Apr 25, 2025

Public workspacesingle-cell TChIC for Zebrafish

This protocol is a draft, published without a DOI.
  • 1Hubrecht Institute, Utrecht University;
  • 2Hubrecht Institute
Vivek Bhardwaj
Icon indicating open access to content
QR code linking to this content
Protocol Citation: Vivek Bhardwaj, Alberto Griffa, Helena Viñas Gaza, Peter Zeller, Alexander van Oudenaarden 2025. single-cell TChIC for Zebrafish . protocols.io https://protocols.io/view/single-cell-tchic-for-zebrafish-cwubxesn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 06, 2023
Last Modified: April 25, 2025
Protocol Integer ID: 84579
Funders Acknowledgements:
EMBO
Grant ID: ALTF 1197–2019
ERC
Grant ID: ERC-AdG 101053581-scTranslatomics
Abstract
Establishing a cell-type-specific chromatin landscape is critical for the maintenance of cell identity during embryonic development. However, our knowledge of how this landscape is set during vertebrate embryogenesis has been limited, due to the lack of methods to jointly detect chromatin modifications and gene expression in the same cell. Here we present a multimodal measurement of full-length transcriptome and chromatin modifications in individual cells during early embryonic development in zebrafish using a novel protocol: single-cell transcriptome with chromatin immunoclevage (scTChIC)
Protocol materials
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
Reagentrat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML
ReagentTri-Methyl-Histone H3 (Lys27) (C36B11) Rabbit mAbCell Signaling TechnologyCatalog #9733S
ReagentH3K4me1 Recombinant Polyclonal AntibodyThermo Fisher ScientificCatalog #710795
ReagentStericup® Quick Release Vacuum Driven Sterile Filters Merck Millipore (EMD Millipore)Catalog #S2GPU05RE
ReagentTris 1M pH 7.5ThermofisherCatalog #15567027
ReagentBSA 20mg/mLNew England BiolabsCatalog ##B9000
ReagentATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
ReagentT4 DNA LigaseNew England BiolabsCatalog #M0202L
ReagentMgCl2 1MThermofisherCatalog #AM9530G
ReagentDTT 0.1MInvitrogen - Thermo FisherCatalog #15846582
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
Reagent Hybridase Thermostable RNase HBiosearch TechnologiesCatalog #H39500
ReagentRQ1 RNase-Free DNasePromegaCatalog #M6101
ReagentT4 PNKNew England BiolabsCatalog # M0201L
ReagentdNTPs MixPromegaCatalog #U1515
ReagentDTT 0.1MInvitrogen - Thermo FisherCatalog #15846582
ReagentMgCl2 1MThermofisherCatalog #AM9530G
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
Reagent DNA Polymerase I, Large (Klenow) FragmentNew England BiolabsCatalog # M0210L
ReagentThermolabile Exonuclease INew England BiolabsCatalog # M0568L
ReagentATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
ReagentTris 1M pH 7.5ThermofisherCatalog #15567027
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
ReagentdNTPs MixPromegaCatalog #U1515
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
ReagentT4 PNKNew England BiolabsCatalog # M0201L
ReagentE. coli Poly(A) PolymeraseNew England BiolabsCatalog #M0276L
ReagentAdenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
ReagentMgCl2 1MThermofisherCatalog #AM9530G
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
ReagentNEB T4 RNA Ligase 2, truncatedNew England BiolabsCatalog #M0242L
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
ReagentRNAse AThermo ScientificCatalog #EN0531
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
ReagentAmpliTaq™ 360 DNA PolymeraseThermo Fisher ScientificCatalog #4398828
ReagentdATPs 100mMPromegaCatalog #U1335
ReagentKCl 1MThermofisherCatalog #AM9640G
ReagentBSA 20mg/mLNew England BiolabsCatalog ##B9000
ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
ReagentdNTPs MixPromegaCatalog #U1515
ReagentNEBNext® High-Fidelity 2X PCR Master MixNew England BiolabsCatalog #M0541L
ReagentVBLOK200 Reservoir, CaseClickBio, Inc.Catalog #CBVBLOK200-1
ReagentMineral Oil BioUltra, for molecular biologyMerck MilliporeSigma (Sigma-Aldrich)Catalog #69794-500ML
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentCellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554
ReagentCellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572
ReagentCellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentCellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554
ReagentcOmplete™, EDTA-free Protease Inhibitor CocktailMerckCatalog #5056489001
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentSpermidineMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2626-5G
ReagentFACSmax Cell Dissociation SolutionamsbioCatalog #AMS.T200100
Reagentrat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML
ReagentPronaseMerck MilliporeSigma (Sigma-Aldrich)Catalog #10165921001
ReagentCellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572
ReagentCellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615
ReagentSilverseal plate sealergreiner bio-oneCatalog #676090
ReagentThermolabile Proteinase KNew England BiolabsCatalog #P8111S
Before start
Reagents, tips and tubes should be RNAse and DNAse-free, and ideally DNA-low-binding as well.
Embryo Dissociation
Embryo Dissociation
1d
1d
Obtain Zebrafish embryos. Grow them at Temperature28.5 °C in a 10cm diameter petri dish in ~Amount10 mL of fresh E3 media in an incubator.

If planning to incubate the embryos for a long time, check the water level periodically for evaporation. You might want to add a beaker with water just to provide a bit more moisture.
Check on the embryos periodically. Count them and decide if and how to split them between one or multiple timepoints.
Optionally, take representative pictures of the embryos
Sort our the unfertilized embryos from the fertilized ones using a plastic Pasteur pipette. This can be done at any time between the collection of the eggs and their dissociation, but it's advisable to do it very early (~1hpf) because of the ease of distinguishing fertilized and unfertilized.
1 hour before the start of dissociation prepare and/or thaw the reagents required:

1. fresh E3 media (Amount1 L or more)

2. Pronase solution (1mg/mL, dissolved in E3 media)
ReagentPronaseMerck MilliporeSigma (Sigma-Aldrich)Catalog #10165921001

3. Calcium-free Ringer’s solution (prepared following ZFIN recipe book, 5th Edition https://zfin.atlassian.net/wiki/spaces/prot/pages/362220041/RINGER+S+SOLUTIONS)

