Mar 08, 2019
Version 8
Single-cell mapping of lineage and identity via CellTagging V.8
- Brent A. Biddy1,2,3,
- Wenjun Kong1,2,3,
- Kenji Kamimoto1,2,3,
- Chuner Guo1,2,3,
- Sarah Waye1,2,3,
- Tao Sun1,2,3,
- Samantha A Morris1,2,3
- 1Department of Developmental Biology;
- 2Department of Genetics;
- 3Center of Regenerative Medicine. Washington University School of Medicine in St. Louis. 660 S. Euclid Avenue, Campus Box 8103, St. Louis, MO 63110, USA.
- Human Cell Atlas Method Development Community
- Morris Lab
Protocol Citation: Brent A. Biddy, Wenjun Kong, Kenji Kamimoto, Chuner Guo, Sarah Waye, Tao Sun, Samantha A Morris 2019. Single-cell mapping of lineage and identity via CellTagging. protocols.io https://dx.doi.org/10.17504/protocols.io.yxifxke
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 08, 2019
Last Modified: March 08, 2019
Protocol Integer ID: 21194
Keywords: cell barcoding, lineage tracing, single-cell analysis, direct lineage reprogramming
Abstract
Single-cell technologies are offering unprecedented insight into complex biology, revealing the behavior of rare cell populations that are typically masked in bulk population analyses. One current limitation of single-cell approaches is that lineage relationships are lost as a result of cell processing, restricting interpretations of the data collected. Elegant computational approaches have been developed in an effort to infer these missing observations, but it remains a challenge to reconstruct true reprogramming trajectories using these tools. Although sophisticated lineage tracing solutions to connect cell history with fate are emerging, these protocols are either not compatible with high-throughput scRNA-seq, or require genome editing strategies that are not readily deployed in some systems. Here, our protocol describes a single-cell resolution clonal tracking approach, ‘CellTagging’, based on combinatorial cell indexing, permitting the parallel capture of lineage information and cell identity. CellTagging integrates with high-throughput single-cell RNA-sequencing, where iterative rounds of cell labeling enable the construction of multi-level lineage trees. This straightforward lentiviral-labeling approach can be applied to an array of cell biological applications to simultaneously profile lineage and identity, at single-cell resolution.
Materials
STEP MATERIALS
Pooled CellTag Library V1addgeneCatalog #115643
Pooled CellTag Library V2addgeneCatalog #115644
Pooled CellTag Library V3addgeneCatalog #115645
Stellar Competent CellsTakara Bio Inc.Catalog #636763
QIAGEN Plasmid Plus Mega KitQiagenCatalog #12981
293T cell lineATCCCatalog #CRL-3216
X-tremeGENE™ 9 DNA Transfection ReagentMerck MilliporeSigma (Sigma-Aldrich)Catalog #6365779001
pCMV-VSV-GaddgeneCatalog #8454
pCMV-dR8.2 dvpraddgeneCatalog #8455
Protamine SulfateMerck MilliporeSigma (Sigma-Aldrich)Catalog #P3369-10G
TrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
2x Kapa HiFi Hotstart Readymix Kapa BiosystemsCatalog #KK2602
Agencourt Ampure XPBeckman CoulterCatalog #A63880
High Sensitivity D5000 ScreenTapeAgilent TechnologiesCatalog #5067-5592
High Sensitivity D5000 ReagentsAgilent TechnologiesCatalog #5067-5593
Protocol materials
Stellar Competent CellsTakara Bio Inc.Catalog #636763
pCMV-dR8.2 dvpraddgeneCatalog #8455
Protamine SulfateMerck MilliporeSigma (Sigma-Aldrich)Catalog #P3369-10G
pCMV-VSV-GaddgeneCatalog #8454
Pooled CellTag Library V1addgeneCatalog #115643
Pooled CellTag Library V2addgeneCatalog #115644
TrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
2x Kapa HiFi Hotstart Readymix Kapa BiosystemsCatalog #KK2602
QIAGEN Plasmid Plus Mega KitQiagenCatalog #12981
X-tremeGENE™ 9 DNA Transfection ReagentMerck MilliporeSigma (Sigma-Aldrich)Catalog #6365779001
Agencourt Ampure XPBeckman CoulterCatalog #A63880
High Sensitivity D5000 ScreenTapeAgilent TechnologiesCatalog #5067-5592
High Sensitivity D5000 ReagentsAgilent TechnologiesCatalog #5067-5593
Pooled CellTag Library V3addgeneCatalog #115645
293T cell lineATCCCatalog #CRL-3216
Pooled CellTag Library V3addgeneCatalog #115645
Pooled CellTag Library V1addgeneCatalog #115643
Pooled CellTag Library V2addgeneCatalog #115644
Stellar Competent CellsTakara Bio Inc.Catalog #636763
QIAGEN Plasmid Plus Mega KitQiagenCatalog #12981
2x Kapa HiFi Hotstart Readymix Kapa BiosystemsCatalog #KK2602
Agencourt Ampure XPBeckman CoulterCatalog #A63880
High Sensitivity D5000 ScreenTapeAgilent TechnologiesCatalog #5067-5592
High Sensitivity D5000 ReagentsAgilent TechnologiesCatalog #5067-5593
293T cell lineATCCCatalog #CRL-3216
X-tremeGENE™ 9 DNA Transfection ReagentMerck MilliporeSigma (Sigma-Aldrich)Catalog #6365779001
pCMV-VSV-GaddgeneCatalog #8454
pCMV-dR8.2 dvpraddgeneCatalog #8455
Protamine SulfateMerck MilliporeSigma (Sigma-Aldrich)Catalog #P3369-10G
TrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
Safety warnings
For generation of lentivirus, follow BSL2 safety precautions.
