Jun 24, 2020
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR N gene 2020
- 1Public Health Virology, Forensic and Scientific Services
- Public Health Virology, Forensic and Scientific Services
- Coronavirus Method Development Community
Protocol Citation: Judy A Northill, Ian M Mackay 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR N gene 2020 . protocols.io https://dx.doi.org/10.17504/protocols.io.bhpwj5pe
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 18, 2020
Last Modified: June 24, 2020
Protocol Integer ID: 38358
Keywords: CoV, coronavirus, Wuhan, Real-time, RT-PCR, PCR, virus, China, 2019-nCoV, pneumonia, seafood market, WSMPV, Sarbecovirus, SARS-CoV-2, COVID-19
Abstract
- A real-time RT-PCR to designed to detect SARS-CoV-2 and other related sarbecoviruses. Based on sequence MN908947 made available by Professor Yong-Zhen Zhang, Fudan University, Shanghai, China.
- The target region encodes the nucleocapsid (N).
- Tested on wild-type SARS-CoV-2 virus , it is expected to be capable of detecting SARS-CoV-2, bat-like SARS and SARS virus (members of the subgenus Sarbecovirus).
- Limit of detection not yet determined.
- The performance of the assay has not been tested with low viral load samples or samples from patients who are clinically well.
- The sensitivity of this assay was improved with the use of the SensiFast™Probe Lo-ROX One-step kit.
- A single 1 mismatch at probe-binding site identified with the BetaCoV/USA/CA1/2020|EPI_ISL_406034 (GenBank MN994467.1) variant of SARS-CoV-2 (as of 23JUNE2020).
- Probe is in the 3'-5' (reverse complement) direction.
- Reverse primers were replaced in March 2020.
- We also recommend the ORF1ab assay (Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR ORF1ab 2020), US-CDC-N1 assay or the E gene assay by Corman et al. (Protocol v2-1)
Notes:
- Assay is optimised.
- This test has identified clinical positive cases of coronavirus disease (COVID-19)
Guidelines
- If using a different brand or model of real-time thermocycler, check the concentration of ROX is adequate.
- Method assumes the user is familiar with the thermocycler and software used to run the protocol.
Materials
MATERIALS
SensiFAST™ Probe Lo-ROX KitBiolineCatalog #BIO-84002
STEP MATERIALS
SensiFAST™ Probe Lo-ROX One-Step KitBiolineCatalog #BIO-78001
Protocol materials
SensiFAST™ Probe Lo-ROX One-Step KitBiolineCatalog #BIO-78001
SensiFAST™ Probe Lo-ROX KitBiolineCatalog #BIO-84002
SensiFAST™ Probe Lo-ROX One-Step KitBiolineCatalog #BIO-78001
Mix
Mix
Oligonucleotides
| Oligo Name | Sequence 5'-3' | Location based on NC_045512.2* | |
| Wuhan-TM2020For | TCGTGCTACAACTTCCTCAAG | 28743-28763 | |
| Wuhan-TM2020Probe | 6FAM-CCGCCTCTGCTCCCTTCTGC-BHQ1 | 28809-28790 | |
| SARS2-28875R-G | CTGCCTGGAGTTGAATTTCTTG | 28875-28854 | |
| SARS2-28875R-A | CTGCCTGGAGTTGAATTTCTTA | 28875-28854 |
*GenBank accession NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1.
Reagents
SensiFAST™ Probe Lo-ROX One-Step KitBiolineCatalog #BIO-78001
Synthetic controls
Synthetic controls are produced using the binary synthetic template oligonucleotide positive control for in-house diagnostic real-time RT-PCR method.
The oligonucleotide sequences required to make controls for this assay are:
Probe control:
AAAATAATACGACTCACTATAGGGTGAAGAGAATCCACAAGGAATTGAACCGCCTCTGCTCCCTTCTGCACAGTGTTCAGCAGGTCCTGTTGAAAA
Primer control:
AAAATAATACGACTCACTATAGGGTCGTGCTACAACTTCCTCAAGATGATCTGGCACGGGACCCTCCAAYAAGAAATTCAACTCCAGGCAGAAAA
Reaction Set-up
- Assay has been designed to be used on both a Rotor-Gene 6000 / Rotor-Gene Q 5-plex using 100-place rotor discs and an ABI 7500 Fast real-time machine.
- Total reaction volume is 20µL.
- Prepare sufficient for number of reaction plus a 'dead volume' usually 2 extra. Adjust as necessary if using a robotic dispenser.
| Reagent | Volume (µL) x1 | Final reaction concentration | |
| Nuclease free water | 4.2 | ||
| Wuhan-TM2020F (200µM) | 0.05 | 500nM | |
| SARS2-28875R-G (200µM) | 0.05 | 500nM | |
| SARS2-28875R-A (200µM) | 0.09 | 900nM | |
| Wuhan-TM2020Probe (100µM) | 0.01 | 50nM | |
| 2 X SensiFast Probe Lo-Rox One-Step mix* | 10 | 1X | |
| RiboSafe RNase Inhibitor* | 0.4 | ||
| Reverse transcriptase* | 0.2 | ||
| TOTAL VOLUME | 15 |
*SensiFast™ Probe Lo-ROX One-Step kit (BIO-78005)
Dispense 15µl to each reaction well.
Add 5µl of template, extracted RNA, controls or NTC (nuclease-free water).
Total reaction volume is 20µl.
Amplification
Amplification
PCR amplification
| 1 cycle | 40 cycles | |
| 50°C 5min | 95°C 3 seconds | |
| 95°C 2min | 60°C 30 seconds* |
*Florescence acquisition step
Result Analysis
Result Analysis
The definition used for a satisfactory positive result from a real-time fluorogenic PCR should include each of the following:
- A sigmoidal curve – the trace travels horizontally, curves upward, continues in an exponential rise and followed by a curve towards a horizontal plateau phase
- A suitable level of fluorescence intensity as measured in comparison to a positive control (y-axis)
- A defined threshold (CT) value which the fluorescent curve has clearly exceeded (Fig.1 arrow) and which sits early in the log-linear phase and is <40 cycles
- A flat or non-sigmoidal curve or a curve that crosses the threshold with a CT value >40 cycles is considered a negative result
- NTCs should not produce a curve
Figure 1. Examples of satisfactory sigmoidal amplification curve shape when considering an assay’s fluorescent signal output. The crossing point or threshold cycle (CT) is indicated (yellow arrow); it is the value at which fluorescence levels surpass a predefined (usually set during validation, or arbitrary) threshold level as shown in this normalized linear scale depiction. LP-log-linear phase of signal generated during the exponential part of the PCR amplification; TP-a slowing of the amplification and accompanying fluorescence signal marks the transition phase; PP-the plateau phase is reached when there is little or no increase in fluorescent signal despite continued cycling.