Aug 11, 2024
scNT-seq2: single-cell metabolically labelled new RNA tagging sequencing for time-resolved analysis of gene expression in single cells
- Qi Qiu1,
- Fan Li1,
- Dongming Liang1,
- William Gao1,
- Hao Wu1
- 1Department of Genetics, Epigenetics Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia PA 19104, USA
- IGVF
Protocol Citation: Qi Qiu, Fan Li, Dongming Liang, William Gao, Hao Wu 2024. scNT-seq2: single-cell metabolically labelled new RNA tagging sequencing for time-resolved analysis of gene expression in single cells. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk8811l5r/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 04, 2024
Last Modified: August 11, 2024
Protocol Integer ID: 101225
Abstract
Single-cell metabolically labeled new RNA tagging sequencing (scNT-Seq) is a droplet microfluidics-based, time-resolved RNA-seq method for joint profiling of newly synthesized (“new”) and pre-existing (“old”) RNAs from the same cell by marking new transcripts with T-to-C substitutions via chemical conversion of 4-thiouridine (4sU) in new RNAs to cytidine analogs (Qiu et al., Nature Methods 17.10 (2020): 991-1001. PMID: 32868927). Here, we described the updated scNT-Seq2 method in which an optimized second-strand synthesis reaction is employed to increase the mapping rate and library complexity. This step-by-step protocol describes metabolic labeling, sample preparation, and scNT-Seq2 library preparation for Illumina sequencing.
Materials
| A | B | C | |
| Chemicals, Peptides, and Recombinant Proteins | Source | Identifier | |
| DPBS, no calcium, no magnesium | Invitrogen | 14190136 | |
| Barcoded beads | ChemGenes | MACOSKO-2011-10(V+) | |
| 1M Tris-HCl, pH 8.0 | Invitrogen | 15568-025 | |
| 1 M Tris-HCl, pH 7.5 | Invitrogen | 15567-027 | |
| 0.5 M EDTA, pH 8.0 | Invitrogen | 15575-020 | |
| NxGen RNase Inhibitor | Lucigen | 30281-2 | |
| Bovine Serum Albumin | Sigma-Aldrich | A8806-5G | |
| Ficoll PM-400 | GE Healthcare/Fisher Scientific | 45-001-745 | |
| Sarkosyl | Sigma-Aldrich | L7414-50mL | |
| NaIO4 | Sigma-Aldrich | 7790-28-5 | |
| sodium acetate | Invitrogen | AM9740 | |
| Bst 3.0 DNA Polymerase | NEB | M0374 | |
| Exonuclease I | NEB | M0293L | |
| TFEA | Sigma-Aldrich | 269042-1G | |
| SPRISelect beads | Beckman Coulter | B23318 | |
| DTT | Fermentas | R0862 | |
| QX200 Droplet Generation Oil for EvaGreen | Bio-Rad | 186-4006 | |
| Perfluoro-1-octanol | Sigma-Aldrich | 370533-25G | |
| dNTPs | Clontech | 639125 | |
| Critical Commercial Assays | |||
| Maxima H Minus Reverse Transcriptase | ThermoFisher | EP0753 | |
| Nextera XT DNA sample preparation kit | Illumina | FC-131-1096 | |
| KAPA HiFi hotstart readymix | KAPA Biosystems | KK2602 | |
| Oligonucleotides | |||
| Template Switch Oligo | AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG | ||
| TSO-PCR primer | AAGCAGTGGTATCAACGCAGAGT | ||
| Custom Read 1 Primer | GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC | ||
| TSO-N3G2N4B primer | AAGCAGTGGTATCAACGCAGAGTGA (N1:25252525)(N1)(N1)GG(N1)(N1)(N1)(N1)(N2: 00333433); N1 represents a mixture of A, C, G and T at a 25:25:25:25 ratio, N2 represents a mixture of A, C, G and T at a 0:33:34:33 ratio | ||
| P5-TSO hybrid primer | AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT∗A∗C |
Metabolic labeling
Metabolic labeling
Prepare a 1 M stock solution of 4-thiouridine (4sU) by dissolving the powder in DMSO.
Note
Note: the stock is stable for a few months at -20 C. Protect the solution from light.
For metabolic labeling, the medium was replaced with fresh medium supplemented with nontoxic concentrations of 4sU (i.e. 100 or 200 μM).
Note
If the labeling time is longer than 4 hours, regular exchange of fresh 4sU-containing
media (i.e. every three hours) can enhance 4sU incorporation.
Prepare cell suspension
Prepare cell suspension
After metabolic labeling, cells were rinsed once with DPBS.
Add 0.5 mL Accutase to each well of the 6-well plate and incubate at 37 C for about 5 min.
Add 1 mL culture medium to neutralize the Accutase.
Collect cell suspension in the 15 mL tube, spin down cells at 350 g, 3min.
Resuspend the cell pellet with 1 mL of DPBS (containing 0.01% BSA + 0.5%RNase-Inhibitor).
Count the cell number with Countess II.
Dilute the cell with DPBS (containing 0.01% BSA + 0.5%RNase-Inhibitor) to 100 cells/ μL (1 X 105 cells/mL).