4. FACSmax (used for timepoints lower than 10hpf)
ReagentFACSmax Cell Dissociation SolutionamsbioCatalog #AMS.T200100

5. Protease solution (used for timepoints from 10hpf (included) onwards)
  • 25mL 0.5% Trypsin-EDTA
  • 5mL 10X PBS0
  • 20mL sterile water

6. Protease Stop solution (used for timepoints from 10hpf (included) onwards)
  • 3ml FBS
  • 30μL of 2M CaCl2
  • 5.9mL sterile water
  • 1mL 10X PBS0 (PBS0 is PBS without Ca+ and Mg+)

7. Suspension media (1mL FBS + 9ml PBS0). PBS0 is PBS without Ca+ and Mg+

Cell Tracer dyes and rat serun to stop staining (depending on whether multiple timepoints will be mixed in a single tube or not, see flowcharts below): ReagentCellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554 ReagentCellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572 ReagentCellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567
Reagentrat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML

Equipment
CENTRIFUGE 5430 R
NAME
Eppendorf
BRAND
MP2231000510
SKU


After the dissociation is complete, there are a few possible routes that can be taken (requiring tweaks to the solutions). The flowchart below illustrates the 2 main choices and their required changes:


The choice of protocol will determine which solutions to prepare and whether to also procure the cell tracer dyes. Below is a more detailed overview of which solutions are needed and for which steps according to your choices. We used the two approaches in the bottom row in our datasets.
More detailed overview of which solutions are needed and for which steps according to your choices. We used the two approaches in the bottom row in our datasets. EtOH: Ethanol, WB1: Wash Buffer 1, WB: Wash Buffer, ab: antibody, pA-MN: protein A-MNase fusion protein




How to prepare the various Washing Buffers (CellTrace Staining included)
If you are not planning on using the Celltrace dyes to combine multiple samples, see alternative option below at step 2.1

Prepare Wash Buffer(w/out Spermidine), regular Wash Buffer, Wash Buffer1 (w/out Spermidine) and regular Wash Buffer 1 (WB1). Not all of these need to prepared now, but for the sake of completeness, they are all presented here.

We suggest preparing the Wash buffers in the following order: prepare 50mL of Wash Buffer(w/out Spermidine) and take 10mL aside to make WB1 (w/out Spermidine). Use the remaining 40mL to make regular WB, and from regular WB, prepare WB1 as needed.

Depending on whether the objective is to capture cells or nuclei, switch out the Tween-20 for 10% Saponin.
(Dissolve fresh 10% Saponin in PBS0. Store at Temperature4 °C , use within 2 days. )

For all Wash Buffers: prepare TemperatureOn ice , store at Temperature4 °C , use for up to 2 days

Wash Buffer(w/out Spermidine)
AB
Wash Buffer (w/out Spermidine)Volume 50 mL
H2O RNAse free water47.8 mL
HEPES pH 7.5 (1M)1 mL
NaCl(5M)1.5 mL
Saponin 10%250 µl
Protease inhibitor1 complete tablet
ReagentcOmplete™, EDTA-free Protease Inhibitor CocktailMerckCatalog #5056489001
from the Wash Buffer(w/out Spermidine), prepare the Wash Buffer(w/out Spermidine) 1. We suggest preparing it on a per-needed basis to save on the RNAse inhibitor.
ABCD
Wash Buffer w/out Spermidine 1Volume 1 mLVolume 1.5mLVolume 7,5
Wash Buffer MINUS1mL1.5 mL7.5 mL
EDTA 0.5M4 µl6 µl30 µl
RNAse inhibitor (1:40)25 µl37.5 µl187,5 µl
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 From the remaining Wash Buffer(w/out Spermidine), prepare 40mL of the regular Wash Buffer (by adding the Spermidine).
AB
regular WBVolume 40mL
Wash Buffer w/out Spermidine40mL
Spermidine solution 2.88 µl
ReagentSpermidineMerck MilliporeSigma (Sigma-Aldrich)Catalog #S2626-5G From the regular Wash Buffer, prepare the Wash Buffer 1. We suggest preparing it on a per-needed basis to save on the RNAse inhibitor.
AB
Wash Buffer1Volumn 2.5mL
regular WB2.43 mL
EDTA 0.5M10 µl
RNAse inhibitor (1:40)62,5 µl
ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615

ALTERNATIVE: Preparing Wash Buffers (not for CellTrace staining)
For those not planning to do any stainings, they only need to prepare the regular Wash Buffer following this recipe and the WB1 by adding EDTA to the regular WB.
ABCD
regular Wash BufferConcentrationVolume 50 mLVolume 10 mL
H2O RNAse free water 47.8 mL9.56 mL
HEPES pH 7.51M1 mL200 ml
NaCl5M1.5 mL300 ml
Spermidine solution 3.6 µl0.72 ml
Tween (10%)0.05%250 µl50 ml
Protease inhibitor 1 complete tablet
Store at Temperature4 °C or in a cold room. Use for up to 2 days.
WB1 To an aliquot of WB, add Amount4 µL of Concentration0.5 Molarity (M) EDTA for each Amount1 mL of WB.
Store at Temperature4 °C or in a cold room. Use for up to 2 days.
We suggest not turning all of the regular WB in WB1 immediately, as the regular WB will still be used during day 2.
Dechorionation
Transfer the embryos to a glass beaker with a plastic Pasteur pipette. Remove as much E3 as possible without exposing the embryos to air. Add ~Amount5 mL of Concentration2 micromolar (µM) Pronase Solution. Incubate at Temperature28.5 °C  for Duration00:03:00 checking constantly for cracks in the chorion. If the chorions are still intact after the 3 minutes, incubate for longer (Duration00:01:00 - Duration00:02:00 ). At the first sign of the chorions cracking, proceed to the next step.

