Dec 09, 2024

Public workspaceshRNA Design, Subcloning, and Lentivirus Production

DOI
https://dx.doi.org/10.17504/protocols.io.dm6gp93ndvzp/v1
  • Mukesh Kumar1,
  • Timothy A. Ryan1,2
  • 1Department of Biochemistry, Weill Cornell Medicine, New York, NY 10065;
  • 2Aligning Science Across Parkinson's (ASAP) Collaborative Research Network, Chevy Chase, Maryland 20815, USA
Mukesh Kumar
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.dm6gp93ndvzp/v1
Protocol Citation: Mukesh Kumar, Timothy A. Ryan 2024. shRNA Design, Subcloning, and Lentivirus Production. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gp93ndvzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 26, 2024
Last Modified: December 09, 2024
Protocol Integer ID: 114537
Keywords: ASAPCRN, lentivirus for gene, producing shrna, lentivirus production this protocol, lentivirus production, expressing lentivirus, shrna design, experiments in primary cultured hippocampal neuron, primary cultured hippocampal neuron, hippocampal neuron, gene, neuron, subcloning
Funders Acknowledgements:
NIH
Grant ID: NS036942
NIH
Grant ID: NS11739
ASAP
Grant ID: ASAP-024404
Abstract
This protocol provides a detailed method for designing, subcloning, and producing shRNA-expressing lentivirus for gene silencing experiments in primary cultured hippocampal neurons.
Materials
  • shRNA sequences:

  1. shRNA targeting DDHD2: TRCN0000346842, ATAGTTTAGGTTCGCTTATAT
  2. shRNA targeting CPT2 #1: GACCCAAAGTCTGAGTATAAT
  3. shRNA targeting CPT2 #2: ACTAACTCAGCTGTATTTATT

  • pLKO-TRC vector (Addgene, 191566) expressing shRNA under U6 promoter and BFP under hPGK promoter
  • ReagentpLKO.1 - TRC mTagBFP2addgeneCatalog #191566
  • ReagentQIAquick Gel Extraction Kit (250)QiagenCatalog #28706
  • Packaging plasmids:
  1. ReagentpsPAX2addgeneCatalog #12260
  2. ReagentpMD2.GaddgeneCatalog #12259

  • Reagent jetPRIME®POLYPLUS TRANSFECTION SACatalog #101000027
  • ReagentLenti-X™ ConcentratorTakara Bio Inc.Catalog #631231
  • ReagentLenti-X GoStix PlusTakara Bio Inc.Catalog #631280

  • Restriction enzymes: AgeI and EcoRI (All acquired from NEB)

  • ReagentStbl3 competent cellsThermo Fisher ScientificCatalog #C7373-03 or
  • ReagentNEB Stable Competent E.coli (High Efficiency) - 20x0.05 mlNew England BiolabsCatalog #C3040H
  • Reagent293FT Cell LineThermo FisherCatalog #R70007

  • Virus Production Media: ultraCULTURE Serum-free Medium (Lonza, 12-725F) with ReagentSodium Pyruvate (100 mM)Thermo Fisher ScientificCatalog #11360070 , ReagentSodium Bicarbonate 7.5% solutionThermo FisherCatalog #25080094 , ReagentSodium butyrateMerck MilliporeSigma (Sigma-Aldrich)Catalog #B5887 and ReagentPenicillin-Streptomycin-Glutamine (100X)Thermo FisherCatalog #10378016

Equipment:

  • 0.45 μm syringe filter set (VWR Cat. No. 28145-481)
  • PCR machine
  • Heat block or thermal cycler for annealing
  • Tabletop centrifuge
  • Biosafety cabinet

Troubleshooting
Procedure
16h 15m
shRNA Design:
Use the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/) to design shRNAs targeting the consensus coding sequence of the gene of interest.
Ensure shRNA oligonucleotides include the following regions: Sense strand, Hairpin loop, Antisense strand, and Restriction sites (AgeI and EcoRI) for subcloning.
Annealing of shRNA Oligonucleotides:
Mix equal concentrations of complementary shRNA oligonucleotides in annealing buffer.



Mix
Heat the mixture to Temperature95 °C for Duration00:05:00 , then allow it to cool stepwise to Temperature10 °C for Duration00:10:00 to facilitate annealing.

15m
Temperature
Hold the temperature at Temperature4 °C .




Temperature
Subcloning into pLKO-TRC Vector:
Digest the pLKO-TRC vector with AgeI and EcoRI restriction enzymes.



Purify the plasmids using QIAquick Gel Extraction Kit. Ligate the annealed shRNA oligonucleotides into the digested vector using T4 DNA ligase.



Transformation in Competent cells:
Transform the competent E. coli with the ligation reaction (use Amount5 µL -Amount10 µL ) and plate on LB agar with appropriate antibiotics.

Pipetting
Pick colonies and set up 3-4 small cultures in LB media.
Isolate plasmid DNA from cultures and confirm insertion via restriction digestion or sequencing.
Lentivirus Production in HEK 293FT Cells:
Culture HEK 293FT cells in a 15 cm culture dish with DMEM containing 10% FBS and grow up to 70-80% confluence.
Transfect cells with the following plasmid mix using JetPRIME transfection reagent:

  • Amount7.7 µg of pLKO-shRNA plasmid
  • Amount7.7 µg of psPAX2
  • Amount4.6 µg of pMD2

Incubate cells for Duration16:00:00 , then replace transfection media with 15 ml virus production media.

16h
Incubation
Virus Harvesting:
Collect the supernatant containing lentivirus at Duration16:00:00 -Duration48:00:00 post-transfection.

Filter the supernatant through a 0.45 μm syringe filter to remove cellular debris.
Concentrate the lentivirus using Lenti-X Concentrator according to the manufacturer’s instructions.
Virus Titer Measurement:
Use the Lenti-X GoStix Plus Assay Kit to determine the virus titer.
Store the concentrated lentivirus in small aliquots at Temperature-80 °C until use.

Note
• Use a biosafety cabinet for all steps involving lentivirus to ensure safety and sterility.
• Include appropriate controls during transfection to confirm the efficiency of plasmid delivery.
• The blue fluorescent protein (BFP) expressed from the pLKO-TRC vector can be used to confirm successful transduction in target cells.
• Optimize transfection conditions for HEK 293FT cells to maximize virus yield.

Temperature