Nov 14, 2018

Public workspacesNucDrop-seq Protocol V.2

Molecular Cell
DOI
dx.doi.org/10.17504/protocols.io.vfse3ne
  • Peng Hu1,
  • Emily Fabyanic1,
  • Deborah Y. Kwon1,
  • Sheng Tang1,
  • Zhaolan Zhou1,
  • Hao Wu1
  • 1Department of Genetics, Epigenetics Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia PA 19104, USA
  • Human Cell Atlas Method Development Community
  • Wu Lab @ UPenn
Jennifer Flournoy
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.vfse3ne
External link: https://www.cell.com/molecular-cell/fulltext/S1097-2765(17)30876-6?innerTabgraphical_S1097276517308766=#secsectitle0035
Protocol Citation: Peng Hu, Emily Fabyanic, Deborah Y. Kwon, Sheng Tang, Zhaolan Zhou, Hao Wu 2018. sNucDrop-seq Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.vfse3ne
Manuscript citation:
Hu P, Fabyanic E, Kwon DY, Tang S, Zhou Z, Wu H. Dissecting Cell-Type Composition and Activity-Dependent Transcriptional State in Mammalian Brains by Massively Parallel Single-Nucleus RNA-Seq. Mol Cell. 2017 Dec 7;68(5):1006-1015.e7. doi: 10.1016/j.molcel.2017.11.017.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 08, 2018
Last Modified: November 14, 2018
Protocol Integer ID: 17618
Abstract
Massively parallel single-cell RNA sequencing can precisely resolve cellular diversity in a high-throughput manner at low cost, but unbiased isolation of intact single cells from complex tissues such as adult mammalian brains is challenging. Here, we integrate sucrose-gradient-assisted purification of nuclei with droplet microfluidics to develop a highly scalable single-nucleus RNA-seq approach (sNucDrop-seq), which is free of enzymatic dissociation and nucleus sorting. By profiling ∼18,000 nuclei isolated from cortical tissues of adult mice, we demonstrate that sNucDrop-seq not only accurately reveals neuronal and non-neuronal subtype composition with high sensitivity but also enables in-depth analysis of transient transcriptional states driven by neuronal activity, at single-cell resolution,in vivo.
Guidelines


Materials
Chemicals, Peptides, and Recombinant ProteinsSourceIdentifier
Dulbecco’s Modified Eagle’s MediumLife Technologies11965084
Fetal Bovine SerumLife Technologies26140079
L-glutamineLife Technologies25030081
0.05% TrypsinLife Technologies25300054
Matrigel matrixCorning354230
DMEM/F12Life Technologies11320033
TeSR-E8 MediumStem Cell Technologies05940
DPBS, no calcium, no magnesiumInvitrogen14190136
SucroseSigma-AldrichS0389-1KG
1M Tris-HCl, pH 8.0Invitrogen15568-025
MgAc2Sigma-AldrichM5661-50G
cOmplete™, EDTA-free Protease Inhibitor CocktailRoche11873580001
CaCl2Sigma-AldrichC1016-500G
Triton X-100Sigma-AldrichT8787-100mL
0.5M EDTA, pH 8.0Invitrogen15575-020
NxGen RNase InhibitorLucigen30281-2
Bovine Serum AlbuminSigma-AldrichA8806-5G
Ficoll PM-400GE Healthcare/Fisher Scientific45-001-745
SarkosylSigma-AldrichL7414-50mL
DTTFermentasR0862
QX200 Droplet Generation Oil for EvaGreenBio-Rad186-4006
Perfluoro-1-octanolSigma-Aldrich370533-25G
dNTPsClontech639125
Critical Commercial Assays
Maxima H Minus Reverse TranscriptaseThermoFisherEP0753
KAPA HiFi hotstart readymixKAPA BiosystemsKK2602
Deposited Data
Raw and analyzed dataThis paperGEO: GSE106678
Experimental Models: Cell Lines
NIH3T3ATCCCRL-1658
H7 (female, human embryonic stem cells)WiCellWA07
Experimental Models: Organisms/Strains
Mouse: C57BL/6JJackson Laboratory000664
Oligonucleotides
Template Switch Oligo: AAGCAGTGGTATCAACGC
AGAGTGAATrGrGrG		N/A
TSO-PCR primer: AAGCAGTGGTATCAACGCAGAGTN/A
P5-TSO hybrid primer: AATGATACGGCGACCACCG
AGATCTACACGCCTGTCCGCGGAAGCAGTGGTAT
CAACGCAGAGT∗A∗C		N/A
Custom Read 1 Primer: GCCTGTCCGCGGAAGCA
GTGGTATCAACGCAGAGTAC
Other
Tube, Thinwall, Polypropylene, 38.5 mL, 25 x 89 mm (qty. 50)Beckman Coulter326823
Glass 15mL Dounce Tissue Grinder Set with Two Glass Pestles, Grinding Chamber O.D. x L: 22 x 94mm (Case of 2)Wheaton357544
SW 28 Ti Rotor, Swinging Bucket, Aluminum, 6 x 38.5 mL, 28,000 rpm, 141,000 x gBeckman Coulter342207
Barcoded BeadsChemGenesMACOSKO-2011-10
PDMS Microfluidic DeviceμFluidixBatch #9508
Syringe PumpsKD Scientific78-8100
40μm Sterile Cell StrainerFisher Scientific22-363-547
Medical Grade Polyethylene Micro TubingScientific CommoditiesBB31695-PE/2
SPRISelect BeadsBeckman CoulterB23318
75-cycle High Output v2 KitIlluminaFC-404-2005
10-micron carboxylated polystyrene beadsBangs Labs#PC06N-11355
Software and Algorithms
Drop-seq_tools (v1.12)http://mccarrolllab.com/dropseq/
STAR v2.5.2ahttps://github.com/alexdobin/STAR
Seurat v1.4http://satijalab.org/seurat/
Seurat v2.0http://satijalab.org/seurat/
GSEAhttp://software.broadinstitute.org/gsea/index.jsp
DBSCANhttps://cran.r-project.org/web/packages/dbscan/index.html
MISOhttps://miso.readthedocs.io/en/fastmiso/
Random Foresthttps://www.stat.berkeley.edu/∼breiman/RandomForests/