6m
Critical
Dilute the Pronase with serial dilutions with a large (enough to fill 90% the beaker) volume of E3 media. Pour away as much liquid as possible without leaving the embryos exposed to air, and repeat this washing step another 3-4 times. Swirl the beaker to release the embryos from their chorions.
8m
Transfer the dechorionated embryos with a glass pipette to 1.5mL protein low-binding tubes. Use multiple tubes so that each tube only contains at most ~50 embryo (less at later timepoints).
Deyolking
Remove as much E3 as possible (without leaving the embryos exposed to air). Add Amount200 µL of Calcium-free Ringers solution.

Gently pipette up and down with a P200 pipette to deyolk (~15 times).

Expected result
the solution should turn cloudy and slightly yellow-tinted.

Let sit in Ringer’s solution for approximately Duration00:05:00 at TemperatureRoom temperature .
5m
Centrifuge the samples at Centrifigation600 rcf, 00:03:00  with a Swinging Buckets Centrifuge
Equipment
CENTRIFUGE 5430 R
NAME
Eppendorf
BRAND
MP2231000510
SKU

3m
Centrifigation
Wash the samples with Amount500 µL of Suspension Media at TemperatureRoom temperature
Wash
centrifuge at Centrifigation600 rcf, 00:03:00  with the swinging buckets centrifuge.
3m
Dissociation: 
Resuspend cells in Amount200 µL  of either FACSmax (for timepoints up to 8hpf (included)), or Protease Solution (for timepoints later than 10hpf (included). Incubate on shaker at Shaker600 rpm, 28°C, 00:06:00
Resuspend up and down gently every 2min.

Check under the microscope that the suspension is single cell! If not keep longer.
Expected result
the solution should contain single cells

If the solution is already single cell, interrupt the shaking and proceed to the next step.
6m
If using the Protease Solution, at the end of the dissociation, add 34uL of Protease Stop Solution for each 200uL of Protease Solution.
Collect and filter the single cell solution into a 1.5 mL prot-low binding tube using the blue cap from FACS tubes (35 um) and centrifuge at Centrifigation600 rcf, 00:03:00  with the swinging buckets centrifuge.
3m
Centrifigation
Resuspend the cell pellet in Amount500 µL  of Suspension media at TemperatureRoom temperature  . Take aAmount10 µL aliquot to count the number of cells. Centrifuge the rest at Centrifigation600 rcf, 00:03:00  with the swinging buckets centrifuge.

3m
Wash
Resuspend the pellet in Amount500 µL of WB1 Full (remember the 1:40 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).
Keep on TemperatureOn ice until all the timepoints have been collected.

DAY 1: Cell Staining and Antibody Incubation
DAY 1: Cell Staining and Antibody Incubation
2h
2h
Centrifuge all samples at Centrifigation600 rcf, 00:03:00  with the swinging buckets centrifuge.
Wash each sample with Amount200 µL of WB1 (w/out Spermidine) (with 1:200 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ), and centrifuge them again at Centrifigation600 rcf, 00:03:00  with the swinging buckets centrifuge.

Skip till Step 13 if you are not planning on staining your samples!

6m
Wash
Resuspend each sample in Amount1 mL of WB1 (w/out Spermidine). Add to each sample Amount1 µL of one or a combination of the CellTrace Dyes:
ReagentCellTrace™ CFSE Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34554 ReagentCellTrace™ Far Red Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34572 ReagentCellTrace™ Yellow Cell Proliferation Kit, for flow cytometryThermo FisherCatalog #C34567

We suggest consistently using the same staining setup between replicate experiments to speed up the configuration of the FACS Sorting Layout.
Mix
Vortex each sample well!
Incubate the samples in the dark TemperatureOn ice for Duration00:20:00

20m
Incubation
In the meantime, prepare/thaw the Reagentrat serumMerck MilliporeSigma (Sigma-Aldrich)Catalog #R9759-5ML (which will stop the staining)

Add Amount70 µL of Rat Serum for each Amount1 mL of the staining volume (7% of staining volume) to each sample and incubate at TemperatureRoom temperature for Duration00:05:00 to stop the staining.
5m
Centrifuge the samples at Centrifigation600 rcf, 4°C, 00:03:00  with the swinging buckets centrifuge.
3m
Wash each sample with Amount200 µL of WB1 Full (with 1:200 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ) , and centrifuge the samples at Centrifigation600 rcf, 4°C, 00:03:00  with the swinging buckets centrifuge.

3m
Wash
Resuspend and collect the samples in 1 tube with WB1 Full (with 1:40 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ). Calculate the final value so that the concentration of cells is approximately 1 Mil cells/mL, and the mixing ratios corresponds to the desired experimental mix.
If planning to measure more than one histone modification in the same experiment, split the sample in the corresponding number of tubes.

If using colors to mix samples, an unstained populations of carrier cells can be added to increase the cell number.
Critical
Add to each sample the appropriate primary antibody, at the appropriate dilution. Incubate DurationOvernight on a roller in the dark and at Temperature4 °C .

Note
We used a 1:200 dilution for ReagentTri-Methyl-Histone H3 (Lys27) (C36B11) Rabbit mAbCell Signaling TechnologyCatalog #9733S
and a 1:100 dilution for ReagentH3K4me1 Recombinant Polyclonal AntibodyThermo Fisher ScientificCatalog #710795



5m
Critical
Overnight
DAY 2: Sort, Protein A-MN treatment and activation
DAY 2: Sort, Protein A-MN treatment and activation
1d
1d

Note
From now on, reagents, cells, plates and machines should be kept cold, TemperatureOn ice or at Temperature4 °C as much as possible (including on the way from a machine to a centrifuge).
Cells should ideally also be kept in the dark (until the sort).

Prepare 384-wells Plates
Before starting, make sure to have enough plates to sort into. These should be 384-wells hardshell plates (Biorad) containing at least 5uL of Mineral Oil
ReagentMineral Oil BioUltra, for molecular biologyMerck MilliporeSigma (Sigma-Aldrich)Catalog #69794-500ML and Amount0.05 µL of WB2 containing 28ng/uL of Celseq2 adapters.
Note
We suggest preparing the 384-wells plates in advance of the sort

You can prepare the plates by first filtering the mineral oil with a ReagentStericup® Quick Release Vacuum Driven Sterile Filters Merck Millipore (EMD Millipore)Catalog #S2GPU05RE and then dispensing several (between 5 and 10) uLs of the filtered mineral oil in each plate.

