Jul 14, 2023
Sequencing of Canine Parvovirus (CPV) from Rectal Swab Samples V.1
- Sara França de Araújo dos Santos1,
- Ueric José Borges de Souza1,
- Martha Trindade Oliveira2,
- Jairo Jaime3,
- Fernando Rosado Spilki4,
- Ana Cláudia Franco2,
- Paulo Michel Roehe2,
- Fabrício ouza Campos2
- 1- Bioinformatics and Biotechnology Laboratory, Campus of Gurupi, Federal University of Tocantins, Gurupi 77410-570, Brazil;
- 2Virology Laboratory, Department of Microbiology, Immunology, and Parasitology, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul, Porto Alegre 90035-003, Brazil;
- 3Universidad Nacional de Colombia, Sede Bogotá. Facultad de Medicina Veterinaria y de Zootecnia, Departamento de Salud Animal. Centro de Investigación en Infectología e Inmunología Veterinaria (CI3V). Carrera 30 # 45-03, Bogotá D.C. CP 11132. Colombia;
- 4Molecular Microbiology Laboratory, Feevale University, Novo Hamburgo 93525-075, Brazil
Protocol Citation: Sara França de Araújo dos Santos, Ueric José Borges de Souza, Martha Trindade Oliveira, Jairo Jaime, Fernando Rosado Spilki, Ana Cláudia Franco, Paulo Michel Roehe, Fabrício ouza Campos 2023. Sequencing of Canine Parvovirus (CPV) from Rectal Swab Samples V.1. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgq3563lk5/v1
Manuscript citation:
Santos SFA, Souza UJB, Oliveira MT, Jaime J, Spilki RS, Franco AC, Roehe PM, Campos FS. Recovery of complete genomes of canine parvovirus from clinical samples. bioRxiv preprint, 25p. 2023.https://www.biorxiv.org/content/10.1101/2023.07.12.548703v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 01, 2023
Last Modified: July 14, 2023
Protocol Integer ID: 84318
Keywords: CPV, Canine Parvovirus, sequencing, viral DNA, rectal swab, DNA extraction, canine parvovirus, viral genome, full length of the viral genome, pathogenicity for puppy, sequencing, genome assembly, genome, reliable coverage of the genome, viral enteritis, puppies with clinical signal, contagious viral disease, multiplex pcr, cpv, pcr, pathogenicity, larger numbers of read, resulting read
Funders Acknowledgements:
This work was partially supported by grants from Rede Corona-ômica BR MCTI/FINEP (http://www.corona-omica.br-mcti.lncc.br, accessed on 25 June 2023) affiliated by RedeVírus/MCTI
Grant ID: FINEP 01.20.0029.000462/20; CNPq 404096/2020-4
This work was partially supported by grant from the National Council for Scientific and Technological Development–CNPq
Grant ID: Process number: 443215/2019-7
Abstract
Canine parvovirus (CPV) is a highly contagious viral disease that affects dogs, especially puppies. CPV-2 is recognized for its resilience in contaminated environments, ease of transmission among dogs, and pathogenicity for puppies. In this protocol, we have adapted the methodology to allow the recovery of complete CPV-2 genomes directly from clinical samples (dry swabs) from puppies with clinical signals of viral enteritis. A multiplex PCR was designed with primers targeting fragments of 400 to 1,000 base pairs (bp) along the full length of the viral genome. The resulting reads were compared after sequencing with the Nanopore technology. Genome assembly revealed that the smaller fragments generated larger numbers of reads, allowing a more reliable coverage of the genome than those attained with primers targeting larger amplicons. Both new methodologies were efficient in amplification and sequencing.
