Sep 28, 2023
Simple Seed-vacuum Protocol for Agrobacterium-mediated Virus Induced Gene Silencing (VIGS) in Sunflower Helianthus annuus L.
- Majd Mardini1,
- Mikhail Kazantsev1,2,
- Elina Ivoilova1,
- Victoria Utkina1,
- Anastasia Vlasova1,2,
- Ilya Kirov1,2
- 1All-Russia Research Institute of Agricultural Biotechnology, Timiryazevskaya Str. 42, 127550 Moscow, Russia;
- 2Moscow Institute of Physics and Technology, 141701 Dolgoprudny, Russia
- Plant Mobilome Biology laboratory
Protocol Citation: Majd Mardini, Mikhail Kazantsev, Elina Ivoilova, Victoria Utkina, Anastasia Vlasova, Ilya Kirov 2023. Simple Seed-vacuum Protocol for Agrobacterium-mediated Virus Induced Gene Silencing (VIGS) in Sunflower Helianthus annuus L.. protocols.io https://dx.doi.org/10.17504/protocols.io.261ged56dv47/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 27, 2023
Last Modified: September 28, 2023
Protocol Integer ID: 87006
Keywords: Sunflower, VIGS, Agrobacterium, TRV, Seed vacuum , simple protocol , Helianthus annuus , mediated virus induced gene silencing, virus induced gene silencing, vigs protocol for sunflower, vacuum protocol for agrobacterium, reproducible agrobacterium, viral rna product, viral rna, agrobacterium, modified viral construct, targeted gene, numerous agrobacterium, introduction of the viral construct, degradation of viral rna product, mediated vigs protocol, underlying principle of the vigs system, viral construct, induced gene silencing, vigs system, seed vacuum, virus, introduced virus, phytoene desaturase gene, gene, tobacco rattle virus, rna, vig, helianthus annuus, crop, various commercial sunflower cultivar, innate defense mechanism, simple seed, model plant species, powerful tools for functional genomic research, plant
Funders Acknowledgements:
Russian Science Foundation
Grant ID: 22-64-00076
Abstract
Virus-Induced Gene Silencing (VIGS) stands out as one of the most powerful tools for functional genomic research. The underlying principle of the VIGS system is based on harnessing the innate defense mechanism of the studied species to induce post-transcriptional gene silencing. In brief, the process involves introducing a modified viral constructs carrying a fragment of the host targeted gene (300-500 bp). The introduced virus will prompt a group of enzymes within the plant's defense system, setting off the degradation of viral RNA products together with any similar sequences in the cell, including the host’s own mRNA. As a result, the expression level of the targeted gene is altered or, in optimal scenarios, completely silenced.
The introduction of the viral constructs is typically achieved through agrobacterium-mediated transformation. Numerous agrobacterium-VIGS systems have been firmly established for a number of crops and model plant species (Zhang Y. et al., 2019; Ramegowda V. et al., 2014). However, it is important to note that the infiltration procedure and viral construct often exhibit strong species-specificity. And as research advances, customizing new protocols becomes imperative for successful implementation across diverse plant species.
Here, we represent a simple and reproducible agrobacterium-mediated VIGS protocol for sunflower (Helianthus annuus L.). Our methodology is seed vacuum-based without the necessity for pre-germination, MS medium recovery, or even seeds sterilization. Within this protocol, we provide comprehensive instructions that ensure the consistent replication of results. For demonstration we used PHYTOENE DESATURASE gene (PDS) of Helianthus annuus as a target for VIGS. The viral constructs are derived from Tobacco Rattle Virus (TRV) (Liu Y. et al., 2002). Information on vectors assembly and post-experimental validation are also provided. The protocol's reproducibility has been rigorously tested on a breeding line and various commercial sunflower cultivars.
Troubleshooting
Before start
The VIGS constructs should be prepared beforehand and introduced into agrobacterium cells using the standard transformation method employed in your laboratory.
