May 29, 2025

Public workspaceSOP for Macrocystis pyrifera specific qPCR V.1

 Forked from SOP Template
This protocol is a draft, published without a DOI.
  • Hannah Hampton1
  • 1Cawthron
Icon indicating open access to content
QR code linking to this content
Protocol CitationHannah Hampton 2025. SOP for Macrocystis pyrifera specific qPCR. protocols.io https://protocols.io/view/sop-for-macrocystis-pyrifera-specific-qpcr-gzahbx2b7
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: May 12, 2025
Last Modified: May 29, 2025
Protocol Integer ID: 218153
Keywords: Macrocystis pyrifera, Giant kelp, qPCR, quantitative PCR, eDNA, environmental DNA, sop for macrocystis pyrifera, macrocystis pyrifera in sediment sample, macrocystis pyrifera, quantitative pcr sop id, specific qpcr sop title, pcr, sediment sample, procedure for the detection, sop
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
SOP Title: Standard Operating procedure for the detection of Macrocystis pyrifera in sediment samples via quantitative PCR
SOP ID:
Division: May 2025, Cawthron Institue
Written by: Hannah Hampton
Guidelines
  1. This SOP was developed on the Biorad CFX Connect Real-Time PCR detection system, using Microseal PCR plates 96-well, thin-wall (#MSP9601), Microseal ‘B’ PCR Plate Sealing Film, adhesive, optical (#MSB1001) and PowerUp SYBR Green Master Mix for qPCR (#A25742). While we have endeavoured to make this SOP robust, we cannot guarantee performance when different reagents are used. Alternative Taq polymerases/master mixes and consumables should work but may require a small amount of optimisation (examples might include working volumes/concentrations, annealing temperatures and extension times).
  2. Primers were ordered from IDT. Upon receipt at these were made to 100 µM stocks using Ambion nuclease free water. When required 10 µM working stocks were created using nuclease free water.
  3. The development of this SOP was undertaken in the Cawthron Institute’s Molecular biology suite with sterile, separate and sequential rooms to reduce cross contamination. PCR set up was done in laminar flow cabinets. The set up area was cleaned, including all equipment, with 0.5% sodium hypochlorite followed by 70% ethanol and benchtop sterilisation using UV light (>15 min) was undertaken before PCR set up.
  4. The accuracy of RT-PCR is highly dependent on accurate pipetting and thorough mixing of solutions. Take care to avoid pipetting errors during set up.
  5. The reagents are light sensitive – protect from light where possible.
Materials
Equipment:
  • Pipettes (0.1-2 µl, 2-20 µl, 20-200 µl, 200-1000 µl)
  • Pipette tips to fit escribed pipettes above
  • 1.5 ml microcentrifuge tubes
  • 96-well plate compatible with the RT-PCR machine being used
  • Plate sealing film compatible with the 96 well plate and RT-PCR machine
  • Centrifuge compatible with 96 well plates (recommended)
Reagents
  • Polymerase master mix (this SOP was developed using PowerUp SYBR Green Master Mix for qPCR, from ThermoFisher Scientific )
  • Positive control template to be used to generate a standard curve (DNA extracted from Macrocystis pyrifera tissue of a known concentration or the following gBlock from IDT)
  • Sediment extractions predicted to contain Macrocystis pyrifera DNA, with a quantified amount of total DNA.
Before start
AbbreviationDescription
Ct Cycle threshold
HEPA High efficiency particulate air
nM nanomoles
NTC Non-template control
RT-PCR Real-time PCR
SOP Standard operating procedure
UV ultraviolet
µM micromole
Purpose
This SOP aims to guide users to perform a quantitative real-time PCR to detect Macrocystis pyrifera (Giant Kelp) in sediment samples.
Background / Rationale
We have developed a set of species specific primers for the detection of Macrocystis pyrifera to enable the detection of giant kelp DNA in marine sediments, even beyond the confines of their original habitats. A probe has been developed for use in droplet digital PCR, however here we present an SOP for a double stranded dye based qPCR which should be applicable to the majority of qPCR machines.
Supplies and Materials

Safety information
Due to the likelihood of using different reagents and equipment we suggest the users:

1. Check safety data sheets for any reagents being used
2. Check safety manuals for equipment being used

If the user has any further questions, they should reach out to the appropriate company representatives for the reagents and equipment.

qPCR set up - computer based
Calculate the number of samples to be tested. Use the table below to figure out the size of your master mix. The number of samples should be multiplied by 3 to account for triplicates, and then another 10% of reaction volumes should be added to allow for pipetting errors. Each run should include three non-template (e.g., water instead of template) controls. Standards represent the positive control, and should be done at six different concentrations representing a ten-fold dilution series in which you expect your test samples concentrations to fall within. In the below example we have 7 samples plus 6 standards (positive controls) plus 1 negative control, in triplicate. This is 42 wells, plus an extra 4 reactions to account for pipetting error – our master mix is calculated for 46 PCRs.