Materials
Consumables:
Isopropanol
Beta-mercaptoethanol
Ethanol
Nuclease-free water
(primers from Table 1 and 2)
R9.4 Oxford MinION flowcell (FLO-MIN106)(Oxford Nanopore)
Commercial Kits:
* Quick-DNA/RNA™ Viral MagBead (Zymo Research)
* Q5® High-Fidelity 2X Master Mix (New England Biolabs)
* AMPure XP beads (Beckman Coulter)
* Ligation Sequencing kit SQK-LSK-109 (Oxford Nanopore)
* Native Barcoding kits EXP-NBD104 and EXP-NBD114 (Oxford Nanopore)
Equipment:
Thermocycler
Magnetic stand (or automated extractor with magnetic block)
MinION Mk1B device (Oxford Nanopore)
Protocol materials
Quick-DNA/RNA Viral MagBeadZymo ResearchCatalog #R2140 / R2141
Q5 High-Fidelity PCR Kit - 200 rxnsNew England BiolabsCatalog #E0555L
Ampure XP beads Beckman CoulterCatalog #A63881
Qubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854
Nucleic Acid Extraction using Quick-DNA/RNA Viral MagBead (Zymo Research)
This protocol uses Quick-DNA/RNA Viral MagBeadZymo ResearchCatalog #R2140 / R2141 for extraction.
All kit's solutions need to be prepared beforehand, as described by the kit. If you've already prepared the solution, go to step 2. This is a modified version of the kit's protocol. The original kit's protocol can be found here.
DNA/RNA Buffer:
Add 500 µL of beta-mercaptoehtanol (user supplied) per 100 ml Viral DNA/RNA Buffer, (final 0.5% (v/v)
DNA/RNA Wash 1:
Kit R2140 --> Add 20 mL of isopropanol (2-propanol PA, user supplied) to MagBead DNA/RNA Wash 1 concentrate
Kit R2141 --> Add 80 mL of isopropanol (2-propanol PA, user supplied) to MagBead DNA/RNA Wash 1 concentrate
DNA/RNA Wash 2:
Kit R2140 --> Add 30 mL of isopropanol (2-propanol PA, user supplied) to MagBead DNA/RNA Wash 2 concentrate
Kit R2141 --> Add 120 mL of isopropanol (2-propanol PA, user supplied) to MagBead DNA/RNA Wash 2 concentrate
DNA/RNA Shield™:
Kit R2140 --> Add 25 mL of nuclease-free water (user supplied) to 2X DNA/RNA Shield™ concentrate
Kit R2141 --> Add 125 mL of nuclease-free water (user supplied) to 2X DNA/RNA Shield™ concentrate
Proteinase K (20 mg/ml):
Kit R2140 --> Add 1.04 mL of Proteinase K Storage Buffer to lyophilized Proteinase K (20 mg )
Kit R2141 --> Add 3.12 mL of Proteinase K Storage Buffer to lyophilized Proteinase K (60 mg )
Mix by vortexing. Use immediately or store frozen aliquots.
Elute each dry Sample into 400 µL of 1X viral DNA/RNA buffer.
Our samples were dry rectal swabs of animals confirmed positive by a rapid test.
Samples were collected and stored in a centrifuge tube (without transporting media) at -20 ºC until processing.
For each sample, add 10 µL of beads and 4 µL of proteinase K.
Obs: when working with many samples, one can always prepare a mixed solution with both components. Just make to keep the beads suspended while pipetting.
Transfer the plate (or your tubes) to magnetic stand (user supplied). After the beads have pelleted, aspirate and discard the supernatant.
This protocol can be fast tracked by the use of an automated extractor.
Perform one wash of the pellet (beads) with 250 µL of MagBead DNA/RNA Wash 1 solution.
Perform one wash of the pellet (beads) with 250 µL of MagBead DNA/RNA Wash 2 solution.
Add 250 µL of 80% ethanol and mix well.
Transfer the sample (liquid and beads) to a new place/tube.
Pellet the beads and discard the the supernatant.
Add 50 µL of nuclease-free water and mix well (this is the elution step).
Pellet the beads (magnetically) and transfer the supernatant (containing DNA/RNA) to a new plate/tube.
