Jun 17, 2020
Single-gene long-term CRISPRi knockdown viability assay
This protocol is a draft, published without a DOI.
- Nolan Bick1,
- Benjamin Gaeta2,
- Tsukasa Shibue1,
- Francisca Vazquez2
- 1Cancer Program, Broad Institute of MIT and Harvard;
- 2Broad Institute
- Cancer Dependency Map Target ValidationTech. support email: depmap-tda@broadinstitute.org
Protocol Citation: Nolan Bick, Benjamin Gaeta, Tsukasa Shibue, Francisca Vazquez 2020. Single-gene long-term CRISPRi knockdown viability assay. protocols.io https://protocols.io/view/single-gene-long-term-crispri-knockdown-viability-bdm6i49e
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 13, 2020
Last Modified: June 17, 2020
Protocol Integer ID: 34206
Keywords: Colony Formation, cell viability, CRISPRi, target validation, genetic dependency, CRISPR Interference
Abstract
As an alternative to 'Single-gene short-term CRISPR ko viability assay (https://www.protocols.io/edit/single-gene-short-term-crispr-ko-viability-assay-bc6jizcn/description)', we have also developed a method for assessing the long-term viability effect upon suppression of a gene of interest. Using CRISPRko (CRISPR/Cas9-mediated gene knockout) is not compatible with evaluating long-term viability effects due to incomplete penetrance of gene inactivation. Instead, we use CRISPRi with catalytically dead Cas9 (dCas9) fused to Krüppel associated box (KRAB) domain to suppress gene expression with higher penetrance. Following perturbation with CRISPRi, cells are seeded at a clonogenic density and their growth is monitored for up to 2 weeks.
We provide sequences of CRISPRi negative and positive sgRNAs controls, which are critical for evaluating the strength of the dependency, as well as a series of templates to record and normalize the data produced throughout this assay. In addition to permitting evaluation of long-term viability effects, this CRISPRi-based assay might also enable the assessment of the effects of partial suppression of gene expression if appropriate gRNAs are available.
Attachments
Guidelines
While the Single-gene short-term CRISPR ko viability assay described here provides a good starting point for evaluating genetic dependency in selected cell line models, this assay cannot assess vability effect that appears long (> 1 week) after gene depletion. The Single-gene long-term CRISPRi knockdown viability assay described in this section is useful for evaluating such slow viability effects.
Materials
MATERIALS
Paraformaldehyde fixative: 4% paraformaldehyde in phosphate buffered saline (PBS)
Crystal violetBio Basic Inc.Catalog #CB0331.SIZE.100g
EZ-LINE Multiwell TC Plates, 24-well TC plate, 50/case, TreatedBio Basic Inc.Catalog #SP41135.SIZE.1CS
Acetic acidMerck MilliporeSigma (Sigma-Aldrich)Catalog #320099-6X2.5L
15-Dimethyl-15-diazaundecamethylene polymethobromide PolybreneMerck MilliporeSigma (Sigma-Aldrich)Catalog #H9268
DNA Ligation Kit Mighty MixTakara Bio Inc.Catalog #6023
Safety warnings
- Use BL2+ facility for lentivirus infection and subsequent propagation of infected cells.
Before start
- Obtain and propagate 3+ models (i.e., cell lines) that are putatively sensitive on the genetic perturbation to be tested as well as 3+ lineage-matched control models that are supposed to be insensitive to the same perturbation
- (Optional) Adapt all the cell line models to growth in RPMI1640 medium supplemented with 10% fetal bovine serum (FBS)
Reagent Preparation/Set-Up
Reagent Preparation/Set-Up
Select cell lines that are putatively dependent (dep) or nondependent (nondep) on a gene of interest using depmap.org. Usually, 3 or more cell lines from both dep and nondep classes are selected.
OPTIONAL: If the original medium for the cell line is not RPMI, consider adapting the cells with RPMI + 10% fetal bovine serum (FBS) so that all the cell lines are grown in the same media.
Plasmids/Cloning
We created the pXPR_BRD023-D lentivector to express dCas9 + KRAB alongside sgRNAs targeting our gene of interest in addition to positive and negative controls (sequences included in materials).
Step 3.1: describes our method to create the pXPR_BRD023-D vector
Steps 3.2 to 3.7: describes insertion of specific sgRNA sequences for the gene of interest. and controls.