The constructs utilized for demonstration in this protocol have been developed based on TRV vectors. The primary target gene for VIGS is the PDS of sunflower (Helianthus annuus L.). This gene serves as a common positive control in VIGS experiments due to its easily detectable phenotypic characteristics. Silencing effects manifest as color-bleaching of the leaves.
The PDS fragment for VIGS (siRNA) was designed utilizing the open-access web server https://www.zhaolab.org/pssRNAit/. The PDS fragment used within these VIGS constructs was amplified from sunflower genomic DNA using these primers: 5'-taattctagaATGGCATTTTTAGATGGCAGCCC-3' and 5'-taatggatccTGGAGTAGCAAATACATAAGCATCCCC-3'. Subsequently, the resulting amplicon was ligated into the pYL156 TRV RNA2 vector following standard procedure. The resulting construct was introduced into Agrobacterium tumefaciens strain GV3101 using a standard electroporation procedure.
TRV2 constructs used in this protocol:
addgene-plasmid-148969-TRV2.dna61KB TRV2 Ha PDS.dna78KB PDS gene in sunflower and the location of primers:
PDS Helianthus anuus.dna37KB link for pYL192 (TRV1): https://www.addgene.org/148968/
link for pYL156 (TRV RNA2): https://www.addgene.org/148969/
Primers information for cultures validation and results analysis:
| A | B | C | D | E | F | |
| forword primer | sequence | reverse primer | sequence | PCR template | comments | |
| pYL156_TRV2_ F_flank | GTTCAGGCGGTTCTTGTGTGTC | TRV2-tRNA_flank_R | TTGAACCTAAAACTTCAGACACGGATCTAC | pYL156 (TRV RNA2) | agrobacterium colony check | |
| TRV2 Ha PDS | agrobacterium colony check | |||||
| cDNA from VIGS-treated plant | validation of succefull viral infection | |||||
| TRV1_F | AGACAACTTAATAACACATTGCGGACG | TRV1_R | CTTTGACGTTGGAGTCCACGTTC | pYL192 (TRV1) | agrobacterium colony check | |
| Ha_PDS_VIGS_insertion_F | taattctagaATGGCATTTTTAGATGGCAGCCC | Ha_PDS_VIGS_insertion_R | taatggatccTGGAGTAGCAAATACATAAGCATCCCC | genomic DNA of sunflower | amplyfing PDS insertion for VIGS construct assembly |
Infiltration suspension preparation
Streak previously prepared glycerol stocks of agrobacterium carrying the required VIGS constructs (TRV1 and TRV2) on agar-LB plates. For each plate: 20 mL LB medium + 1% agar + 50 μg/mL kanamycin + 10 μg/mL gentamycin + 100 μg/mL rifampicin.
Note
This step should be executed at least 3 days before the designated date of the primary seed vacuum infiltration. Nevertheless, agrobacterium LB plates can be stored for up to 3 months at 4°C, allowing for advance preparation and PCR validation of these plates for multiple forthcoming VIGS experiments during this timeframe.
Incubate at 28°C. Individual, well-separated colonies will start to emerge within 24-38 hours.
Expected result
Streak from agrobacterium glycerol stock after 35 hours incubation at 28°C
Note
Before proceeding to the next step, a PCR check is recommended for the selected colonies. However, this step is not necessary if the PCR check has already been conducted prior to the preparation of the glycerol stocks. (Information on primers and PCR conditions can be found in the "BEFORE START" section)
To prepare the starting culture, inoculate 5 mL of liquid LB containing antibiotics with single colony and incubated at 28°C/180rpm for another 24-38 hours.
Expected result
Starting culture after 40 hours growth. Left tube: negative control; Right tube: agrobacterium transformed with TRV2-empty plasmid.
To prepare the infiltration culture, transfer the starting culture to a sterile flask containing 50mL of LB (10 times the volume of the starting culture) suplemented with antibiotics, MES (10 mM), and acetosyringone (200 µM) .