Nuclei Isolation
Nuclei Isolation



Prepare sucrose cushion (50 mL):

ReagentsVol.
2 M Sucrose45 mL
H2O4.45 mL
1 M Tris-HCl pH 8.0500 μL
3 M MgAc250 μL
1 tablet protease inhibitor w/o EDTA


Note
Cool down the ultracentrifuge to 4 °C before preparing buffers.


Prepare homogenization buffer (50 mL):

ReagentsVol.
H2O40.89 mL
2 M Sucrose8 mL
0.5 M CaCl2500 μL
1 M Tris-HCl pH 8.0500 μL
3 M MgAc250 μL
100% Triton50 μL
0.5 M EDTA10 μL
1 tablet protease inhibitor w/o EDTA
Add 14 mL of sucrose cushion to the bottom of a 1 x 3.5 in (25 x 98 mm) centrifuge tube (Beckman). Keep centrifuge tube on ice.
Amount14 mL Sucrose cushion

Add 12 mL of homogenization buffer into the dounce tissue grinder, douncing 21 times with loose pestle then 7 more times using tight pestle to release the nuclei from adult mouse cortical tissues.
Amount12 mL Homogenization buffer
Note
This step needs to be optimized for different brain regions and other adult tissues.


Carefully transfer the homogenate atop the sucrose cushion in the centrifuge tube. Add an additional 10 mL of the homogenization buffer atop the homogenate.
Amount12 mL Homogenization buffer

Note
Add the solution into the centrifuge tube slowly.

Centrifuge at 25,000 rpm for 2 hours at 4 °C to pellet nuclei.
Duration02:00:00 Centrifugation
Temperature4 °C

After centrifugation, carefully remove the centrifuge tube from rotor and keep the tubes on ice.

Note
An off-white circular pellet containing nuclei should be visible at the bottom of centrifuge tube.

Carefully remove the supernatant and add 1 mL chilled resuspension buffer (0.01% BSA in DPBS with RNase inhibitor). Incubate on ice for 20 min beforere suspending the pellet.
Amount1 mL Resuspension buffer
Duration00:20:00 Incubation on ice


Resuspend nuclei pellet and transfer the suspension into a 1.5-mL lobind tube (Eppendorf).
Note
Wash centrifuge tube with 0.5 mL chilled resuspension buffer and add to Eppendorf tube.

Spin down nuclei at 5,000 rpm for 15 minutes at 4 °C to pellet nuclei. Remove supernatant, and resuspend in 1.5 mL resuspension buffer.
Duration00:15:00 Centrifugation
Amount1.5 mL Resuspension buffer
Note
To remove any excess sucrose cushion from the buffer.



Filter nuclei twice with 40-µm cell strainer and count the number of nuclei. Dilute nuclei to 100 nuclei/μL with resuspension buffer(0.01% BSA in DPBS with RNase inhibitor). Transfer 2 mL of nuclei suspension into a 3-mL Luer-lock syringe.

Note
The following steps were adapted from the Drop-seq protocol (Macosko et al., 2015).