Amplification of pooled CellTag libraries
Amplification of pooled CellTag libraries
Note
In this first part of the protocol, we describe the amplification of pooled CellTags by liquid culture to maintain library complexity. CellTag libraries are available from Addgene: https://www.addgene.org/pooled-library/morris-lab-celltag/. For analysis of clonal dynamics with a single round of CellTagging, we recommend the V1 pooled library. For multiple rounds of CellTagging to support lineage reconstruction, pooled libraries V2 and V3 should also be obtained.
Pooled CellTag Library V1addgeneCatalog #115643
Pooled CellTag Library V2addgeneCatalog #115644
Pooled CellTag Library V3addgeneCatalog #115645
Thaw Stellar Competent Cells in an ice bath just before use.
Stellar Competent CellsTakara Bio Inc.Catalog #636763
After thawing, mix 100 µL of cells with 10-50ng of pooled CellTag DNA in a 1.5-mL microcentrifuge tube.
Place transformation mixture on ice for 00:30:00
Heat shock the cells for 60 seconds at 42 °C
Place tube on ice for 00:01:00
Add SOC medium to bring the final volume to 1000 µL
Incubate by shaking (~250 rpm) for 01:00:00 at 37 °C
Take 5 µL of the recovery. Prepare serial dilutions from 1:10 to 1:1000 and plate onto LB + Ampicillin plates. Spread the sample evenly over the plate so that the bacterial colonies are easy to count. Grow overnight at 37 °C
Add the rest of the recovery to 500 mL of LB + Ampicillin. Grow overnight while shaking (~250 rpm) at 37 °C
Following overnight incubation, count the number of colonies on the plates to calculate the number of colony forming units (CFUs). To maintain CellTag library complexity, aim for 100-200 CFUs per unique CellTag in the library.
Note
Number of unique CellTags contained in each pooled library from Addgene:
CellTag-V1: 19,973 CellTags
CellTag-V2: 4,934 CellTags
CellTag-V3: 5,737 CellTags
Harvest the cells from the liquid culture and use Qiagen Megaprep columns (Or multiple Maxiprep columns) to purify the library.
QIAGEN Plasmid Plus Mega KitQiagenCatalog #12981
Assessment of CellTag library complexity via sequencing
Assessment of CellTag library complexity via sequencing
Note
In this next phase of the protocol, the above CellTag library is prepared and sequenced to assess complexity. This step is recommended in order to create a 'whitelist' of CellTags existing in the library, facilitating downstream analysis to enhance sensitivity and specificity of clone calling and lineage reconstruction.
PCR amplification of the CellTag region in pSMAL
2x Kapa HiFi Hotstart Readymix Kapa BiosystemsCatalog #KK2602
Add to each PCR tube:
25 µL of 2x Kapa HiFi Hotstart Readymix
1.5 µL of 10 uM forward CellTag sequencing primer
1.5 µL of 10 uM reverse CellTag sequencing primer
20 ng of CellTag plasmid library from Step 12
Note
Forward CellTag sequencing primer:
5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT CATGGACGAGCTGTACAAGTAA3'
This forward primer contains the Illumina P5 adapter and Seq1 sequences
Reverse CellTag sequencing primer:
5’CAAGCAGAAGACGGCATACGAGATACAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGCAGGGGAAAGAATAGTAGAC3’
This reverse primer contains the Illumina P7 adapter, Seq2 sequence, and an index, "ACAGT" to support sample multiplexing
Run this PCR program:
95 °C 00:03:00
12 cycles of:
98 °C 00:00:20
65 °C 00:00:15
72 °C 00:00:20
Then:
72 °C 00:01:00
4 °C forever
Purification of the tagmented library and analysis on the Tapestation:
Vortex the bottle of AMPure beads to mix.