Note
We use a Tecan Freedom Evo for this step, but many other machines might be up to the task.

Next you should dispense in each plate, Amount0.05 µL of CelSeq2 adapters, diluted in WB2, in each well. We use a Mosquito Liquid Handling robot (SPT Labtech) to transfer Amount0.05 µL from each well of a master plate(containing the primers in WB2) to each well of the target plate(s) (up to 4 at the same time). To minimise evaporation, the Mosquito should be humidified to a humidify of ~Humidity80 %
Keep the plates TemperatureOn ice if you plan to use them the same day, otherwise store them at Temperature-20 °C . When needed, thaw them ~ Duration00:30:00 before the sort TemperatureOn ice or on thermocyclers cooled to Temperature4 °C .

WB2
ABCD
Wash Buffer 2 Concentration Volume 50 mLVolume 10 mL
H2O RNAse free water 47.8 mL9.56 mL
HEPES pH 7.51M1 mL200 ml
NaCl5M1.5 mL300 ml
Spermidine solution  3.6 µl0.72 ml
Tween (10%)0.05%250 µl50 ml

The CelSeq2 adapters were ordered from IDT and are distributed according to this layout (same as CelSeq2 and VASA-seq) Download Celseq2_primers.xlsxCelseq2_primers.xlsx19KB
30m
Centrifuge the antibody stained sample at Centrifigation600 rcf, 4°C, 00:03:00  with the swinging buckets centrifuge. Respond the sample in Amount500 µL of WB (with 1:200 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).

Centrifuge the sample again at Centrifigation600 rcf, 4°C, 00:03:00  with the swinging buckets centrifuge.

Note
It's important to use the correct buffer (WB) to wash away the EDTA that was previously present, in order for the pA-MNase not be hampered after sorting.

6m
DAY 2: Sort, Protein A-MN treatment and activation
DAY 2: Sort, Protein A-MN treatment and activation
1d
1d
Resuspend the sample in Amount500 µL of WB (with 1:40 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ) + ProteinA-MN (600uL/mL, add 5uL every 1mL of WB) and Hoechst dye.

Note
We use our own in-house produced Protein A-MN. If producing your own, you might want to perform a titration the first time you use it.
For details of its production, see
Zeller, P., Yeung, J., Viñas Gaza, H. et al. Single-cell sortChIC identifies hierarchical chromatin dynamics during hematopoiesis. Nat Genet 55, 333–345 (2023). https://doi.org/10.1038/s41588-022-01260-3

Mix for Duration01:00:00 at Temperature4 °C on a roller in the dark.
Critical
Centrifuge the sample at Centrifigation600 rcf, 4°C, 00:03:00  with the swinging buckets centrifuge. Resuspend the sample in 500uL of WB (with 1:200 ReagentRNasin Plus Ribonuclease InhibitorsPromegaCatalog #N2615 ).
3m
Wash
Repeat this wash again. Go togo to step #20

Filter the sample through the blue caps filter of FACS tubes. Proceed to sorting. Keep samples in the dark and TemperatureOn ice
Sort single cells/nuclei in 384 well-plates containing mineral oil and Celseq2 adapters in WB2. Use the Hoechst and Celltracer dyes staining to identify the cells and distinguish each timepoints.
Label the plates as you sort them (We suggest adding Histone mark, Experiment, Sorting Order information in the labelling).
Note
We suggest sorting all populations in the same plate, and to sort them by columns (population x in column 1, 2, 3; population y in column 4, 5, 6; etc), rather than rows. These two provisions help counter possible inter-plate and intra-plate batch effects (due to the fact that the robots we use dispense row-wise, rather than column-wise).
We also suggest leaving a few empty wells as Negative Controls (we typically leave wells O21 to O24 and P21 to P24).

1h
Keep plates TemperatureOn ice
Immediately after sorting, seal the plates with ReagentSilverseal plate sealergreiner bio-oneCatalog #676090
Once sealed, immediately centrifuge Centrifigation2000 rcf, 4°C, 00:02:00 the plate, then move it on coolblocks TemperatureOn ice , or on 384-wells thermocyclers set at Temperature4 °C .

2m
Centrifigation
Critical
Prepare the WB2 + Concentration3 millimolar (mM) CaCl2 and the Stop Solution to start and (then) stop the MN digestion.

WB2 + CaCl2:
Prepare WB2
ABCD
Wash Buffer 2 Concentration Volume 50 mLVolume 10 mL
H2O RNAse free water 47.8 mL9.56 mL
HEPES pH 7.51M1 mL200 ml
NaCl5M1.5 mL300 ml
Spermidine 3.6 µl0.72 ml
Tween (10%)0.05%250 µl50 ml
Dilute CaCl2 solution ~1:1000 (or more) in the WB2 solution, to a final concentration of 3mM.


MNase Stop Solution:
ABCD
MNase Stop SolutionConcentrationVolume (1 plate)N+1 plates
H2O RNAse free water 50.25 µl 
EGTA0.5 M6 µl 
NP4010%11.25 µl 
Prot K Thermolabile 20 mg/mL7.5 µl 
MgCl21M0.94 µl 
Calculate margin when preparing the mix to account for the robot's dead volumes
ReagentThermolabile Proteinase KNew England BiolabsCatalog #P8111S

Note
Depending on the number of plates to be processed, there might be enough time left to prepare the Stop solution during the Digestion. Even in such case, we would still suggest to prepare the MNase Stop solution (without the Prot K) before starting the Digestion anyway, and only adding the enzyme during the Digestion.

15m
Dispense Amount0.1 µL of WB2 +  Concentration3 millimolar (mM) CaCl2 in each well to activate the MN.
We use a Nanodrop Liquid Handling machine for this step, and dispense into 2 plates, held in cool blocks, at the time.
As soon as plates have received the MNAse, seal each plate with Aluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
Transfer the plates to 384-wells thermocyclers set at Temperature4 °C for a Duration00:30:00 digestion.

Note
You should be able, with practice, to simultaneously dispense in a set of plates while centrifuging the pair that was just dispensed. If you can proceed at a steady pace (thus keeping the timing uniform), you would only need to time the first pair of plates, and then just proceed to the Digestion Stop in the same order and at the same pace.