Nuclei and beads co-encapsulation
Nuclei and beads co-encapsulation
Prepare barcoded beads (ChemGenes):
Wash beads once with 30 mL of 100% ethanol and twice with 30 mL of TE-TW (10 mM Tris-HCl pH 8.0, 1 mM EDTA and 0.01% Tween-20)
Amount30 mL 100% Ethanol
Amount30 mL TE-TW


Pass beads through a 100-µm cell strainer and count the number of beads.
Re-suspend beads at 120 beads/μL concentration in 1.5 mL lysis buffer for each sNucDrop-seq run. Transfer 1.5 mL of bead suspension into a 3-mL Luer lock syringe.
Amount1.5 mL Lysis Buffer

Prepare lysis buffer (makes 1 mL):
ReagentsVol. (μL)
H2O400
20% Ficoll PM-400300
20% Sarkosyl10
0.5 M EDTA40
1.0 M Tris-HCl, pH 7.5200
1.0 M DTT50

Draw up 7 mL of droplet generation oil (Bio-Rad) into a 10-mL Luer-lock syringe.
Amount7 mL Droplet generation oil

Connect 3 syringes (containing nuclei, beads and oil, respectively) to the Aquapel-coated PDMS Microfluidic device (µFluidix) with the following flow rate setting:
Syringe ContentFlow Rate (μL/hr)
Oil15,000
Nuclei4,000
Beads4,000
Start the run by pressing “start” on the pumps in the following order: nuclei→ beads → oil.
When the flow of droplets stabilizes, collect ~20 μL of aqueous flow to examine the droplet quality. Check whether the droplet size is uniform and estimate the percentage of bead doublets (the doublet rate should be less than 5%).

Once confirming the droplet quality, collect 1.0 mL of droplets into a 50-mL conical tube.

Droplet Breakage
Droplet Breakage
Remove the oil layer from the bottom of the 50-mL tube.
Add 30 mL of room temperature 6X SSC into the tube.
Amount30 mL 6X SSC

Add 1 mL of Perfluorooctanol (PFO) into the tube in a fume hood. Shake, rigorously,the tube 4 times to break the droplets. Spin at 1000Xg for 1 min.
Amount1 mL PFO
Duration00:01:00 Centrifugation

Carefully remove the supernatant on top and then add 20 mL of 6X SSC to to kick up the beads into solution. Wait a
few seconds to allow the majority of the oil to sink to the bottom. Transfer the supernatant to a new 50-mL tube.
Amount20 mL 6X SSC

Add 20 mL of 6X SSC to kick up the beads into solution again. Transfer and combine the supernatant.
Amount20 mL 6X SSC
Spin at 1000xg for 2 min to pellet the beads.
Duration00:02:00 Centrifugation
Note
Make the RT master mix.


The beads are now pelleted to the bottom of the tube. Carefully remove all but ~1 mL of liquid. Resuspend the beads with remaining liquid and transfer them to a 1.5-mL lobind tube.

Spin 1000X g for 1min. Remove the supernatant. Wash beads twice with 1 mL of 6X SSC and then once with ~300 μL 2X RT buffer. Remove as much of the 2X RT buffer as you can without taking any beads.
Duration00:01:00 Centrifugation
Amount1 mL 6X SSC
Amount300 µL 2X RT

Reverse Transcription
Reverse Transcription
Prepare RT mix (makes 200 μL):

ReagentsVol. (μL)
H2O80
Maxima 5X RT buffer40
20% Ficoll PM-40040
10 mM dNTPs20
100 μM Template Switch Oligo5
RNase Inhibitor (Lucigen)5
Maxima H Minus Reverse Transcriptase10



Add 200 μL of RT mix to the beads.
Amount200 µL RT Mix

Incubate beads at room temperature for 30 min with rotation, then 150 min at 42 °Cwith rotation.
Duration00:30:00 Room Temperature
Duration02:30:00 at 42 °C



Wash beads once with 1 mL TE-SDS (10 mM Tris-HCl pH 8.0, 1 mM EDTA and 0.5% SDS), twice with 1 mL TE-TW.
Amount1 mL TE-SDS
Amount1 mL TE-TW
Note
Beads can be stored at 4°C in TE-TW for at least one month.



Exonuclease I treatment
Exonuclease I treatment
Prepare Exonuclease mix (makes 200 μL):


ReagentsVol. (μL)
10X Exonuclease I buffer20
H2O170
Exonuclease I10

Wash beads once with 1 mL 10mM Tris-HCl pH 8.0, re-suspend in 200 μL of exonuclease mix.
Amount1 mL 10mM Tris-HCl pH8.0
Amount200 µL exonuclease mix

Incubate beads at 37°C for 45 min with rotation.
Duration00:45:00 Incubation at 37°C

Wash beads once with 1 mL TE-SDS, twice with 1 mL TE-TW.
Amount1 mL TE-SDS
Amount1 mL TE-TW

cDNA Amplification
cDNA Amplification
Wash beads once with 1 mL H2O. Spin 1000X g for 1 min.
Amount1 mL H2O

Remove supernatant and re-suspend the beads with 1 mL of H2O.Quickly transfer 1 μLof beads into a well of 96-well plate (containing 50 μL of H2O) and count the number of beads. Repeat bead counting three times and take the average.
Amount1 mL H2O
Note
The expected bead concentration is 40-70 beads/μL for each run (~1 mL of droplets).

