4mL
Total50mL
2)    prepare Bead Wash Buffer: 0.05% Tween in 1X B&W
o   keep at room temp
ABCD
  StorageVolume
2X Binding&Washing Buffer room10mL
10% Tween20Sigma P9416room100µL
H2O room9.9mL
Total20mL
3)    prepare Bind Buffer A: 2X B&W + RNase Inhibitor
o   store at -20ºC, keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
2X B&W Buffer60120180240300360420480
Protector RNase Inhibitor12345678
4)    prepare Bind Buffer B: 0.05% Tween in 1X B&W + RNase Inhibitor
o   store at -20ºC, keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
Bead Wash Buffer30060090012001500180021002400
Protector RNase Inhibitor0.511.522.533.54
5)    prepare Bead Storage Buffer: 0.1% Tween in 10mM Tris + RNase Inhibitor
o   store at -20ºC, keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
10mM Tris, pH82004006008001000120014001600
10% Tween20246810121416
Protector RNase Inhibitor0.511.522.533.54

2.     Prepare Streptavidin beads
-        obtain: 
o   Streptavidin C1 beads (Thermo 65001, 4ºC)
1)    vortex Streptavidin beads, take (44µL x # sublibrary) beads to a 1.5mL tube
2)    put on magnet until liquid becomes clear (~2min), discard supernatant
3)    remove from magnet, resuspend with (100µL x # sublibrary) Bead Wash Buffer, ensure all beads are fully resuspended, not stuck to the side
4)    put on magnet until liquid becomes clear (~2min), discard supernatant
5)    repeat wash twice more for a total of three washes
6)    resuspend with (55µL x # sublibrary) Bind Buffer A, keep at room temp

3.     Apply Streptavidin beads to sublibrary lysates
-        obtain:
o   Lysis Neutralizer: 100mM PMSF (Thermo 36978, -20ºC): add isopropanol to dissolve, make sure at saturate level by still having white undissolved in the bottom
1)    remove sublibrary lysates from -80ºC, incubate at 37ºC for 5min, ensure no precipitate before proceeding, quick centrifuge sublibrary lysates
2)    per sublibrary, add 2.5µL Lysis Neutralizer (100mM PMSF), mix 5x (set to 40µL); quick centrifuge, incubate at room temp for 10min
3)    per sublibrary, add 50µL Streptavidin beads in Bind Buffer A, mix 5x (set to 90µL)
4)    incubate at 25ºC for 60min while shaking (30s at 1400RPM, 30s pause)
5)    quick centrifuge, put on magnet High until liquid becomes clear, discard supernatant
o   cDNA is unamplified, discarding any beads will result in reduction of transcripts detected
6)    resuspend beads with 125µL Bind Buffer B, keep at room temp for 1min
7)    put on magnet High until liquid becomes clear, discard supernatant
8)    repeat wash with 125µL Bind Buffer B
9)    resuspend beads with 125µL Bead Storage Buffer, keep at room temp for 1min

4.     Template Switch
-        oligo:
o   Split_TSO (100µM, /5dSp/AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG, order as RNA with HPLC purification)
-        obtain:
o   Maxima H Minus RT (200U/µL) and 5X RT Buffer (Thermo EP0753, -20ºC)
o   dNTP (10mM, NEB N0447L, -20ºC)
o   PEG 8000 (25% at -20ºC): from 5g powder (Sigma P5413) in H2O (~15mL) for total 20mL
1)    prepare Template Switching Mix:
o   keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
Split_TSO (100µM)2.24.46.68.81113.215.417.6
Maxima H Minus RT5.51116.52227.53338.544
5X RT Buffer22446688110132154176
dNTP (10mM)1122334455667788
PEG 8000 (25%)336699132165198231264
Protector RNase Inhibitor5.51116.52227.53338.544
H2O30.861.692.4123.2154184.8215.6246.4
Total110220330440550660770880
2)    put on magnet High until liquid becomes clear, discard supernatant
o   cDNA is unamplified, discarding any beads will result in reduction of transcripts detected
3)    without resuspending beads, add 125µL H2O, wait 1min, discard supernatant
4)    resuspend with 100µL Template Switch Mix, quick centrifuge
o   Template Switch Mix is viscous, ensure beads are fully resuspended before proceeding
5)    incubate at 25ºC for 30min while shaking (30s at 1400RPM, 30s pause)
6)    mix by pipetting 5x to resuspend settled beads, incubate at 42ºC for 90min while shaking
7)    optional: to help TSO RT extension (30min): 55ºC for 15min, 42ºC for 15min
 