Note
If timing allows, it would be good (and polite) to run a Daily Clean of the Nanodrop (~7/8 minutes) to remove any potential traces of the nuclease.

32m
Centrifigation
Critical
Stop the digestion of the plates by adding Amount0.1 µL of MNase Stop Solution to each well.
(Remember to add the Thermolabile Prot K, if not done previously)

We use a Nanodrop Liquid Handling machine for this step, and dispense into 2 plates, held in cool blocks, at the time.

Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
Once the centrifugation is complete, move plate to a 384-well thermocycler.

Note
Once done, you should run a Daily Clean of the Nanodrop (~7/8 minutes) to remove any potential traces of the Prot K for the next user(s).

2m
Centrifigation
Critical
Incubate the plate at Temperature4 °C for Duration00:20:00 , then Temperature37 °C for Duration02:00:00 , then Temperature55 °C for Duration00:20:00 and then hold at Temperature4 °C .
2h 40m
Once done, freeze all plates in a Temperature-80 °C . The plates can then be thawed and processed at any time.
Pause
DAY 3: RNA and DNA Fragment processing and DNA adapter ligation
DAY 3: RNA and DNA Fragment processing and DNA adapter ligation
1d
1d
Thaw the plates you plan to process TemperatureOn ice or at Temperature4 °C on pre-cooled thermocyclers.
Note
Reagents and plates should be kept cold, TemperatureOn ice or at Temperature4 °C as much as possible (including on the way from a machine to a centrifuge). Coolblocks are highly advisable.

Fragment RNA
Incubate the plates in a pre-warmed thermocycler at Temperature85 °C for Duration00:02:00 .
Immediately move plates to a pre-cooled thermocycler at Temperature4 °C .
Note
Carefully time this step to correctly fragment the RNA.

2m
Critical
Blunt End RNA fragments and Poly-A tailing
Prepare Mix1, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep TemperatureOn ice
ABCD
Mix11 cell (nL)1 plate (400 cells), uLN plates + 10%
T4 PNK1,212
polyA polymerase 0,1751,75
ATP (0.1mM)(1 in 100)0,888,75
Tris-HCl 1M pH82,828
50% PEG80000,757,5
BSA 20mg/mL0,0750,75
RNAse out110
KCl 1M330
DTT 0,1M220
MgCl2 1M0,151,5
H2O3,1231,2
Per well in strip18,93
ReagentT4 PNKNew England BiolabsCatalog # M0201L
ReagentE. coli Poly(A) PolymeraseNew England BiolabsCatalog #M0276L
ReagentAdenosine 5-Triphosphate (ATP) New England BiolabsCatalog # P0756L
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
ReagentMgCl2 1MThermofisherCatalog #AM9530G
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
15m
Dispense Mix1 with Nanodrop Liquid Handling Robot. Dispense Amount0.150 µL of Mix1 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
2m
Centrifigation
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at Temperature37 °C for Duration01:00:00 , and then hold at Temperature4 °C .
1h
First Strand cDNA synthesis of RNA fragments
Prepare Mix2, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep TemperatureOn ice
ABCD
Mix21 cell (nL)1 plate (400 cells), uLN plates + 10%
SSIII110
KCl 1M0,7511,25
DTT 0.1M0,57,5
dNTPs Mix (10mM)0,7511,25
50% PEG80000,57,5
BSA 20mg/mL0,050,75
H206,4596,75
Per well in strip18,125
ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
ReagentdNTPs MixPromegaCatalog #U1515
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
15m
Dispense Mix2 with Nanodrop Liquid Handling Robot. Dispense Amount0.100 µL of Mix2 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at Temperature50 °C for Duration01:00:00 , and then hold at Temperature4 °C .
1h
DNA fragment Blunt Ending
Prepare Mix3, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep TemperatureOn ice
ABCD
Mix31 cell (nL)1 plate (400 cells), uLN plates + 10%
Klenow large0,3253,25
NaCl 5M0,22
T4 PNK0,3253,25
TL Exo10,55
dNTPs Mix (10mM)0,3253,25
Tris-HCl 7,5pH1,7517,5
DTT 0,1M0,757,5
ATP 100mM0,656,5
MgCl2 1M0,252,5
50% PEG80000,757,5
BSA 20mg/mL0,0750,75
H209,191
Per well in strip18,75
Reagent DNA Polymerase I, Large (Klenow) FragmentNew England BiolabsCatalog # M0210L
ReagentT4 PNKNew England BiolabsCatalog # M0201L
ReagentThermolabile Exonuclease INew England BiolabsCatalog # M0568L
ReagentdNTPs MixPromegaCatalog #U1515
ReagentATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
ReagentDTT 0.1MInvitrogen - Thermo FisherCatalog #15846582 ReagentTris 1M pH 7.5ThermofisherCatalog #15567027
ReagentMgCl2 1MThermofisherCatalog #AM9530G
ReagentBSA 20ng/mLNew England BiolabsCatalog #B9000S
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932
15m
Dispense Mix3 with Nanodrop Liquid Handling Robot. Dispense Amount0.150 µL of Mix3 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .

2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at Temperature37 °C for Duration00:30:00 , then Temperature75 °C for Duration00:20:00 , and then hold at Temperature4 °C .

50m
A-tailing DNA fragments
Prepare Mix4, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep TemperatureOn ice
ABCD
mix41 cell (nL)1 plate (400 cells), uLN plates + 10%
Taq 3600,22,0
dATP 100mM0,22,0
KCl 1M110,0
50% PEG80000,757,5
BSA 20mg/mL0,0750,8
H2O12,775127,8
Per well in strip18,8
ReagentAmpliTaq™ 360 DNA PolymeraseThermo Fisher ScientificCatalog #4398828
ReagentdATPs 100mMPromegaCatalog #U1335
ReagentKCl 1MThermofisherCatalog #AM9640G
ReagentBSA 20mg/mLNew England BiolabsCatalog ##B9000
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932

15m
Dispense Mix4 with Nanodrop Liquid Handling Robot. Dispense Amount0.150 µL of Mix4 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .

2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at Temperature72 °C for Duration00:15:00 , and then hold at Temperature4 °C .

15m
Start thawing the adaptor master plate (TemperatureOn ice ). It's advisable to centrifuge it at Centrifigation2000 rcf, 4°C, 00:02:00 once it's thawed.
Start humidifying the Mosquito Liquid Handling robot (SPT Labtech).
2m
Adaptor Ligation DNA fragments
Using a Mosquito Liquid Handling robot (SPT Labtech) transfer 50nL of 5uM paired forked adaptors from each well of the adaptor master plate to the plate(s) being processed.
Note
Humidify the Mosquito to ~Humidity80 % to minimise the evaporation from the adaptor master plate!


These adaptors were purchased from IDT, paired (top and bottom strand) and annealed, diluted to the working concentrations and stored at -20C till used. Sequences and layout are in this table:Download ChIC_forked_adaptors.xlsxChIC_forked_adaptors.xlsx24KB
A more complete explanation of their design is in the Supplementary Information of the sortChIC paper from where they are derived:
Single-cell sortChIC identifies hierarchical chromatin dynamics during hematopoiesis
10m
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
2m
Go togo to step #33 Repeat the dispension with the other plates.
Note
Once the Mosquito is done transferring the adaptors to one set of plates, you can immediately start transferring the adaptors to a second set of plates while dispensing Mix5 to the set of plates that just finished.

Prepare Mix5, and aliquot it in a 8-well strip tube to dispense with the Nanodrop. Keep TemperatureOn ice
ABCD
Mix51 cell (nL)1 plate (400 cells), uLN plates + 10%
T4 ligase (40000U)3,535
MgCl2 1M0,353,5
DTT 0,1M6,7567,5
ATP 100mM0,353,5
Tris pH7.5 1M0,454,5
50% PEG80000,757,5
BSA 20mg/mL0,0750,75
H202,8528,5
Per well in strip18,84
ReagentT4 DNA LigaseNew England BiolabsCatalog #M0202L
ReagentMgCl2 1MThermofisherCatalog #AM9530G
ReagentDTT 0.1MInvitrogen - Thermo FisherCatalog #15846582
ReagentATP Solution (100 mM)Thermo Fisher ScientificCatalog #R0441
ReagentTris 1M pH 7.5ThermofisherCatalog #15567027
ReagentBSA 20mg/mLNew England BiolabsCatalog ##B9000
Reagent Invitrogen™ Nuclease-Free Water (not DEPC-Treated) Invitrogen - Thermo FisherCatalog #AM9932

15m
Dispense Mix5 with Nanodrop Liquid Handling Robot. Dispense Amount0.150 µL of Mix5 per each well.
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .

2m
Once the centrifugation is complete, move plate to a 384-well thermocycler. Incubate the plate at Temperature4 °C for Duration00:20:00 , then at Temperature16 °C for Duration16:00:00 , then Temperature65 °C for Duration00:10:00 , and then hold at Temperature4 °C .

16h 30m
Overnight
DAY 4: Pooling, Second Strand Synthesis, Amplification
DAY 4: Pooling, Second Strand Synthesis, Amplification
18h 4m
18h 4m
Pooling:
Add 1uL of nuclease-free Water in each well of each plate.

Note
We use a Nanodrop Liquid Handling Robot for this, but an iDOT or similar machines should be capable of the same movement.

5m
Once the dispension is complete, seal each plate with Alluminium plate sealer and proceed to centrifuge them at Centrifigation2000 rcf, 4°C, 00:02:00 .
2m
Prepare Pooling Plate(s)
Label each pooling plates so that they can be identified and connected with the plate they are to collect.
Pre-wet each pooling plate with Amount1 mL or Amount2 mL of filtered Mineral Oil. Tilt the plates until the oil has spread over the entire collection surface. We use ReagentVBLOK200 Reservoir, CaseClickBio, Inc.Catalog #CBVBLOK200-1 , but a clean, upside-down pipette tips box lid works as well .

15m
Place each plate upside down over a pooling plate.
Centrifuge them at up to Centrifigation2000 rcf, 4°C, 00:02:00 . Do not stack pooling plates on top of each other in the centrifuge.

Expected result
the plate should be empty, and the pooling plate should contain 2 separate liquids, with the acqeous phase below and the oil above.

2m
Centrifigation
For each plate, pool the aqueous phase in 2mL DNA-low-binding tubes. Centrifuge the tubes at Centrifigation2000 rcf, 00:01:00 (this is just to separate the acqueous phase form the oil).

5m
Take the lower aqueous phase and move it into a 1.5 mL DNA-low binding tube.
1m
Centrifuge the tubes Centrifigation2000 rcf, 00:01:00 again.
1m
Centrifigation
Take the lower aqueous phase and move it into a 1.5 mL DNA-low binding tube. During this pipetting step measure the volume.
2m
Clean up DNA using DNA beads
Add 0.8X µl (depending on volume of each sample) of DNA beads diluted 1 in 8 with bead binding buffer (1 M NaCl, 20% PEG8000, 20mM Tris pH8, 1 mM EDTA) and mix by pipetting.
Take the beads out of the fridge ~ Duration00:30:00 before using them
5m
Incubate for Duration00:15:00 at TemperatureRoom temperature .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
5m
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash Go togo to step #38.3
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in Amount17 µL of nuclease-free water (away from the magnet).
Let elute for Duration00:02:00 , then move back onto the magnet. Once the beads have coalesced on the side of the tube and the eluant is clear, move the eluant to a new tube.
4m
Second Strand Synthesis:
TemperatureOn ice !
Add Amount2 µL of 10X SSS buffer. Mix by vortexing and spin down.
1m
Add Amount1 µL of SSS Enzyme and mix by gently flicking the tube. Spin down
1m
Incubate at
Temperature16 °C for Duration02:30:00 , Temperature65 °C for Duration00:20:00 , then hold at Temperature4 °C
2h 50m
Add 1.3X µl of undiluted DNA beads (Amount26 µL ) and incubate for Duration00:15:00 at TemperatureRoom temperature
15m
Take out of the freezer the IVT reagents (except the enzyme) so they start thawing ~30min in advance of when they will be used.
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash Go togo to step #41.3
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in Amount8 µL of nuclease-free water (away from the magnet). Let elute for ~ Duration00:02:00
2m
IVT
Prepare the IVT mix (thaw the reagents (except the T7 enzyme) ~Duration00:30:00 in advance):
ABC
IVT Mix1 tubeN + 1 tube
ATP2 uL
GTP2 uL
CTP2 uL
UTP2 uL
T7 Buffer2 uL
T7 Enzyme2 uL
Add 12 µl of IVT mix to each tube of eluate with beads.
Incubate on a thermocycler at Temperature37 °C for Duration13:00:00 , with lid at Temperature70 °C . Then, hold at Temperature4 °C