The Cas9 sequence was removed from all-in-one CRISPR KO plasmid, pXPR_BRD023, and replaced with the dCas9-KRAB sequence from pXPR_BRD121. Restriction enzymes Nhel (BRD023), XbaI(BRD121), and BamHI(both) were used for digestion. The dCas9-KRAB insert and BRD023 backbone were subsequently ligated, transformed, and plasmid DNA extracted.
Order oligos for sgRNA sequences:
3 sgRNAs targeting the gene to be tested
2 positive controls and 1 negative control:
| Negative control (intergenic sequence) Chr2-2 | GGTGTGCGTATGAAGCAGTG | |
| Positive control 1 POLR2D | CGGCGGGTGGCAGCGATCCG | |
| Positive control 2 SF3B1 | AAGATCGCCAAGACTCACGA |
CRISPRi sgRNA sequences of negative and positive controls
Anneal oligo sgciRNA oligo pairs.
For each pair, add the following in a PCR tube.
·1.5 μL of forward oligo (100uM)
·1.5 μL of reverse oligo (100uM)
·5 μL of 10x NEB buffer 3.1
·42 μL ddH20
----------------------
50ul total
·Incubate for 4 min at 95°C, 10 minutes at 70C and then let cool to room temperature.
Digest the generic pXPR_BRD023-D vector with NEB enzymes, EcoRI and BsmBI (visit NEB website for digestion procedures consistent with enzyme parameters). Purify backbone and insert via agarose gel.
·Ligate digested BRD023-D backbone to each pair of annealed sgciRNA oligos.
·Immediately transform ligation mix to Stbl3 competent cells from ThermoFisher (Cat: C737303).
·Leave on ice for 10 minutes, heat shock at 42C for 30 seconds, recover by adding 200ul of SOC media per transformation, and incubate at 37C for 1 hour.
·Plate 50ul of each transformation mixture on LB agar + Carbenicillin plates and incubate at 37C overnight (16 hours).
Pick 6 bacterial colonies per plate and amplify each colony in 4ml of LB + 50ug/ml Carbenicillin media for 16 hours at 37C in a bacterial shaker.
Perform miniprep (per manufacturer's instructions) on all samples to extract plasmid DNA.
Prepare lentivirus for each CRISPRi all-in-one construct using 15 cm-plates (protocol for generic virus prodocution is included in attached files).
Determine the number of 15 cm plates for virus production per type of virus based on the need and resource available (we typically need 5 or more 15 cm plates per virus type per target).
Filter media containing virus via 0.45 um filter.
Concentrate the virus to approximately 2 mL per 15 cm plate, using Amicon Ultra-15 Centrifugal FIlter Unit (30K NMWL, MIlipore SIgma, C7715).
To concentrate virus, spin ~15mLs of virus-containing media at 2500g's for 30 minutes at 4°C. We use 30kDa or 100kDa 15-mL filter centrifuge tubes. This approach typically yields ~ 1mL of concentrated virus.
Virus Titration
Virus Titration
30m
30m
Viral Titration
30m
Mix following in a 12-well plate,
| cells | 500,000 cells | |
| virus | (see below; with differing amount of virus) | |
| 8 mg/mL polybrene | 1 uL | |
| 10% FBS, RPMI | up to 2 mL |
Plate map (volume of virus)
| 0 uL (0 uL) | 0 uL (0 uL) | |||
| 25 uL (200 uL) | 50 uL (400 uL) | |||
| 100 uL (800 uL) | 200 uL (1600 uL) |
volume of concentrated virus (use volume in the parenthesis if the virus is not concentrated)
Centrifuge at 900xg, 1.5h, 37ºC
Virus titration/infection: Day 0
Virus titration/infection: Day 0
2h
2h
24 hours after seeding/infecting change medium
| Puro | no Puro | |||
| Puro | Puro | |||
| Puro | Puro |
Puro: 10% FBS RPMI + 2 ug/mL puromycin, 1 mL
no Puro: 10% FBS RPMI, 1 mL
48 hours after starting Puro selection, pick the well with
- No apparent death by Puromycin
- No apparent virus toxicity
Virus Titration
Virus Titration
30m
30m
A no infection well with antibiotic selection is helpful to check on the selection progress of cells
Titrate the virus (see titration protocol above STEP5.1-5.3) to determine the amount of virus giving you maximal infection and minimal toxicity. Archiving >90% infection efficiency (post-antibiotic selection) is optimal.