5.     cDNA Amplification
-        oligo:
o   Split_Partial-TSO (100µM, AAGCAGTGGTATCAACGCAGAGT)
o   Split_TruSeq-Read2 (100µM, CAGACGTGTGCTCTTCCGATCT)
o   Split_hU6_outer (100µM, GGGCCTATTTCCCATGATTCCTTC)
-        obtain:
o   KAPA HiFi 2X Master Mix (Roche KK2602, -20ºC)
1)    prepare Amplification Reaction Solution:
o   keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
KAPA 2X MM55110165220275330385440
Split_Partial-TSO (100µM)0.511.522.533.54
Split_Read2 (100µM)0.511.522.533.54
Split_hU6_outer (100µM)0.511.522.533.54
H2O53.5107160.5214267.5321374.5428
Total110220330440550660770880
2)    mix by pipetting to resuspend settled beads, put on magnet High until liquid becomes clear, discard supernatant
3)    without resuspending beads, add 125µL H2O, wait 1min, discard supernatant
4)    resuspend with 100µL Amplification Reaction Solution, keep on ice
5)    incubate (~60min)
o   adjust the number of 2nd cycles based on number of cells in each sublibrary
o   Lid Temperature: 105ºC
o   Reaction Volume: 100µL
ABC
CyclesTempTime
195ºC3min
598ºC20s
65ºC45s
72ºC3min
12 for 200-1,000 cells 10 for 1,000-2,000 cells 8 for 2,000-6,000 cells 6 for 6,000-12,500 cells 1-2 additional for cells with low RNA98ºC20s
67ºC20s
72ºC3min
172ºC5min
14ºCHold
-       Stop: can store sublibrary at 4ºC overnight

6.     Post-Amplifcation SPRI Clean Up (0.8X)
-        prepare fresh 85% EtOH
1)    put on magnet High until liquid becomes clear
o   do NOT discard supernatant
2)    transfer 90µL clear supernatant to a new tube, discard original tubes with beads
3)    vortex SPRI, add 72µL SPRI (0.8X), brief vortex, incubate at room temp for 5min
4)    put on magnet High until liquid becomes clear, discard supernatant
5)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
6)    repeat wash with 85% EtOH
7)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 2min
o   do NOT over-dry beads as this will loss yield, cracking of beads is over-drying
8)    resuspend beads in 25µL H2O, incubate at 37ºC for 10min to maximize elution
9)    put on magnet Low until liquid becomes clear
10) transfer 25µL eluted cDNA to a new tube, discard original tubes with beads
11) measure the concentration of cDNA using Qubit dsDNA HS, record for Index PCR
12) run 1µL cDNA (1:10 dilution) on Bioanalyzer



