Oct 12, 2021
Single cell CUT and Tag on 10x genomics platform
- Marek Bartosovic1,
- Goncalo Castelo-Branco1
- 1Karolinska Institute Stockholm
External link: https://doi.org/10.1038/s41587-021-00869-9
Protocol Citation: Marek Bartosovic, Goncalo Castelo-Branco 2021. Single cell CUT and Tag on 10x genomics platform. protocols.io https://dx.doi.org/10.17504/protocols.io.bqbnmsme
Manuscript citation:
https://www.biorxiv.org/content/10.1101/2020.09.02.279703v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: December 02, 2020
Last Modified: October 12, 2021
Protocol Integer ID: 45134
Keywords: CUT&Tag, single-cell CUT&Tag, scCUT&Tag, scATAC
Abstract
scCU&Tag on 10x platform uses scCUT&Tag protocol from Steven Henikoff's lab (Kaya-Okur et al., 2019), and scATAC-seq chromium platform (10x Genomics) to perform single-cell barcoding. The method can be used to obtain high quality data for tens of thousands of single cells with high specificity.
See also accompanying BiorXiv preprint https://www.biorxiv.org/content/10.1101/2020.09.02.279703v1 for more details.
scCUT&Tag can be performed on cell lines or freshly isolated cells from primary tissue.
Materials
Ultra pure DNAse/RNAse free water (ThermoFisher, 10977015)
1M Hepes (Alfa Aesar, J60712)
5M NaCL (Invitrogen, AM9759)
Spermidine (Sigma, S2626-1G)
Complete EDTA-free protease inhibitors (Sigma, 11873580001)
BSA powder (Sigma, A9418-50G)
0.5M EDTA (Invitrogen, AM9260G)
Digitonin powder (Merck, CAS 11024-24-1)
NP-40 (ThermoFisher, 85124)
1M MgCl2 (Invitrongen, AM9530G)
10% SDS (ThermoFisher, 15553027)
Proteinase K (Invitrogen, AM2546)
2x NEBNext High-Fidelity PCR master mix (NEB, M0541S)
SYBR green (dilute to 10x) (ThermoFisher, S7563)
Secondary antibody guinea pig anti-rabbit (Novus Biologicals, NBP1-72763)
pA-Tn5 pre-loaded with standard Tn5 adapter sequences (as in Kaya-Okur et al., 2020)
Primary antibody of choice
H3K4me3 (Diagenode, C15410030)
H3K27ac (Abcam, Ab177178)
H3K27me3 (Cell Signalling, 9733T)
H3K36me3 (Abcam, Ab9050)
Rad21 (GeneTex, GTX106012)
Olig2 (Novus Biologicals, NBP1-28667)
Oligonucleotide sequences:
Mosaic end-adapter A (Tn5ME-A) TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Mosaic end-adapter B (Tn5ME-B) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Mosaic-end reverse oligonucleotides (Tn5MErev) 5'-[phos]CTGTCTCTTATACACATCT-3'
PCR primers (as in Buenrostro et al.) 
adapter sequences.xlsx
adapter sequences.xlsx pA-Tn5 loading protocol In house Tn5 assembly updated version.docx
In house Tn5 assembly updated version.docx Buffers prep protocol buffers_v4.xlsx
buffers_v4.xlsx Tn5 loading
Tn5 loading
2h
2h
Dilute Tn5ME-A, Tn5ME-B and Tn5ME-rev oligos to 100uM
Mix in two separate PCR tubes
1. 10ul Tn5ME-A + 10ul Tn5ME-rev
2. 10ul Tn5ME-B + 10ul Tn5ME-rev
Denature on a thermocycler for 5 min at 95°C, and cool down slowly on the thermocycler by ramping down by 0.1C/s
Prepare 2x dialysis buffer:
100mM HEPES-KOH pH7.2
200 mM NaCl
0.2 mM EDTA
2mM DTT*
0.2% Triton-X
20% Glycerol
* DTT is toxic and should only be added to the stock solution immediately prior to use (e.g. 45 ul buffer + 5 ul DTT)
Keep buffer at 4 °C
Mix Tn5 with the annealed oligonucleotides:
Tn5ME-A/Tn5ME-rev 2 ul
Tn5ME-B/Tn5ME-rev 2 ul
Glycerol 21.56 ul
2x Dialysis buffer 21.3 ul
Tn5 (3.5 mg/ml) 3.14 ul
total 50 ul
Mix gently with pipette and incubate for 1h at room temperature.