For the generation of a standard curve we recommend the following sequence:
3'-CGTCCGCGCCCCGAGTGCACCCAATCTCGTGAACGAAGCCTCTCGCGCCCTGCCGCACAGAGTTGTTGACGGCGCTCGCTTCGGCGGCGACTCTCGACTCACGAAACGTGCGCGCAGGATGCCTGCTCGTTCCGCTGCTCCGGCGCGTAAGGCATGTACCGATCCGTCAGTCCGTCCATCTTGTCTCTCGTT-5'
ABC
Reagent Volume required (x= 7 samples + 6 standards + 1 NTC) × 3 + 10% of x
PowerUp SYBR Green Master Mix 5 230
CAWP009 at 10 µM 5’-GAG TGC ACC CAA TCT CGT GAA C-3’ 0.5 23
CAWP010 at 10 µM 5’-GAT GGA CGG ACT GAC GGA TC-3’ 0.5 23
Nuclease free water 3 138
DNA samples 1
Total 10 µl
Recommended creation of plate map
It is suggested to create a plate map to help you with template addition. See example below. Note that there are six standards, seven test samples and one no template control (NTC).

Figure 1: An example plate lay out for a qPCR assay

qPCR set up - laboratory
Place the following consumables into the laminar flow cabinet that has been cleaned with bleach and ethanol: - Pipettes 1000 µL, 20-200 µL, 2-20 µL and 0.1-2 µL. The larger volume pipette will not be required for less than 40 samples.
- Pipette tips to fit the above pipettes. - 1.5 ml microcentrifuge tubes in appropriate rack (number required depends on whether working primer stocks have already been made, and the volume of master mix required).
- Nuclease free water.
- Microseal™ PCR plates 96-well, thin-wall (#MSP9601) plate.

Turn on the UV light of the laminar flow cabinet for >15 minutes. Once this time is up, turn off the UV light and place remaining reagents into the hood.


Resuspend primers. To make a 100 µM stock, multiply the number of nanomoles (nm) of the primer in the tube by 10 and then add that volume in µl of nuclease free water (e.g., for 78.1 nmol of primer, add 781 µl of nuclease free water). Mix thoroughly. This is the storage stock, and should be stored at -20 ºC. To make a working stock, a 1:10 dilution is required. Add 90 µl of nuclease free water to a sterile 1.5 ml microcentrifuge tube and then add 10 µl of your 100 µM primer stock. This working stock should also be stored at -20 ºC.
Perform a 10-fold serial dilution of the standard. You should have six standards. It is important to make fresh dilutions immediately prior to qPCR as DNA does not store well at low concentrations. The suggested highest concentration standard is 14 ng/ul.
Make a master mix by adding the appropriate amounts of:
- PowerUp™ SYBR™ Green master mix
- CAWP009 primer
- CAWP010 primer
- Nuclease free water
Mix gently but thoroughly by pipetting up and down. Aliquot 9 µl of the master mix into each well of the 96-well plate as per the plate map.
Put the plate into the Biorad CFX Connect Real-Time PCR detection system (or the appropriate qPCR system)
Set up the following run:
Hot start 95 °C 3 min
×39 95 °C 10 sec
60 °C 30 sec
65 °C -95 °C melt curve
Analysis
Check the NTC wells for any amplification. There should be no amplification, but data is acceptable if amplification is >10 cycles after the last standard. Ensure that there is amplification of the control template and remove any outlier replicates (+/- >1 Ct from the Ct values of the other replicates). If you do this, ensure the reason for the outlier is understood (e.g., pipetting error). See Figure 2 for an example amplification curve.
Figure 2: Amplification plot for qPCR of Macrocystis pyrifera

Check the automatically generated melt curve. A single sharp peak indicates that there is only the specific Macrocystis pyrifera product. If there are multiple, or broad peaks it suggests that there are non-specific primers, primer dimers or contamination. Figure 3 shows an example melt curve. Note that the variation in peak height reflects differences in amplicon quality between wells, this is normal when sample input varies slightly (an artefact of using extracted tissue DNA rather than a gBlock).

Figure 3: Example melt curve for Macrocystis pyrifera.

Generate a standard curve from the control template by plotting the Ct values against the initial log concentration. For an example see Figure 4.

Figure 4: Example standard curve for Macrocystis pyrifera qPCR
Check that the standard curve has an R2 of >0.9. If not check if there any outliers that can be removed. Again, if you do this ensure that the reason for the outlier is understood (e.g., pipetting error).
Calculate the concentration of your unknown library templates based on the standard curve generates from the control template dilutions. Remember to factor in any dilutions.