Incubate at 28°C/180rpm and monitor OD600 every 1-1.5 hour. Remove from the incubator when OD reaches 1.5.
Note
If not all cultures have reached an OD of 1.5 simultaneously, transfer the ready ones to the refrigerator (at 4 °C) to halt their growth, while allowing the other cultures to continue growing.
Transfer the infiltration culture to a 50-mL tube and collect the agrobacterium cells by centrifuging at 3000 rcf for 10 minute.
Remove the supernatant and wash agrobacterium cells in distilled water for a couple of times.
Re-suspend the cells in the infiltration buffer to achieve a volume that sustains an OD of 1.5. The infiltration buffer is a water-based solution comprising MES (10 mM), acetosyringone (200 µM), and MgCl2 (10mM). After resuspending, allow the infiltration suspension to sit at room temperature for 2-3 hours.
Performing seed-vacuum agrobacterium infiltration
After removing the outer coat of sunflower seeds immerse them in tap water for approximately 2 hours. This will facilitate the removal of the inner membrane.
Transfer the seeds to a sterile Petri dish. Add a 1:1 ratio of TRV1:TRV2 infiltration suspension. Each Petri dish should contain a total volume of 20-25 mL of the infiltration suspension (TRV1 + TRV2).
In our example, three different Petri dishes for different VIGS variants:
- TRV1 + TRV2-empty
- TRV1 + TRV2-PDS
- Infiltration buffer (negative control)
In each Petri dish, introduce a 2-3 g of autoclave-sterile silica sand. In order to produce wounds in the surface of the seeds, gently rub using index and middle fingers (wearing gloves). The rubbing should be executed carefully in a circular motion, taking extra care not to fracture the seeds.
Note
- Change gloves between different Petri dishes with various TRV2 constructs to prevent cross-contamination.
- Following the immersion of seeds in water for 2 hours during the peeling step, they can sometimes become fragile for mechanical manipulation.
Initiate the vacuum process as follows: Apply vacuum for 3 minutes, followed by a 3-minute pause, and then another 3 minutes of vacuum.
Seal the Petri dishes and incubate at 28°C/50rpm for 6 hours.
Note
- Retain the sand within the Petri dish. Allowing the sand to remain during the incubation period at low rpm will sustain the ongoing seed wounding process. This, in turn, has the potential to enhance the efficiency of agrobacterium transformation.
- Our experience revealed that, in comparison to a 2-hour incubation, a 6-hour incubation period produced optimal PDS silencing results, evident in the increased occurrence of color-bleached leaves closer to the epical meristem. However, an 18-hour incubation demonstrated adverse effects, with less pronounced color-bleaching symptoms.
Plant the treated seeds in clean, humid soil. Subsequently, cover the pots with plastic wrap and transfer them to a dark location for a period of 2 days.
After 2 days, remove the plastic wrap and transfer the pots to a greenhouse environment. Maintain a light/dark cycle of 16 hours of light and 8 hours of darkness for optimal growth conditions.
The PDS silencing symptoms (color-bleaching of leaves) will start to be visible within 11-13 days.
Expected result
Protocol references
Zhang, Y., Chen, H., & Han, R. (2019). Advances in the Application of Virus-Induced Gene Silencing in Plants. American Journal of Plant Sciences, 10(9), 1649-1661.
Ramegowda, V., Mysore, K. S., & Senthil-Kumar, M. (2014). Virus-induced gene silencing is a versatile tool for unraveling the functional relevance of multiple abiotic-stress-responsive genes in crop plants. Frontiers in plant science, 5, 323.
Lewi, D. M., Esteban Hopp, H., & Escandón, A. S. (2006). Sunflower (Helianthus annuus L.). Agrobacterium protocols, 291-298.
Liu, Y., Schiff, M., Marathe, R., & Dinesh‐Kumar, S. P. (2002). Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N‐mediated resistance to tobacco mosaic virus. The Plant Journal, 30(4), 415-429.