Feb 24, 2020

Public workspaceSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR E gene 2020

  • 1Public Health Virology, Forensic and Scientific Services
  • Public Health Virology, Forensic and Scientific Services
  • Coronavirus Method Development Community
Icon indicating open access to content
QR code linking to this content
Protocol CitationJudy A Northill, Ian M Mackay 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR E gene 2020. protocols.io https://dx.doi.org/10.17504/protocols.io.bcv9iw96
Manuscript citation:
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance. 2020;25( 3):2000045. https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 24, 2020
Last Modified: February 24, 2020
Protocol Integer ID: 33441
Keywords: CoV, coronavirus, Wuhan, Real-time, RT-PCR, PCR, virus, China, pneumonia, seafood market, WSMPV, sarbecovirus, SARS-CoV-2, COVID-19
Abstract
A real-time RT-PCR designed to amplify a portion of the envelope gene of sequences from the Betacoronavirus sub-genus Sarbecovirus.

The probe and primers were published by Corman et al., and we have slightly modified the protocol, increasing the concentration of the reverse primer, using a different kit and different cycling conditions.

This test has identified clinical positive cases of coronavirus disease 2019 (COVID-19).


Guidelines
  • If using a different brand or model of real-time thermocycler, check the concentration of ROX is adequate.
  • Method assumes the user is familiar with the thermocycler and software used to run the protocol.
Materials
MATERIALS
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
STEP MATERIALS
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Protocol materials
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Oligonucleotides
Oligonucleotides



Oligo nameSequence 5'-3'Location*
E_Sarbeco_F1ACAGGTACGTTAATAGTTAATAGCGT26269-26294
E_Sarbeco_R2ATATTGCAGCAGTACGCACACA26381-26357
E_Sarbeco_P16FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ126332-26357
*Based on numbering for GenBank accession NC_045512 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1

Reagents
Reagents

ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088

Synthetic controls
Synthetic controls

The oligonucleotide sequences required to make controls for this assay are:

Probe control: AAAATAATACGACTCACTATAGGGTGAAGAGAATCCACAAGGAATTGAAACACTAGCCATCCTTACTGCGCTTCGACAGTGTTCAGCAGGTCCTGTTGAAAA

Primer control:
AAAATAATACGACTCACTATAGGGACAGGTACGTTAATAGTTAATAGCGTATGATCTGGCACGGGACCCTCCAATGTGTGCGTACTGCTGCAATATAAAA

Reaction Set-up
Reaction Set-up
  • Assay has been designed to be used on both a Rotor-Gene 6000 / Rotor-Gene Q 5-plex using 100-place rotor discs and a ABI 7500 Fast real-time machine.
  • Total reaction volume is 20µL.
  • Prepare sufficient for number of reaction plus a 'dead volume' usually 2 extra. Adjust as necessary if using a robotic dispenser.


ReagentVolume (µl) x1Final reaction concentration
Nuclease-Free water4.39
E_Sarbeco_F10.04400nM
E_Sarbeco_R20.09900nM
E_Sarbeco_P10.04200nM
2X Reaction mix*10
Superscript III/Platinum Taq enzyme mix*0.4
ROX reference dye (25uM)*0.0450nM
TOTAL VOLUME15
*Superscript®III Platinum® One-Step qRT-PCR kit

Dispense 15µl to each reaction well.
Add 5µl of template, extracted RNA, controls or NTC (nuclease-free water).
Total reaction volume is 20µl.
Amplification
Amplification
PCR Amplification

1 cycle40 cycles
50°C 5 minutes95°C 3 seconds
95°C 2 minutes60°C 30 seconds*
*Florescence acquisition step

Result analysis
Result analysis
The definition used for a satisfactory positive result from a real-time fluorogenic PCR should include each of the following:
  1. A sigmoidal curve – the trace travels horizontally, curves upward, continues in an exponential rise and followed by a curve towards a horizontal plateau phase
  2. A suitable level of fluorescence intensity as measured in comparison to a positive control (y-axis)
  3. A defined threshold cycle (CT) value which the fluorescent curve has clearly exceeded (Fig.1 arrow) and which sits early in the log-linear phase and is <40 cycles
  4. A flat or non-sigmoidal curve or a curve that crosses the threshold with a CT value >40 cycles is considered a negative result
  5. NTCs should not produce a curve.
Figure 1. Examples of satisfactory sigmoidal amplification curve shape when considering an assay’s fluorescent signal output. The crossing point or threshold cycle (CT) is indicated (yellow arrow); it is the value at which fluorescence levels surpass a predefined (usually set during validation, or arbitrary) threshold level as shown in this normalized linear scale depiction. LP-log-linear phase of signal generated during the exponential part of the PCR amplification; TP-a slowing of the amplification and accompanying fluorescence signal marks the transition phase; PP-the plateau phase is reached when there is little or no increase in fluorescent signal despite continued cycling.