-       Stop: can store at 4ºC for up to 2 days or -20ºC for up to 3 months
Preparing Gene Expression Libraries for Sequencing
1.     Gene Expression Fragmentation, End Repair, A-Tailing
-        obtain:
o   Fragmentation Enzyme: 5X WGS Fragmentation Mix (Enzymatics Y9410L)
o   Fragmentation Buffer: 10X Fragmentation Buffer (Enzymatics B0330L)
1)    brief vortex cDNA, quick centrifuge, take 10µL cDNA (at least 125ng in total), add 25µL H2O to bring total volume to 35µL, keep on ice
o   concentration based on Qubit, not Bioanalyzer
o   remaining cDNA can be stored at -20ºC 
2)    prepare thermal cycler (40min)
o   Lid Temperature: 70ºC
o   Reaction Volume: 50µL
StepTempTime
pre-cool4ºCHold
Fragmentation32ºC10min
End Repair & A-tailing65ºC30min
 4ºCHold
o   pre-cool block prior to preparing Fragmentation Mix
3)    prepare Fragmentation Mix:
o   confirm reagents fully thawed and mixed well before using
o   mix well by pipetting 10x, keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
Fragmentation Buffer5.51116.52227.53338.544
Fragmentation Enzyme1122334455667788
Total16.53349.56682.599115.5132
4)    add 15µL Fragmentation Mix, mix 10x (set to 40µL) on ice, quick centrifuge
5)    transfer to pre-cooled thermal cycler and press skip to initiate protocol

2.     Post-Fragmentation Double-Sided SPRI Selection (0.6X-0.8X)
1)    vortex SPRI, add 30µL SPRI (0.6X), brief vortex, incubate at room temp for 5min
2)    put on magnet High until liquid becomes clear
o   do NOT discard supernatant
3)    transfer 75µL clear supernatant to a new tube, discard original tubes with beads
4)    add 10µL SPRI (0.8X), brief vortex, incubate at room temp for 5min
5)    put on magnet High until liquid becomes clear, discard supernatant
o   this may take longer due to low volume of beads
6)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
7)    repeat wash with 85% EtOH
8)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 30s
o   only 30s due to small amount of beads, do NOT over-dry beads as this will loss yield
9)    resuspend beads in 50µL H2O, incubate at room temp for 5min to elute
10) put on magnet High until liquid becomes clear
11) transfer 50µL fragmented DNA to a new tube, discard original tubes with beads
-       Stop: can store at 4ºC overnight or -20ºC for up to 2 weeks

3.     Gene Expression Adapter Ligation
-        oligo:
o   Split_Adaptor_Top (100µM, ACACTCTTTCCCTACACGACGCTCTTCCGATC*T, *phosphorothioated)
o   Split_Adaptor_Bottom (100µM, GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT)
-        obtain:
o   Adaptor Ligase: WGS Ligase (Enzymatics L6030-W-L)
o   Adaptor Ligation Buffer: 5X Rapid Ligation Buffer (Enzymatics B9020L)
1)    anneal Adaptor Duplex:
o   per sublibrary:   2.5µL Split_Adaptor_Top + 2.5µL Split_Adaptor_Bottom (100µM) +
0.125µL 1M NaCl (final 25mM NaCl to help annealing) 
TempTime
95ºC2min
cool down to 25ºC at -0.1ºC/s 
25ºC10min
4ºCHold
2)    prepare Adaptor Ligation Mix:
o   confirm reagents fully thawed and mixed well before using
o   mix well by pipetting, keep on ice
ABCDEFGHI
 Volume (µL) for number of sublibraries
 12345678
Adaptor Ligation Buffer22446688110132154176
Adaptor Ligase1122334455667788
Adaptor Duplex5.51116.52227.53338.544
H2O16.53349.56682.599115.5132
Total55110165220275330385440
3)    add 50µL Adaptor Ligation Mix to 50µL fragmented DNA, mix 10x (set to 80µL), quick centrifuge
4)    incubate (15min)
o   Lid Temperature: 30ºC
o   Reaction Volume: 100µL
StepTempTime
120ºC15min
24ºCHold
o   proceed directly to next step, do NOT leave in thermal cycler for longer than indicated 

4.     Post-Ligation SPRI Clean Up (0.8X)
1)    vortex SPRI, add 80µL SPRI (0.8X), brief vortex, incubate at room temp for 5min
2)    put on magnet High until liquid becomes clear, discard supernatant
3)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
4)    repeat wash with 85% EtOH
5)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 3min
o   do NOT over-dry beads as this will loss yield
6)    resuspend beads in 23µL H2O, incubate at room temp for 5min to elute
7)    put on magnet Low until liquid becomes clear
8)    transfer 21µL eluted DNA to a new tube, discard original tubes with beads

