Feb 14, 2020

Public workspaceSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR N gene 2020 (Wuhan-N; 2019-nCoV-related test) -NOT RECOMMENDED V.4

DOI
dx.doi.org/10.17504/protocols.io.bchwit7e
  • 1Public Health Virology, Forensic and Scientific Services
  • Public Health Virology, Forensic and Scientific Services
  • Coronavirus Method Development Community
Judy A Northill
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.bchwit7e
Protocol Citation: Judy A Northill, Ian M Mackay 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) real-time RT-PCR N gene 2020 (Wuhan-N; 2019-nCoV-related test) -NOT RECOMMENDED. protocols.io https://dx.doi.org/10.17504/protocols.io.bchwit7e
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 13, 2020
Last Modified: February 14, 2020
Protocol Integer ID: 33046
Keywords: CoV, coronavirus, Wuhan, Real-time, RT-PCR, PCR, virus, China, 2019-nCoV, pneumonia, seafood market, WSMPV, Sarbecovirus, SARS-CoV-2, COVID-19
Abstract

  • A real-time RT-PCR to designed to detect SARS-CoV-2 and other related sarbecoviruses. Based on sequence MN908947 made available by Professor Yong-Zhen Zhang, Fudan University, Shanghai, China.
  • The target region encodes the nucleocapsid (N).
  • Not tested on wild-type virus (as of 25Jan2020), it is expected to be capable of detecting Wuhan virus, bat-like SARS and SARS virus (members of the subgenus Sarbecovirus).
  • Limit of detection not yet determined.
  • A single 1 mismatch at probe-binding site identified with the BetaCoV/USA/CA1/2020|EPI_ISL_406034 variant of SARS-CoV-2 (as of 29JAN2020).
  • Probe is in the 3'-5' (reverse complement) direction.

Notes:
  1. Assay is optimised (as of 24Jan2020).
  2. This test has identified a clinical positive case of coronavirus disease (COVID-19)
Guidelines
  • If using a different brand or model of real-time thermocycler, check the concentration of ROX is adequate.
  • Method assumes the user is familiar with the thermocycler and software used to run the protocol.

Materials
STEP MATERIALS
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Protocol materials
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Mix
Mix
Oligonucleotides


Oligo NameSequence 5'-3'Location based on NC_045512*
Wuhan-TM2020ForTCGTGCTACAACTTCCTCAAG28648-28668
Wuhan-TM2020Probe6FAM-CCGCCTCTGCTCCCTTCTGC-BHQ128714-28695
Wuhan-TM2020RevCTGCCWGGAGTTGAATTTCTTG28780-28759
*GenBank accession NC_045512 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1

Reagents

ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088

Synthetic controls

Synthetic controls are produced using the binary synthetic template oligonucleotide positive control for in-house diagnostic real-time RT-PCR method.

The oligonucleotide sequences required to make controls for this assay are:
Probe control:
AAAATAATACGACTCACTATAGGGTGAAGAGAATCCACAAGGAATTGAACCGCCTCTGCTCCCTTCTGCACAGTGTTCAGCAGGTCCTGTTGAAAA
Primer control:
AAAATAATACGACTCACTATAGGGTCGTGCTACAACTTCCTCAAGATGATCTGGCACGGGACCCTCCAACAAGAAATTCAACTCCAGGCAGAAAA
Reaction Set-up
  • Assay has been designed to be used on both a Rotor-Gene 6000 / Rotor-Gene Q 5-plex using 100-place rotor discs and an ABI 7500 Fast real-time machine.
  • Total reaction volume is 20µL.
  • Prepare sufficient for number of reaction plus a 'dead volume' usually 2 extra. Adjust as necessary if using a robotic dispenser.


ReagentVolume (ul) X1Final reaction concentration
Nuclease free water4.41
Wuhan-TM2020F (200uM)0.05500nM
Wuhan-TM2020R (200uM)0.09900nM
Wuhan-TM2020Probe (100uM)0.0150nM
2 X Reaction mix*101X
Superscript III/Platinum Taq enzyme mix*0.4
ROX reference dye (25uM)*0.0450nM
TOTAL VOLUME15
*Superscript®III Platinum® One-Step qRT-PCR kit
Dispense 15µl to each reaction well.
Add 5µl of template, extracted RNA, controls or NTC (nuclease-free water).
Total reaction volume is 20µl.

Amplification
Amplification
PCR amplification


1 cycle40 cycles
50°C     5min95°C 3 seconds
95°C     2min60°C 30 seconds*
*Florescence acquisition step

Result Analysis
Result Analysis
The definition used for a satisfactory positive result from a real-time fluorogenic PCR should include each of the following:
  1. A sigmoidal curve – the trace travels horizontally, curves upward, continues in an exponential rise and followed by a curve towards a horizontal plateau phase
  2. A suitable level of fluorescence intensity as measured in comparison to a positive control (y-axis)
  3. A defined threshold (CT) value which the fluorescent curve has clearly exceeded (Fig.1 arrow) and which sits early in the log-linear phase and is <40 cycles
  4. A flat or non-sigmoidal curve or a curve that crosses the threshold with a CT value >40 cycles is considered a negative result
  5. NTCs should not produce a curve

Figure 1. Examples of satisfactory sigmoidal amplification curve shape when considering an assay’s fluorescent signal output. The crossing point or threshold cycle (CT) is indicated (yellow arrow); it is the value at which fluorescence levels surpass a predefined (usually set during validation, or arbitrary) threshold level as shown in this normalized linear scale depiction. LP-log-linear phase of signal generated during the exponential part of the PCR amplification; TP-a slowing of the amplification and accompanying fluorescence signal marks the transition phase; PP-the plateau phase is reached when there is little or no increase in fluorescent signal despite continued cycling.