Agencourt Ampure XPBeckman CoulterCatalog #A63880
Add 30 µL of room temperature AMPure XP beads to each PCR tube of sample. This is a .6x beads to sample ratio. Purify according to manufacturer’s instructions and elute in10 µL H2O.
Run a Tapestation High Sensitivity d5000 tape according to the manufacturer’s instructions. Use 1 µL of the purified cDNA sample as input.
High Sensitivity D5000 ScreenTapeAgilent TechnologiesCatalog #5067-5592
High Sensitivity D5000 ReagentsAgilent TechnologiesCatalog #5067-5593
Expected result
Representative Tapestation data for CellTag-V1 library preparation
Sequence on Illumina MiSeq, according to the manufacturer’s instructions.
Sequence analysis to generate CellTag Whitelist, see https://github.com/morris-lab for code and tutorials.
Production of CellTag lentivirus
Production of CellTag lentivirus
Safety information
Follow BSL2 safety precautions.
Day 0: Plate 293T cells at 50-60% confluency, on a 10cm plate.
293T cell lineATCCCatalog #CRL-3216
Note
293T cell culture medium:
DMEM
10% FBS
Day 1: change media ~ two hours prior to transfection.
Transfection: prepare two 1.5ml Eppendorf tubes with the following:
(1) 200 µL DMEM <- add 15 µL X-tremeGENE9 directly to the media
(2) 200 µL DMEM + CellTag plasmid ( 2ug ) + pCMV-VSV-G (200 ng) + pCMV-dR8.2 dvpr (2 ug)
X-tremeGENE™ 9 DNA Transfection ReagentMerck MilliporeSigma (Sigma-Aldrich)Catalog #6365779001
pCMV-VSV-GaddgeneCatalog #8454
pCMV-dR8.2 dvpraddgeneCatalog #8455
Transfer DMEM+DNA to DMEM+X-tremeGENE9 and mix by pipetting, incubate at room temperature for 00:15:00
Add DMEM+DNA+X-tremeGENE9 mix dropwise to the cell culture plate. Gently push plate back-and-forth, side-to-side to evenly distribute the transfection reagents.
Day 2: Change media
Day 3: First virus harvest
Collect cell supernatant and filter through a low-protein-binding 0.45uM syringe filter to remove cell debris.
Add fresh media to cells
Day 4: Second virus harvest
Collect cell supernatant and filter through a low-protein-binding 0.45uM syringe filter to remove cell debris.
Discard cells
Virus is ideally used as fresh as possible. It can be stored at 4 °C for a few days or at -80 °C for longer-term storage.
Titre virus according to https://www.addgene.org/protocols/fluorescence-titering-assay/. Flow cytometry can be used to more accurately assess virus titre. Alternatively, our imaging-based titration software can be used: see https://github.com/morris-lab for code and tutorials.
Transduction of cells with CellTag lentivirus
Transduction of cells with CellTag lentivirus
Note
In this phase of the protocol, we outline the transduction of mouse embryonic fibroblasts (MEFs) with the CellTag virus libraries, generated in the prior steps. These following steps are highly-dependent on the properties of the cells to be CellTagged. We will note major considerations to make in terms of experimental design. So far, we have successfully CellTagged and traced MEFs, mouse endoderm progenitors, human embryonic kidney, human endothelial, and mouse pre-B cells.
Day 1
Plate MEFs at a density of 50,000 cells in a well of a 6-well plate, on 0.1% gelatin.
Note
The starting number of cells is an extremely important consideration: to maximize the number and size of clones that can be detected and traced, we recommend keeping the starting cell population to be CellTagged relatively small. The downstream choice of single-cell capture platform is also important to consider here. For example, platforms with a higher cell capture efficiency require fewer cells to be loaded, therefore supporting the plating and culture of smaller numbers of cells in these early stages.
Day 2
Transduce cells with the CellTag viral library overnight. We transduce cells with fresh viral supernatant, with the addition of protamine sulfate. Polybrene can also be used to enhance transduction efficiency.