Multiplex PCR to obtain CPV genome fragments
This protocol uses 2 sets of oligos: one set amplifies ~400 bp sequences that overlap about 100 nucleotides with each other (Table 1); the other amplifies ~1000 bp sequences that overlap about 100 nucleotides with each other (Table 2). Primers are listed in the tables below and were design based on Canine parvovirus reference sequence NC_001539.1 (GenBank).
Primers should be mix into 2 pools for each set. To prepare a pool, add 5 µL of each primer (at 100 micromolar (µM) ) as indicated. This will be your 10X (stock) solution. Working solution should be dilute to 1X concentration (10 micromolar (µM) ).
| Name | Pool | Sequence (5’ – 3’) | Size (nt) | %GC | Tm | |
| CPV-400_0.7_LEFT* | 1 | ATGTCTGGCAACCAGTATACTG | 22 | 45.50 | 60.30 | |
| CPV-400_1_LEFT | 1 | AACCAACTGACCAAGTTCACGT | 22 | 45.45 | 60.80 | |
| CPV-400_1_RIGHT | 1 | GTTCCAGCGAACATCCTTTCCA | 22 | 50.00 | 61.31 | |
| CPV-400_1.5_LEFT* | 1 | AGGTGGCGGGCTAATTGTG | 19 | 57.90 | 59.50 | |
| CPV-400_2_LEFT | 2 | AAGAAACATGCAGAAAATGAAGCATT | 26 | 30.77 | 59.73 | |
| CPV-400_2_RIGHT | 2 | CGTAGCCATTTACCAGTTGCTTG | 23 | 47.83 | 60.67 | |
| CPV-400_3_LEFT | 1 | ATGGGGAAAAGATCAAGGCTGG | 22 | 50.00 | 60.81 | |
| CPV-400_3_RIGHT | 1 | AGTGTGCTGACAATTTGTCTGTC | 23 | 43.48 | 59.94 | |
| CPV-400_4_LEFT | 2 | GGGTGACTATATTAACATACAGACATAAGC | 30 | 36.67 | 60.59 | |
| CPV-400_4_RIGHT | 2 | TCCTGGTTGTGCCATCATTTCA | 22 | 45.45 | 60.68 | |
| CPV-400_5_LEFT | 1 | ACTTTGCGGGACTTGGTTAGTA | 22 | 45.45 | 59.81 | |
| CPV-400_5_RIGHT | 1 | ACAACCAACATTACCCACAGCT | 22 | 45.45 | 60.61 | |
| CPV-400_6_LEFT | 2 | CAGTTCTTTTTCATGGACCAGCA | 23 | 43.48 | 59.93 | |
| CPV-400_6_RIGHT | 2 | AAACCAAAGTCTCCTGGAAGCT | 22 | 45.45 | 60.01 | |
| CPV-400_7_LEFT | 1 | TGGATGTGAAGAAAGACCTGAACA | 24 | 41.67 | 60.47 | |
| CPV-400_7_RIGHT | 1 | AACGCCAAGTTGGTTTGATTGT | 22 | 40.91 | 60.01 | |
| CPV-400_8_LEFT | 2 | AGTGGACCTTGCACTGGAAC | 20 | 55.00 | 60.20 | |
| CPV-400_8_RIGHT | 2 | GCTTCGTCGTGTTCTTTTGCAG | 22 | 50.00 | 61.33 | |
| CPV-400_9_LEFT | 1 | AAATATCTTGGGCCTGGGAACA | 22 | 45.45 | 59.87 | |
| CPV-400_9_RIGHT | 1 | ACTGCTCCATCACTCATTGGTG | 22 | 50.00 | 60.80 | |
| CPV-400_10_LEFT | 2 | ACCACCTCATATTTTCATCAATCTTGC | 27 | 37.04 | 60.91 | |
| CPV-400_10_RIGHT | 2 | TCAACCAATGACCAAGGTGTTACA | 24 | 41.67 | 60.95 | |
| CPV-400_11_LEFT | 1 | GTGGTTGTAAATAATATGGATAAAACTGCA | 30 | 30.00 | 60.00 | |