Store enzyme at -80C long term. Keep working stock at -20C.
Test small batch of Tn5 and if the loading is successful, scale up the loading reaction.
Buffers preparation
Buffers preparation
30m
30m
Nuclei preparation and primary antibody incubation
Nuclei preparation and primary antibody incubation
30m
30m
Dissociate your tissue/ cell line into a single-cell (single-nuclei) suspension and count your cells using manual counting chamber. We generally use between 150,000-250,000 cells as input from fresh samples and up to 500,000 nuclei extracted from frozen tissue.
If FACS sorting from a dissociated tissue, sort directly into eppendorf tubes with 500 ul of the antibody buffer cooled to 4 degrees.
Centrifuge cells/nuclei for 5 minutes at 300x g. Resuspend in 200 ul of Antibody buffer and centrifuge again 3 minutes at 600x g.
Note
Perform all incubations and centrifugations in 0.5ml standard eppendorf tubes.
Use swinging bucket rotor centrifuge with adapters for 0.5ml tubes. Centrifugation in fixed angle rotor centrifuge leads to higher nuclei loss during centrifugation.
Prepare 1:50 dilution of primary antibody in 200 ul of antibody buffer per sample.
Resuspend the pelleted nuclei in 100 ul of the antibody buffer
Note
We have validated following antibodies work for scCUT&Tag:
H3K4me3 (Diagenode, C15410030)
H3K27ac (Abcam, Ab177178)
H3K27me3 (Cell Signalling, 9733T)
H3K36me3 (Abcam, Ab9050)
Rad21 (GeneTex, GTX106012)
Olig2 (Novus Biologicals, NBP1-28667)
Incubate the cells with primary antibody overnight at 4 degrees on rotating wheel or roller with slow rotation speed.
Overnight
Secondary antibody incubation
Secondary antibody incubation
1h 30m
1h 30m
Centrifuge the nuclei, 3minutes at 600x g.
Remove supernatant. Wash once with 200ul of Dig-wash buffer.
Centrifuge 3 minutes at 600x g
Remove the supernatant.
Prepare 200ul of 1:50 diluted secondary antibody per sample in Dig-Wash-BSA buffer.
Resuspend the nuclei in 200 ul of diluted secondary antibody.
Note
We use guinea pig anti rabbit secondary antibody for rabbit primary.
Guinea pig anti-rabbit (Novus Biologicals, NBP1-72763)
Incubate 1 hour 01:00:00 rotating at room temperature.
1h
pA-Tn5 incubation
pA-Tn5 incubation
1h 30m
1h 30m
Centrifuge 3 minutes at 600x g
Remove the supernatant. Resuspend in 200 ul of Dig-300-BSA wash.
Repeat the wash-centrifugation 2 more times for total of 3 washes
Prepare 200 ul of 1:100 diluted pA-Tn5 in Dig-300-BSA buffer per sample.
Resuspend the pellet in 200 ul of diluted pA-Tn5
Incubate for 1 hour 01:00:00 rotating at room temperature
1h
Tagmentation
Tagmentation
1h 30m
1h 30m
Centrifuge 3 minutes at 300x g
Remove the supernatant. Resuspend in 200 ul of Dig-300-BSA wash.
Repeat the wash-centrifugation 2 more times for total of 3 washes
Resuspend the nuclei in 200ul of tagmentation buffer. Incubate 1hour 01:00:00 at 37 degres in water bath or thermomixer.
Tap the tubes 3-4 times during the incubation to prevent nuclei sedimentation
Note
The tagmentation buffer does not contain BSA, so excessive clumping of nuclei can occur, depending on the sample. If that is the case, 1% final BSA can be added to the tagmentation buffer.