Protamine SulfateMerck MilliporeSigma (Sigma-Aldrich)Catalog #P3369-10G
Note
We transduce MEFs at a multiplicity of infection (MOI) of around 3-4. This results in each cell expressing a unique combination of CellTags, increasing the confidence of downstream clone calling. We do not track cells expressing fewer than 2 CellTags. With an MOI of ~3, we find that around 70% of MEFs express 2 or more CellTags.
We use fresh viral supernatant for this step. For some cell types, the media is not compatible, or the cells are sensitive to supernatant. In these cases, we recommend concentration of CellTag viral particles via ultracentrifugation, followed by resuspension in fresh media. In our experience, MEFs, 293Ts, and B-cells respond well to viral transduction with supernatant. Difficult to transduce cells may also benefit from viral concentration and spinfection.
Day 3
Change media. At this stage, GFP expression should start to be visible. Culture cells for a further 48 hours at which point almost all cells should be GFP positive.
CellTagged fibroblasts expressing GFP, 48 hours post-transduction
Note
In initial experiments, we recommend a 'trial run' to assess cell response to CellTagging and any potential viral silencing. Culturing MEFs over a 10 week period, we observe that CellTag expression becomes weaker but is not completely silenced. This can be assessed visually, or via flow cytometry, or sequencing as outlined below.
Cell harvest and replating for clonal tracking
Cell harvest and replating for clonal tracking
Note
In this phase of the protocol, cells are cultured and portions periodically harvested for single-cell RNA-sequencing. The remaining cells should be replated to support clonal expansion. Here, the frequency of sampling and detection of clones is highly dependent on the growth properties of the cells being studied. For example, many clones will be detected from early stages in fast-growing cells. For slow-growing cells, or protocols involving transition of cells to post-mitotic cells, fewer and smaller clones will be detected.
Harvest cells for single-cell RNA-sequencing. For MEFs, we wash cells in calcium- and magnesium-free PBS, followed by gentle dissociation in TryplE Express, followed by washing in DMEM+10% FBS.
TrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
Following cell counting, methanol fix minimum of 10,000 cells. Replate the remaining cells for continued clonal expansion.
Methanol fixation protocol:
Alles, J. et al. Cell fixation and preservation for droplet-based single-cell transcriptomics. BMC Biol. 15, 44 (2017) (https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-017-0383-5)
Note
For timecourse analyses, we recommend fixation of cells followed by single-cell processing and library preparation within the same batch.
For single-cell processing via 10x Genomics, we methanol fix a minimum of 10,000 cells per sample. Ideally, 25,000 cells are fixed to yield ~10,000 single-cell transcriptomes per sample. For Drop-seq, we fix a minimum of 100,000 per sample. We have found that methanol fixation works well for MEFs, B-cells, and 293Ts but performance can vary depending on cell type. We recommend that this is assessed for each cell type.
To support lineage reconstruction, replated cells can be further CellTagged with V2 and V3 libraries. For MEFs, we CellTagged cells with the V2 library 5 days following V1 CellTagging. We followed this with the V3 library 15 days after V1 CellTagging. Again, this is highly cell-type and protocol dependent.
Note
Analysis of clonal expansion can be achieved with one round of tagging with the CellTag V1 pooled library. For more complex lineage reconstruction to support the detection of lineage bifurcations, we recommend subsequent CellTagging with V2 and V3 pooled libraries. For lineage reconstruction, it is critical to use these different libraries which contain unique motifs to support CellTag demultiplexing and reconstruction in downstream analyses.
Following harvest of all samples, cells should be processed for single-cell capture, library preparation, and sequencing using 10x Genomics or Drop-seq platforms, according to the standard protocols. CellTag transcripts are effectively captured via these standard workflows and no additional steps are required.
For fixed cell rehydration, please refer to: https://support.10xgenomics.com/single-cell-gene-expression/sample-prep/doc/demonstrated-protocol-methanol-fixation-of-cells-for-single-cell-rna-sequencing
Note
On both the 10x Genomics and Drop-seq platforms, we aim to sequence cells to a depth of at least 30,000 reads per cell. Overall, keeping the cell population size relatively small and the proportion of these cells sequenced high, this will increase the number and size of clones detected.
Single-cell analysis, clone-calling, and lineage reconstruction
Single-cell analysis, clone-calling, and lineage reconstruction
Visit http://celltag.org/ to explore our dataset on the dynamics of reprogramming, reconstructed via CellTagging.
Our raw data is available here:
Dataset
Biddy et al., Single-cell mapping of lineage and identity in dir
NAME