Icon indicating open access to content
QR code linking to this content
Document CitationShiyi Wang 2024. shRNA plasmids. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvm288bg3p/v1
License: This is an open access  document  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: May 23, 2023
Last Modified: July 10, 2024
Document  Integer ID: 82336
Keywords: ASAPCRN
Funders Acknowledgements:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Abstract
How to make shRNA plasmids
1. pLKO.1 Puro plasmids containing shRNA (pLKO.1-shRNA) against mouse/ratLrrk2(shLrrk2: TRCN0000322193; GGCCGAGTTGTGGATCATATT), was obtained from the RNAi Consortium (TRC) via Dharmacon.

2. A scrambled shRNA sequence was generated (GTTGCTGAATGGCGGATCTAT) and cloned into the pLKO.1 TRC cloning vector according to Addgene protocols (https://www.addgene.org/protocols/plko/).

3. To generate pLKO.1 shRNA plasmids that express EGFP (pLKO.1-shRNA-EGFP), CAG-EGFP was removed from pLenLox-shNL1-CAG-EGFP and inserted between Kpn1 and SpeI sites in pLKO.1 Puro, replacing the puromycin resistance gene. pLKO.1 shRNA mCherry plasmids were generated by replacing EGFP with mCherry between KpnI and NheI sites.