5.     Gene Expression Sublibrary Index PCR
-        oligo:
o   Split_P5 (10µM, AATGATACGGCGACCACCGAGATCTACAC-N6-ACACTCTTTCCCTACACGACGC)
o   Split_P7 (10µM, CAAGCAGAAGACGGCATACGAGAT-N6-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
-        obtain:
o   KAPA HiFi 2X Master Mix (Roche KK2602, -20ºC)
1)    set up Index PCR per sublibrary on ice, record P5 & P7 index primer pairs used
o   confirm reagents fully thawed and mixed well before using
o   ensure no two sublibraries contain the same index primer pair
o   mix well by pipetting, keep on ice
AB
 Volume (µL) per sublibrary
KAPA 2X MM25
Split_P5 (10µM)2.5
Split_P7 (10µM)2.5
cDNA20
Total50
2)    incubate (~30min)
o   Lid Temperature: 105ºC
o   Reaction Volume: 50µL
o   adjust cycles depending on the amount of cDNA during fragment based on Qubit
ABC
CyclesTempTime
195ºC3min
13 for 10-24ng 12 for 25-49ng 11 for 50-99ng 10 for 100-299ng 8 for 300-999ng 7 for 1000+ng98ºC20s
67ºC20s
72ºC1min
172ºC5min
14ºCHold
-       Stop: can store at 4ºC overnight 

6.     Post-Amplification Double-Sided Size Selection (0.6X-0.8X)
1)    vortex SPRI, add 30µL SPRI (0.6X), brief vortex, incubate at room temp for 5min
2)    put on magnet High until liquid becomes clear
o   do NOT discard supernatant
3)    transfer 75µL clear supernatant to a new tube, discard original tubes with beads
4)    add 10µL SPRI (0.8X), brief vortex, incubate at room temp for 5min
5)    put on magnet High until liquid becomes clear, discard supernatant
o   this may take longer due to low volume of beads
6)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
7)    repeat wash with 85% EtOH
8)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 30s
o   only 30s due to small amount of beads, do NOT over-dry beads as this will loss yield
9)    resuspend beads in 20µL H2O, incubate at room temp for 5min to elute
10) put on magnet Low until liquid becomes clear
11) transfer 20µL eluted DNA to a new tube, discard original tubes with beads
12) measure the concentration of GEX sequencing library using Qubit dsDNA HS
13) run 1µL cDNA (1:10 dilution) on Bioanalyzer


o   there should be a peak between 400-500bp
-       Stop: can store at -20ºC for up to 3 months
 
Preparing CROP CRISPR Libraries for Sequencing
1.     CRISPR Feature PCR
-        oligo:
o   Split_hU6_inner (100µM,  ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACG)
o   Split_TruSeq-Read2 (100µM, CAGACGTGTGCTCTTCCGATCT)
-        obtain:
o   KAPA HiFi 2X Master Mix (Roche KK2602, -20ºC)
1)    obtain amplified cDNA, quick centrifuge, aliquot out 50ng cDNA (at least 10ng), add H2O to bring total volume to 25µL
2)    set up Feature PCR per sublibrary on ice
o   confirm reagents fully thawed and mixed well before using
o   expected size: 268bp (scaffold), 293bp (CS1), ~600bp (polyT)
 Volume (µL) per sublibrary
KAPA 2X MM25
Split_hU6_inner (100µM) 0.25
Split_TruSeq-Read2 (100µM)0.25
cDNA24.5
Total50
3)    incubate (~50min)
o   Lid Temperature: 105ºC
o   Reaction Volume: 50µL
ABC
CyclesTempTime
195ºC3min
598ºC20s
65ºC20s
72ºC1min
1398ºC20s
67ºC20s
72ºC1min
172ºC5min
14ºCHold
-       Stop: can store at 4ºC overnight 