| CPV-400_11_RIGHT | 1 | TGTTCTATCCCATTGAAAATAATATCTCCA | 30 | 30.00 | 59.80 | |
| CPV-400_12_LEFT | 2 | TGCCATTTACTCCAGCAGCTAT | 22 | 45.45 | 60.01 | |
| CPV-400_12_RIGHT | 2 | TCCCATTTGAGTTACACCACGT | 22 | 45.45 | 60.08 | |
| CPV-400_13_LEFT | 1 | TTTGCCTCAATCTGAAGGAGCT | 22 | 45.45 | 60.14 | |
| CPV-400_13_RIGHT | 1 | ATCATTCGTTACAGGAAGGTTAAAGTT | 27 | 33.33 | 59.83 | |
| CPV-400_14_LEFT | 2 | ACACCTGAGAGATTTACATATATAGCACA | 29 | 34.48 | 60.63 | |
| CPV-400_14_RIGHT | 2 | ACCTTTCCACCAAAAATCTGAGTAAG | 26 | 38.46 | 60.18 | |
| CPV-400_15_LEFT | 1 | CAAATGGTCAAATTTGGGATAAAGAATTTG | 30 | 30.00 | 60.15 | |
| CPV-400_15_RIGHT | 1 | TTCTAGGTGCTAGTTGATATGTAATAAACA | 30 | 30.00 | 59.56 | |
| CPV-400_16_LEFT | 2 | TGTTTATTACATATCAACTAGCACCTAGAA | 30 | 30.00 | 59.56 | |
| CPV-400_16_RIGHT | 2 | TCTAAGGGCAAACCAACCAACC | 22 | 50.00 | 61.20 | |
| CPV-400_17_LEFT | 1 | AGGTTTGTTAGATGGTATACAATAACTGT | 29 | 31.03 | 59.61 | |
| CPV-400_17_RIGHT | 1 | AGCTTTAAATACTAATTTACCTTTCCACCA | 30 | 30.00 | 60.50 | |
| CPV-400_17.5_RIGHT* | 1 | AAGTATCAATCTGTCTTTAAGGGG | 24 | 37.50 | 60.10 | |
| CPV-400_18_LEFT* | 2 | TATAAGGTGAACTAACCTTACCATA | 25 | 32.00 | 59.20 | |
| CPV-400_18_RIGHT* | 2 | TTAATATAATTTTCTAGGTGCTAGTTG | 27 | 25.90 | 59.20 |
Table 1. Primers targeting 400 bp amplicons
| Name | Pool | Sequence (5'-3') | Size (nt) | %GC | Tm | |
| CPV-1000_1_LEFT | 1 | CTGACCAAGTTCACGTACGTATGA | 24 | 45.83 | 60.93 | |
| CPV-1000_1_RIGHT | 1 | TGTTCAGTGTAAAGTGTGCTGACA | 24 | 41.67 | 61.18 | |
| CPV-1000_2_LEFT | 2 | GTGAATGGGTGACTATATTAACATACAGAC | 30 | 36.67 | 60.73 | |
| CPV-1000_2_RIGHT | 2 | ACCAAACCAAAGTCTCCTGGAAG | 23 | 47.83 | 60.95 | |
| CPV-1000_3_LEFT | 1 | AAGCAAATTGAACCAACTCCAGT | 23 | 39.13 | 59.55 | |
| CPV-1000_3_RIGHT | 1 | GGTGGTGGTTTACTTCTTTTAGTTGG | 26 | 42.31 | 60.90 | |
| CPV-1000_4_LEFT | 2 | CTAAGGACGCTAAAGATTGGGGG | 23 | 52.17 | 61.00 | |
| CPV-1000_4_RIGHT | 2 | GTTCCTGTAGCAAATTCATCACCTG | 25 | 44.00 | 60.77 | |
| CPV-1000_5_LEFT | 1 | CCATCTCATACTGGAACTAGTGGC | 24 | 50.00 | 60.82 | |
| CPV-1000_5_RIGHT* | 1 | TGGATTCCAAGTATGAGAGGCTCT | 24 | 45.83 | 61.21 | |
| CPV-1000_6_LEFT | 2 | AACCAAGACTTCATGTAAATGCACC | 25 | 40.00 | 60.66 | |
| CPV-1000_6_RIGHT* | 2 | TGGATTCCAAGTATGAGAGGCTCT | 24 | 45.83 | 61.21 |
Table 2. Primers targeting 1000 bp amplicons
We used Q5 High-Fidelity PCR Kit - 200 rxnsNew England BiolabsCatalog #E0555L to perform PCR.
