Jun 01, 2020

Public workspaceSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RdRp nested RT-PCR V.3

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RdRp nested RT-PCR
  • Judy Northill1,
  • Ian Mackay1
  • 1Public Health Virology, Forensic and Scientific Services
  • Public Health Virology, Forensic and Scientific Services
  • Coronavirus Method Development Community
Icon indicating open access to content
QR code linking to this content
Protocol CitationJudy Northill, Ian Mackay 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RdRp nested RT-PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.bgz2jx8e
Manuscript citation:
Hu D, Zhu C, Wang Y, Ai L, Yang L, Ye F, et al. Virome analysis for identification of novel mammalian viruses in bats from Southeast China. Scientific Reports. 2017;7(1):10917 . https://www.nature.com/articles/s41598-017-11384-w
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 31, 2020
Last Modified: June 01, 2020
Protocol Integer ID: 37658
Keywords: COVID-19, SARS, coronavirus, Rd-Rp, RT-PCR, PCR, SARS-CoV-2, severe, coronavirus rt, severe acute respiratory syndrome coronavirus, other coronavirus, specific to sar, sar, pcr, nested rt, rdrp region, rdrp,
Abstract
A nested RT-PCR targeting the RdRp region of the sub-genus Sarbecovirus. The primers are modified from the pan-coronavirus RT-PCR published by Hu et al. 2017 to be more specific to SARS-CoV-2, though other coronaviruses may still be detected.

Assay may be used in resource poor settings where real-time cyclers are not available.
Sanger sequencing should be used to confirm SARS-CoV-2 where WGS is not available or where WGS fails due to poor quality sample.


Materials
STEP MATERIALS
ReagentSuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12574026
ReagentMyFi MixBiolineCatalog #BIO-25049
Protocol materials
ReagentSuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12574026
ReagentMyFi MixBiolineCatalog #BIO-25049
Troubleshooting
Oligonucleotides
Name Purpose 5’-3’ Location*
SARS-CoV-2-15283-FRound 1 forward primer ATGGGTTGGGATTATCCTAAATG 15283-15305
SARS-CoV-2-15887-RRound 1 reverse primer TGTTGAGAGCAAAATTCATG 15887-15868
SARS-CoV-2-15286-FRound 2 forward primer GGTTGGGATTATCCTAAATGTGA 15286-15308
SARS-CoV-2-15725-RRound 2 reverse primer GCATCGTCAGAGAGTATCATCAT 15725-15703
*Based on numbering for GenBank accession NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1
Round 1 amplified products will produce a band of 605bp.
Round 2 amplified products will produce a band of 440bp.
Mix

ReagentSuperScript III One-Step RT-PCR System with Platinum TaqInvitrogen - Thermo FisherCatalog #12574026

ReagentMyFi MixBiolineCatalog #BIO-25049
Round 1 mix

ReagentVolume x1 (µl)Final Concentration
Nuclease-free water3.2
2 x Reaction mix*101 X
Wuhan15283-F (20pmol/µl)0.5500nM
Wuhan15887-R (20pmol/µl)0.5500nM
Superscript/Platinum Taq mix*0.8
TOTAL15
*SuperScript III One-Step RT-PCR System with Platinum Taq #12574026
Dispense mix in 15µl amounts in 0.2ml PCR tubes suitable for thermocycler.
Mix maybe stored frozen if necessary.

Round 2 mix

ReagentVolume x1 (µl)Final Concentration
Nuclease-free water4
MyFi 2X mix*101X
Wuhan15286-F (20pmol/µl)0.5500nM
Wuhan15725-R (20pmol/µl)0.5500nM
TOTAL15
*MyFi™Mix Bioline #BIO-25049
Dispense mix in 15µl amounts in 0.2ml PCR tubes suitable for thermocycler.
Mix maybe stored frozen if necessary.

AMPLIFICATION ROUND 1

  • Thaw required number of tubes with round 1 mix.
  • Add 5µl of extract, control, or NTC (nuclease-free water) to round 1 mix above for a final reaction volume of 20µl.
  • Label the tubes and record details.

The assay has been used with Eppendorf thermocyclers.
PCR cycling times
1 cycle40 cycles1 cycleHold
50°C 30 minutes94°C 30 seconds68°C 5 minute15°C
94°C 2 minutes55°C 30 seconds
68°C 1 minute

AMPLIFICATION ROUND 2
  • Dilute each of the round 1 amplicons 1/100 in nuclease-free water ( 2ul + 198ul is ideal)
  • Thaw required number of tubes with round 2 mix.
  • Add 5μl of the diluted round 1 amplicon.
  • Total reaction volume is 20μl.

PCR cycling times
1 cycle40 cycles1 cycleHold
95°C 3 minutes95°C 15 seconds72°C 1 minute15°C
55°C 15 seconds
72°C 15 seconds

GEL ELECTROPHORESIS
Amplified products are analysed by gel electrophoresis or equipment such as a QIAxcel or equivalent.
Round 1 amplified products will produce a band of 605bp.
Round 2 amplified products will produce a band of 440bp.
No template controls (NTC) should be not detected.
Example of result from a QIAxcel.
D3-Round 1 band, D8-round 2 band, D4 and D9 are NTC in round 1 and 2 respectively.