13h 30m
Overnight
DAY 5: rRNA depletion, RNA adapter ligation, RT, PCR and final library
DAY 5: rRNA depletion, RNA adapter ligation, RT, PCR and final library
6h 29m 30s
6h 29m 30s
IVT bead cleanup
Move samples onto magnet rack.
Move supernatant to a new tube, and add 1.3X Ampure RNA beads (Amount26 µL ) and incubate for Duration00:10:00 at TemperatureRoom temperature
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
Repeat the 80% EtOH wash Go togo to step #41.3
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in Amount10 µL of nuclease-free water (away from the magnet). Let elute for ~ Duration00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, move the supernatant to a new tube.
rRNA depletion
Transfer Amount6 µL of the aRNA to a new tube TemperatureOn ice , and freeze the remaining eluant at Temperature-80 °C

Prepare the Hybridisation buffer - oligos mix:
Prepare the Hybridisation Buffer.
Note
We suggest preparing a large volume of the Hybridisation buffer once, aliquoting and storing it at Temperature-20 °C until needed.


AB
Hybridisation Buffer
NaCl 5M200 uL
Tris-HCl (1M), pH 7.5500uL
H2O300 uL

Optional
Mix the Hybridisation Buffer with the rRNA depletion Oligos (TemperatureOn ice )
ABC
1 tuben+1 tubes
Hybridization Buffer2 uL
rRNA-depletion oligos, 25uM2 uL

The rRNA depletion oligos that we used for the Zebrafish Ribosomes are these (ordered from IDT and pooled together): Download Zf_rRNA_dep_oligos.xlsxZf_rRNA_dep_oligos.xlsx15KB
2m
Add Amount4 µL of the Hybridisation Buffer + rRNA depletion Oligos mix to each tube.
Spin down and cool Temperature0 °C .
1m
Incubate tubes on a thermocycler at Temperature95 °C for Duration00:02:00 , then decrease the temperature to Temperature45 °C at a rate of 0.1C/s, then hold at Temperature45 °C
2m
Temperature
Prepare the RNAse mix:
Prepare the RNAse Buffer.
AB
RNAse Buffer
Tris-HCl (1M), pH 7.5500 uL
NaCl (5M) 200µl200 uL
MgCl2 (1M) 200µl200 uL
H20 3100µl3100 uL

Note
We suggest preparing a large volume of the RNAse buffer once, aliquoting and storing it at Temperature-20 °C until needed.

Optional
Prepare the RNAse Mix.
ABC
1 tuben+1 tubes
Epicentre (Lucigen) RNaseH (Thermostable)2 uL
RNAse buffer8 uL
Reagent Hybridase Thermostable RNase HBiosearch TechnologiesCatalog #H39500

2m
Incubate the RNAse Mix at Temperature45 °C for a few minutes (we suggest placing it in the same thermocycler as samples, once they are holding at 45C)

5m
While keeping both samples and Hybridise Mix on the thermocycler at Temperature45 °C , add Amount10 µL of the RNAse mix to each sample.
1m
Incubate the samples at Temperature45 °C for Duration00:30:00 .
30m
Spin down and cool TemperatureOn ice .
DNAse treatment (removal of depletion oligos)
Prepare the DNAse Mix:
ABC
1 tuben+1 tubes
Nuclease-free Water21 uL
CaCl2 (10mM)5 uL
Promega RQ1 DNAse4 uL
ReagentRQ1 RNase-Free DNasePromegaCatalog #M6101

Add Amount30 µL of DNAse Mix to each tube. Incubate at Temperature37 °C for Duration00:30:00 , then hold at Temperature4 °C .
30m
Start thawing Ampure RNA beads at TemperatureRoom temperature ~30 min before the Bead clean up.

Bead Cleanup
Add Amount80 µL of undiluted, pre-warmed RNA beads to each sample and incubate at TemperatureRoom temperature for Duration00:10:00 .
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
5m
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash Go togo to step #41.3
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in Amount6 µL of nuclease-free water (away from magnet). Let elute for ~ Duration00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer Amount5 µL of eluant to a new tube (TemperatureOn ice ).
Adapter ligation
Pre-heat a thermocycler to Temperature70 °C (with heated lid at Temperature105 °C ).
Add to each sample Amount1 µL of RA3(Concentration20 micromolar (µM) ).

RA3 (ordered from IDT): /5rApp/TGGAATTCTCGGGTGCCAAGG/3SpC3/
Heat adapter-sample-mix at Temperature70 °C for Duration00:02:00 and then directly put TemperatureOn ice

2m
Critical
Pre-heat a thermocycler to Temperature25 °C (with lid heated at Temperature25 °C or without the lid closed).
Prepare the Ligation Mix (TemperatureOn ice ):
ABC
1 tuben+1 tubes
NEB 10x T4 RNA Ligase Reaction Buffer1.1 µl 
NEB T4 RNA Ligase 2, truncated1.1 µl 
Invitrogen RNaseOUT1.1 µl 
Nuclease-free H2O1.1 µl 
ReagentNEB T4 RNA Ligase 2, truncatedNew England BiolabsCatalog #M0242L
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019

3m
 Add Amount4 µL of the Ligation mix to each tube, mix well by pipetting and spin down (keep TemperatureOn ice )