Reactions should be set up independent for each pool, with a final volume of 25 µL , as bellow:
Reactions for 400 bp products:
* Master Mix 2X - 12.5 µL
* Primer pool 1 or 2 - 1.6 µL
* Nuclease-free H20 - 5.9 µL
* DNA - 5.0 µL
Reactions for 1000 bp products:
* Master Mix 2X - 12.5 µL
* Primer pool 1 or 2 - 0.4 µL
* Nuclease-free H20 - 7.1 µL
* DNA - 5.0 µL
The final concentration in a reaction should be 15 nanomolar (nM) per primer. Therefore, the volume of primers used in a reaction will vary according with the number of primers in the pool. More about this subject can be found in Quick et al. (2017).
PCR's run method should be set as:
* 98 °C for 00:03:00
* 35 cycles of (98 °C for 00:00:15 ; 63 °C for 00:05:00 )
* Hold at 4 °C
8m 15s
Purifying PCR Products with AMPure XP beads (Beckman Coulter)
Mix amplification products of Pool 1 and Pool 2 (final volume 50 µL ).
We purify the fragments with Ampure XP beads Beckman CoulterCatalog #A63881 , using a modified protocol (original protocol ca be found here).
This is step can also be fast-tracked by the use of an automated system.
Add an equal volume of AMPure XP per sample (50 µL ).
After biding, on a magnetic stand, wash beads once with 80 % (v/v) ethanol.
Elute DNA with 20 µL of (sequencing appropriate) buffer.
Transfer DNA to a new plate/tube.
Quantify your DNA.
We used Qubit dsDNA HS Assay kit Thermo Fisher ScientificCatalog #Q32854
Equipment
Qubit™ 3 Fluorometer
NAME
Fluorometer for nucleic acid quantitation
TYPE
Invitrogen
BRAND
Q33216
SKU
LINK
Fluorometer for nucleic acid quantitation
SPECIFICATIONS
Library preparation & sequencing
To prepare a library, use the Ligation and Barcoding kits (following manufacturer's instructions).
We used Ligation Sequencing kit SQK-LSK-109 and Native Barcoding kits EXP-NBD104 and EXP-NBD114 (Oxford Nanopore)
Load library on your flow cell and sequence your sample.
We used R9.4 Oxford MinION flow cell (FLO-MIN106) and MinION Mk1B device for sequencing.
Protocol references
Quick, J., Grubaugh, N. D., Pullan, S. T., Claro, I. M., Smith, A. D., Gangavarapu, K., Oliveira, G., Robles-Sikisaka, R., Rogers, T. F., Beutler, N. A., Burton, D. R., Lewis-Ximenez, L. L., de Jesus, J. G., Giovanetti, M., Hill, S. C., Black, A., Bedford, T., Carroll, M. W., Nunes, M., Alcantara, L. C., Jr, … Loman, N. J. (2017). Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nature protocols, 12(6), 1261–1276. https://doi.org/10.1038/nprot.2017.066