If titrating the virus is not possible, select 3 concentrations to use during the experiment. We found that for most cell lines we can use 100 uL of concentrated virus or 800 uL on non-concentrated virus
Add optimal virus to cells and spin plate at 900g (RCF) @ 37°C for 90 minutes.
Aspirate media and wash with PBS and add selection antibiotic
1h 30m
Seeding: Day 3
Seeding: Day 3
55m
55m
Check to see cells are selecting out from selection (Ideally >10% dead cells).
When testing 3 different MOIs, pick the one with minimal viral toxicity and maximal survival against selection.
5m
Trypsinize cells and count cells (SELECTION-FREE MEDIA)
5m
Seed cells into colony formation plate, seeding density varies based on cell doubling time (make dilutions if needed)
45m
24-well: Total volume to 500ul
Fast growing (cell doubling time 24-72 hours): 500 cells per well at lowest density
Medium growing (cell doubling time 72-120 hours): 1000 cells per well at lowest density
Slow growing (cell doubling time >120+ hours): 2500 cells per well at lowest density
Plate layout (24-well):
| (seeding density) | Ch2-2 (neg control) | POLR2D (pos control) | SF3B1 (pos control) | Target- sgRNA-1 | Target- gRNA-2 | Target-sgRNA-3 | |
| 1x | |||||||
| 2x | |||||||
| 4x | |||||||
| 8x |
DO NOT add antibiotics at this point (antibiotic treatment will be restarted on Day 6)
Plate rest of negative control and target cells for Western blot if desired
Culturing: Day 6
Culturing: Day 6
5m
5m
Working quickly, aspirate media (collect and spin if suspension cells), and re-add media with antibiotic selection
5m
- Do not wash with PBS
- Avoid drying in center of wells
- Don’t touch bottom of well
- Carefully add media to wells (avoid detachment of cells)
Culturing: Day 9
Culturing: Day 9
5m
5m
Working quickly, aspirate media (collect and spin if suspension cells), and re-add media with antibiotic selection
5m
Culturing: Day 12
Culturing: Day 12
5m
5m
Working quickly, aspirate media (collect and spin if suspension cells), and re-add media with antibiotic selection
5m
Staining with CV: Day 14
Staining with CV: Day 14
1h 5m
1h 5m
Staining with Crystal Violet (Adherent Cells)
1h
Aspirate Media and gently wash with PBS
Add 4% PFA or 10% Neutral-buffered formalin (under fume hood) to wells and put on shaker for 15 minutes
For 24-well, 250ul
Remove PFA or Formalin (under fume hood) and dispose of in appropriate hazardous waste container
Wash wells with DI water
For 24-well, 250ul
Remove water and dispose of in PFA/Formalin waste container
Add crystal violet to each well (under fume hood) and put on shaker for 20 minutes
For 24-well, 250ul
Remove crystal violet (under fume hood) and dispose of in appropriate hazardous container
Wash wells with DI water
For 24-well, 250ul
Remove water and dispose of in crystal violet waste container
Fill ice bucket with DI water and gently dunk plates to rinse, repeat for a total of 2 dunks
Let plates air dry (overnight is usually best)
Take images of plates once dry using scanner
Place plates face up (bottom of well is closer to scanner)
Resolution: 600 dpi
5m
Quantification of CV: After day 14
Quantification of CV: After day 14
10m
10m
After scanning pictures of plate(s), add 10% acetic acid to each well and put on shaker for at least 20 minutes
For 24-well, 325ul
30m
Mix well, add 100ul in triplicates into clear bottom 96-well plate
5m
Add 10% acetic acid as account for background to empty well(s)
Read absorbance at 595 nm
5m
Dispose of acetic acid + crystal violet in appropriate hazardous waste container
5m
Quantification with CTG: Day 14
Quantification with CTG: Day 14
45m
45m
Quantifying with Cell Titer-Glo (Suspension Cells)
45m
Without removing media, add 150 uL/well of CTG reagent (24-well plates) (undiluted)
Shake the plate on the shaker, 30 min @ Room Temp.
Aliquot 100 uL x 3 wells into opaque (white/black) 96-well plate
Read luminescence
Use the same Excel template as above (see STEP 17.1) for the analysis of the result.
The intensity of crystal violet staining (or luminescence) of experimental samples (with knockdown) relative to those of negative and positive control samples will indicate how strong the viability effect is.