2.     Post-Amplification Double-Sided Size Selection (0.5X-1X)
1)    vortex SPRI, add 25µL SPRI (0.5X), brief vortex, incubate at room temp for 5min
2)    put on magnet High until liquid becomes clear
o   do NOT discard supernatant
3)    transfer 70µL clear supernatant to a new tube, discard original tubes with beads
4)    add 25µL SPRI (1X), brief vortex, incubate at room temp for 5min
5)    put on magnet High until liquid becomes clear, discard supernatant
o   this may take longer due to low volume of beads
6)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
7)    repeat wash with 85% EtOH
8)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 30s
o   only 30s due to small amount of beads, do NOT over-dry beads as this will loss yield
9)    resuspend beads in 20µL H2O, incubate at room temp for 5min to elute
10) put on magnet Low until liquid becomes clear
11) transfer 20µL eluted DNA to a new tube, discard original tubes with beads
12) measure the concentration of CRISPR Feature PCR DNA using Qubit dsDNA HS
-       Stop: can store at 4ºC for up to 2 days or -20ºC for up to 3 months  

3.     CRISPR Sublibrary Index PCR
-        oligo:
o   Split_P5 (10µM, AATGATACGGCGACCACCGAGATCTACAC-N6-ACACTCTTTCCCTACACGACGC)
o   Split_P7 (10µM, CAAGCAGAAGACGGCATACGAGAT-N6-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
-        obtain:
o   KAPA HiFi 2X Master Mix (Roche KK2602, -20ºC)
1)    obtain post Feature PCR cDNA, quick centrifuge, aliquot out 10ng cDNA, add H2O to bring total volume to 21µL
2)    set up CRISPR Index PCR per sublibrary, record P5 & P7 index primer pairs used
o   confirm reagents fully thawed and mixed well before using
o   ensure no two sublibraries contain the same index primer pair
o   expected size: 345bp (scaffold), 370bp (CS1), ~700bp (polyT)
AB
 Volume (µL) per sublibrary
KAPA 2X MM25
Split_P5 (10µM)2.5
Split_P7 (10µM)2.5
cDNA20
Total50
3)    incubate (~30min)
o   Lid Temperature: 105ºC
o   Reaction Volume: 50µL
ABC
CyclesTempTime
195ºC3min
998ºC20s
67ºC20s
72ºC1min
172ºC5min
14ºCHold

4.     Post-Amplification Double-Sided Size Selection (0.5X-0.9X)
1)    vortex SPRI, add 25µL SPRI (0.5X), brief vortex, incubate at room temp for 5min
2)    put on magnet High until liquid becomes clear
o   do NOT discard supernatant
3)    transfer 70µL clear supernatant to a new tube, discard original tubes with beads
4)    add 20µL SPRI (0.9X), brief vortex, incubate at room temp for 5min
5)    put on magnet High until liquid becomes clear, discard supernatant
o   this may take longer due to low volume of beads
6)    without resuspending beads, add 180µL 85% EtOH, wait 1min, discard supernatant
7)    repeat wash with 85% EtOH
8)    centrifuge briefly, put on magnet Low, remove remaining EtOH, dry for 30s
o   only 30s due to small amount of beads, do NOT over-dry beads as this will loss yield
9)    resuspend beads in 20µL H2O, incubate at room temp for 5min to elute
10) put on magnet Low until liquid becomes clear
11) transfer 20µL eluted DNA to a new tube, discard original tubes with beads
12) measure the concentration of CRISPR sequencing library using Qubit dsDNA HS
13) run 1µL cDNA (1:10 dilution) on Bioanalyzer
-       Stop: can store at -20ºC for up to 3 months
Sequencing
ABCD
  Gene ExpressionCRISPR gRNA
Sequencing Depth/cell30-50k read pairs2-5k read pairs
Library Pooling Ratio6-101
Recommended Number of CyclesRead 170ntat least 64nt
i7 Index 16nt6nt
i5 Index 26nt6nt
Read 286nt86nt