Incubate on thermocycler at Temperature25 °C for Duration01:00:00 (lid heated at 25°C or without the lid closed), then hold at Temperature4 °C .
1h
cDNA synthesis
Pre-heat a thermocycler to Temperature65 °C (with heated lid at Temperature105 °C ).
Prepare the dNTPs Mix (TemperatureOn ice ):
ABC
 1 tuben+1 tubes
Promega dNTP Mix (10 mM each)1 µl 
RTP (20 µM)2 µl 
ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
ReagentdNTPs MixPromegaCatalog #U1515

RTP (ordered from IDT): GCCTTGGCACCCGAGAATTCCA
Add Amount3 µL of the dNTPs to each tube.
Incubate on thermocycler at Temperature65 °C for Duration00:05:00 , then transfer tubes directly TemperatureOn ice .
5m
Prepare the Reverse Transcription Mix (TemperatureOn ice ):
ABC
 1 tuben+1 tubes
Invitrogen 5x FS Buffer 4 µl 
H2O1 µl 
Invitrogen 0.1M DTT1 µl 
Invitrogen RNaseOUT (40U/ µl)1 µl 
Invitrogen SS III (200U/ µl)1 µl 
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019 ReagentSuperScript™ III Reverse TranscriptaseFisher ScientificCatalog #18080085
Add Amount8 µL of the Reverse Transcription mix to each tube, mix well by pipetting and spin down (keep TemperatureOn ice ).
Incubate in a thermocycler at Temperature50 °C for Duration01:00:00 , then Temperature70 °C for Duration00:15:00 , and then hold at Temperature4 °C (with lid heated at Temperature85 °C ).
1h 15m
RNA degradation 
Add Amount1 µL of ReagentRNAse AThermo ScientificCatalog #EN0531 to each tube.
Incubate on thermocycler at Temperature37 °C for Duration00:30:00 , then hold at Temperature4 °C (with heated lid at Temperature70 °C )
30m
Start thawing Ampure DNA beads at TemperatureRoom temperature ~30 min before the next Bead clean up.
Bead Cleanup
Add Amount22 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at TemperatureRoom temperature for Duration00:10:00 .
10m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add Amount1 mL of 80% EtOH to each sample. incubate for Duration00:00:30

30s
Remove the supernatant.
1m
Repeat the 80% EtOH wash Go togo to step #52.2
1m
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
10m
Resuspend in Amount20 µL of nuclease-free water (away from magnet). Let elute for ~ Duration00:02:00
2m
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer Amount20 µL of eluant to a new tube (TemperatureOn ice ).
2m
Split the eluant in 2 tubes. Store half (Amount10 µL ) at Temperature-20 °C , and continue with the other Amount10 µL .
2m
PCR amplification
Prepare the PCR Mix:
ABC
 1 tuben+1 tubes
NEBNext High-Fidelity 2X PCR Master Mix25 µl 
RP12 µl 
H2O (nuclease free)11 µl 
ReagentNEBNext® High-Fidelity 2X PCR Master MixNew England BiolabsCatalog #M0541L

RP1 (Illumina RNA PCR Primer 1):
5’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
3m
Add Amount36 µL of the PCR Mix to each 10uL sample.
1m
To each sample, add Amount2 µL of one Illumina TruSeq Small RNA Index Adapter (RPI Series). When choosing indexes, keep in mind your sequencing arrangements (it's not advisable to have 2 samples with the same index, even if they come from different organisms).

Note
We usually avoid the following indexes: RPI10, RPI24, RPI41

Adaptor sequences (Illumina TruSeq Small RNA Index Adapter, RPI Series) are here : Download Illumina_RPI_sequences.xlsxIllumina_RPI_sequences.xlsx9KB
1m
Incubate at Temperature98 °C for Duration00:00:30 ,
then run either 7 or 8 cycles of: Temperature98 °C for Duration00:00:10 , Temperature60 °C for Duration00:00:30 , Temperature72 °C for Duration00:00:30 ;
then Temperature72 °C for Duration00:10:00 ,
and finally hold at Temperature4 °C
30m
PCR
Pause
Bead Cleanup
Add Amount40 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at TemperatureRoom temperature for Duration00:15:00 .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
Repeat the 80% EtOH wash Go togo to step #54.2
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
Resuspend in Amount25 µL of nuclease-free water (away from magnet). Let elute for ~ Duration00:02:00
Place sample in magnet rack, once the beads have coalesced on the side of the tube and the eluant is clear, transfer Amount25 µL of eluant to a new tube.
Bead Cleanup
Add Amount20 µL of undiluted, pre-warmed Ampure XP beads to each sample and incubate at TemperatureRoom temperature for Duration00:15:00 .
15m
Move eppendorfs on a magnet rack and, once the beads have coalesced on the side of the tube and the supernatant is clear, remove the supernatant.
Add Amount1 mL of 80% EtOH to each sample. Incubate for Duration00:00:30

30s
Remove the supernatant.
Repeat the 80% EtOH wash Go togo to step #55.2
Dry up the beads (until they should lose their shimmer, up to Duration00:10:00 . Drying time is influenced by the humidity. Over and under drying leads to material loss!!)
Resuspend in Amount10 µL of nuclease-free water (away from magnet). Let elute for ~ Duration00:02:00
Place each sample in magnet rack. Once the beads have coalesced on the side of the tube and the eluant is clear, transfer Amount10 µL of eluant to new tubes.
Label these tubes carefully for they contain the final library. Store at -20C if not planning on measuring concentration and size distribution soon,

Pause
Measure the concentration with a Qubit High Sensitivity DNA assay.
Measure the distribution of lengths of the library with a High Sensitivity DNA Bioanalyser.
Store at -20C if not planning on sequencing soon.

Expected result
the concentration should be greater than 1ng/uL, and the average length should be around 500-600nt.
Example library size distribution with a High Sensitivity DNA Bioanalyser.
The peaks, particularly evident in B, are due to the ChIC fraction of the library. The smoother curve is due to the RNA fraction of the library.


Proceed to sequence each library at a depth of ~60M reads per plate.
Note
We have used Ilumina NextSeq 2000 or Novaseq 6000, 2 x 100 bp, with 10% PhiX spike in, low complexity region: NNNNNNNNNNNTNNNNNNNNNNN .