Transfer an aliquot of 6,000 beads (corresponding to ~100 nuclei) into a PCR tube. Spin down and remove the supernatant, then re-suspend the beads with 50 μL PCR mix:
ReagentsVol. (μL)
KAPA HiFi HS Readymix25
100 μM TSO-PCR primer0.4
H2O24.6
Store the remaining beads in TE-TW at 4°C.
Note
Run 1st round of TSO-PCR to determine the optimal number of PCR amplification cycle to avoid over-amplification.


Run 1st round of TSO-PCR.PCR program:

95 °C for 3 minutes (min)
4 cycles of:
98 °C for 20 seconds (s)
65 °C for 45 s
72°C for 3 min
9 cycles of:
98 °C for 20 s
67 °C for 20 s
72 °C for 3 min
Then:
72 °C for 5 min
4 °C forever

Purify PCR productstwice with0.6X (30 μL) SPRI beads. Elute in 10 μL H2O.
Amount30 µL SPRI beads
Amount10 µL H2O



Measure the concentration of PCR products by Qubit.

Note
For mouse cortical nuclei, the expected concentrationis 100-600 pg/μL.

Perform real-time PCR analysis to determine the additional number of PCR cycles needed for optimal cDNA amplification.
ReagentsVol. (μL)
Purified cDNA1
25 μM TSO-PCR primer0.2
2X KAPA FAST qPCR Readymix5
H2O3.8
Run real-time PCR with the following program:
95 °C for 3 min
25 cycles of:
95 °C for 15 s
63 °C for 30 s
72°C for 30 s
After determining the optimal PCR cycle number, perform large-scale TSO-PCR on remaining beads. Wash the remaining beads twice with 1 mL H2O. Apportion 6,000 beads for each PCR reaction. Spin down and remove the supernatant, then re-suspend the beads with 50 μL PCR mix.
Amount1 mL H2O
Amount50 µL PCR Mix
PCR program:
95 °C for 3 min
4 cycles of:
98 °C for 20 s
65 °C for 45 s
72 °C for 3 min
9 plus additional cycles of:
98 °C for 20 s
67 °C for 20 s
72 °C for 3 min
Then:
72 °C for 5 min
4 °C forever


Combine the PCR product for a given sample into a 1.5-mL lobind tube and purify twice with 0.6X SPRI beads. Elute the cDNA in H2O (in 1/5 the volume of the PCR product).
Quantify the cDNA library by Qubit (for mouse cortical nuclei, the expected concentrationis 800-2000 pg/μL) and run the bioanalyzer to check the average fragment size of the purified cDNA library (the expected average size of cDNA library is 1300-2000 bp).

Tagmentation
Tagmentation
Preheat thermocycler to 55°C. For each sample, take out 550 pg of purified cDNA with H2O in a total volume of 5 μL to a PCR tube.

Add 10 μL of Nextera TD buffer and 5 μL of Amplicon Tagmentation enzyme to each reaction. Mix by pipetting ~5 times.
Amount10 µL Nextera

Incubate at 55 °C for 5 min.
Duration00:05:00 Incubation

Add 5 μL of Neutralization Buffer to each reaction. Mix by pipetting ~5 times. Spin down and incubate at room temperature for 5 min.
Amount5 µL Neutralization Buffer
Duration00:05:00 Incubation


Add to each PCR tube in the following order:
ReagentsVol. (μL)
Nextera PCR mix15
2 μM P5-TSO hybrid primer5
2 μM Nextera N70X oligo5
PCR program:

95 °C for 30 s
12 cycles of:
95 °C for 10 s
55 °C for 30 s
72 °C for 30 s
Then:
72 °C for 5 min
4 °C forever

Purify PCR product twice with 0.6XSPRI beads. Elute the cDNA in 10μL H2O.
Amount10 µL H20

Quantify the concentration of cDNA library by Qubit and check the average fragment size of the purified cDNA library by Bioanalyzer (the expected fragment size is500-700 bp).
Sequencing
Sequencing
Estimate the library concentration:
Conc. (nM) =


For sequencing on Illumina NextSeq 500 (75-cycle High Output v2 Kit), denature the library and dilute to 2.0 pM. Load diluted library to position 10. Dilute custom Read1 primer (0.3 μM) and load it to position 7. For sequencing multiple libraries in one flowcell, use following sequencing specification: 20 bp (Read1; custom read1 primer), 8 bp (Index1), and 50-60 bp (Read2).