1h
Prepare 1x Diluted nuclei buffer (DNB) supplemented with 2%BSA
Prepare STOP buffer by mixing 200ul of Dig-300 buffer with 10 ul of 500mM EDTA per sample.
Note
The 10x scATAC kit provides 20x diluted nuclei buffer (DNB). We routinely prepare 2x DNB by mixing 900ul of dH2O + 100ul of 20xDNB and store at -20 degrees. Then on the day of experiment we mix 500ul of 2x DNB + 400ul of dH2O + 100ul of 20%BSA to prepare 1xDBB+2%BSA.
Note
We have successfully used 1xPBS + 1%BSA instead of 1x DNB+2%BSA. We did not observe any difference in nuclei clumping or data quality.
Add 200ul of STOP buffer and mix well by pipetting up and down several times.
Note
Final 0.5 % final BSA, critical, otherwise the nuclei would clump during the centrifugation
Centrifuge for 3 minutes at 300x g.
Wash the nuclei with 200 ul of 1xDNB+BSA
qPCR cycle check of bulk library15 steps
At this stage success of tagmentation can be checked by generating bulk library from part of the sample and performing qPCR.
qPCR cycle check (optional)
qPCR cycle check (optional)
2h
2h
While nuclei are in 200ul of DNB, take 10% (20 ul) in a new tube, add 73 ul of water, 5 ul of 10%SDS and 2ul of proteinase K. Mix well by pipetting up and down 5x.
Keep the remaining nuclei on ice for about 2 hours during optional cycle check. This does not influence efficiency of scCUT&Tag.
Incubate for 30 minutes 00:30:00 at 50 degrees.
30m
Purify the DNA using ZYMO DNA Clean an Concentrator-5 kit. Use 1:5 ratio of binding buffer.
Elute the DNA in 25 ul of elution buffer.
Mix qPCR reaction:
Fw primer ATAC* 2ul
Rev primer ATAC* 2ul
water 8.5 ul
10xSYBR 2.5 ul
2x NEBnext MM 25 ul
eluted DNA template 10ul
total 50 ul
*Indexed primers described by Buenrostro, J.D. et al. Single-cell chromatin accessibility reveals principles of regulatory variation. Nature 523:486 (2015).
Run qPCR program:
1. 72C 5min
2. 98C 1min
3. 98C 15s
4. 63C 10s (data collection)
5. GOTO 3 39x
Typical successful experiment has CT value in < 15 and can be easily distinguished from failed runs where CT > 20.
Counting the nuclei
Counting the nuclei
Centrifuge the nuclei for 3 minutes at 300x g.
Resuspend the nuclei in 15-25ul of1xDNB+2%BSA
Count the nuclei using manual counting chamber.
Use 2ul of Nuclei suspension + 8ul of trypan blue in 2 replicates
Calculate nuclei concentration and refer to the 10x scATAC-seq manual regarding concentration and volume required for chromium chip loading for desired yield.
Note
scCUT&Tag is compatible with
Chromium Single Cell ATAC Reagent Kits (v1)
or
Chromium Next GEM Single Cell ATAC Reagent Kits (v1.1 )
10x scATAC-seq protocol
10x scATAC-seq protocol
1h 30m
1h 30m
Skip Step 1 in the scATAC-seq manual, start at Step 2 GEM Generation and barcoding
If using scATAC-seq kit v1.1, thaw ATAC buffer B
Prepare master mix:
scATAC v1:
Nuclei suspension 15 ul
Barcoding reagent 61.5 ul
Reducing agent B 1.5 ul
Barcoding Enzyme 2 ul
scATAC v1.1:
Nuclei suspension 8 ul
ATAC buffer B 7 ul
Barcoding reagent B 56.5 ul
Reducing agent B 1.5 ul
Barcoding Enzyme 2 ul
Note
scATAC v1.1 requires ATAC buffer B from Step 1 to be added to the master mix.
Load the 10x chromium chip according to manufacturers instructions in the 10x scATAC-seq kit in Step 2
Continue with the protocol exactly as in manufacturers instructions in the 10x scATAC-seq from Step 3 onwards
For final PCR amplification, use standard chromium scATAC-seq kit amplification protocol, with 16-20 PCR cycles depending on the antibody.