Cell and beads co-encapsulation
Cell and beads co-encapsulation
Prepare lysis buffer:
| A | B | C | |
| Reagents | Vol.(μL) | Final Concentration | |
| H2O | 400 | ||
| 20% Ficoll PM-400 | 300 | 6% | |
| 20% Sarkosyl | 10 | 0.2% | |
| 0.5 M EDTA | 40 | 20 mM | |
| 1.0 M Tris-HCl, pH 7.5 | 200 | 200 mM | |
| 1.0 M DTT (add freshly) | 50 | 50 mM |
Lysis buffer master mix
Prepare barcoded beads:
Wash beads once with 30 mL of 100% ethanol and twice with 30 mL of TE-TW (10 mM Tris-HCl pH 8.0, 1 mM EDTA and 0.01% Tween-20). Pass the beads through a 100 μm cell strainer and count the number of beads. Resuspend the beads at 120 beads/μL concentration in 1.5 mL lysis buffer for each run (to profile 1,000~2,000 cells). Transfer 1.5 mL of bead suspension into a 3 mL Luer lock syringe. Make one more mL of lysis buffer to wash the syringe and magnetic disc.
Draw up 7 mL of droplet generation oil (Bio-Rad) into a 10-mL Luer-lock syringe.
Connect 3 syringes (containing cells, beads, and oil, respectively) to the Aquapel-coated
PDMS Microfluidic device (μFluidix) with the following flow rate setting:
| A | B | |
| Syringe Content | Flow Rate (μL/hr) | |
| Oil | 15000 | |
| Cells | 4000 | |
| Beads | 4000 |
Start the run in the following order: cells → beads → oil.
When the flow of droplets stabilizes, collect ~20 μL of aqueous flow to examine the droplet quality. Check whether the droplet size is uniform and estimate the percentage of bead doublets (the doublet rate should be less than 5%).
Once confirming the droplet quality, collect 1.2-1.3 mL of droplets into a 50 mL conical tube (target 1,000~2,000 cells for each sample).
Droplet breakage
Droplet breakage
Remove the oil layer from the bottom of the 50 mL tube.
Add 30 mL of room temperature 6X SSC into the tube.
Add 1 mL of Perfluorooctanol (PFO) into the tube in a fume hood. Shake by hand to break the droplets (3-4 forceful vertical shakes, the shakes should be long distance -- from head to leg) Spin at 1,000x g for 1 min.
Carefully remove the supernatant on top and then add 25 mL of 6X SSC to kick up the beads into the solution. Wait a few seconds to allow the majority of the oil to sink to the bottom. Transfer the supernatant to a new 50 mL tube.
Add 25 mL of 6X SSC to kick up the beads into thesolution again. Transfer and combine the supernatant.
Spin at 1,000x g for 1 min to pellet the beads.
The beads are now pelleted to the bottom of the tube. Carefully remove all but ~1 mL of liquid. Resuspend the beads with the remaining liquid and transfer them to a 1.5 mL Low Binding tube.
Spin at 1,000x g for 1 min. Remove the supernatant. Wash beads once with 1 mL of 6X SSC.
Chemical conversion of mRNAs on beads
Chemical conversion of mRNAs on beads
Wash beads once with 450 μL reaction buffer (without TFEA and NaIO4).
Incubate beads in 474 μL Reaction-mix + 26 μL NaIO4 at 45 C for 1 hr with rotation.
| A | B | |
| Reagents | Volume (μL) | |
| 3 M sodium acetate (pH 5.2) | 8 | |
| 0.5 M EDTA (pH 8.0) | 2 | |
| H2O | 214 | |
| TFEA | 13 | |
| Sub-total | 237 | |
| 192 mM NaIO4 | 13 |
Master mix for chemical conversion
Wash the beads once with 0.7 mL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5).
Incubate the beads in 0.7 mL Reducing Buffer at 37 C for 30 min with rotation. Add 2% RNase inhibitor (20 μL/1 mL) to the reducing buffer before use.
| A | B | |
| Reagents | For 1mL (μL) | |
| 1 M Tris-HCl (pH7.5) | 10 | |
| 1M DTT | 10 | |
| 5M NaCl | 20 | |
| 0.5M EDTA | 2 | |
| RNase Inhibitor | 20 | |
| DEPC-H2O | 958 |
Reducing Buffer
Reverse transcription
Reverse transcription
Prepare RT mix:
| A | B | |
| Reagents | Vol. (μL) | |
| H2O | 80 | |
| Maxima 5X RT buffer | 40 | |
| 20% Ficoll PM-400 | 40 | |
| 10 mM dNTPs | 20 | |
| 100 μM Template Switch Oligo | 5 | |
| RNase Inhibitor | 5 | |
| Maxima H Minus Reverse Transcriptase | 10 |
Wash the beads once with 1 mL Tris-HCl buffer (10 mM, pH 7.5).
Wash the beads once with 0.3 mL 2X RT buffer.
Add 220 μL of RT mix to the beads.
Incubate beads at room temperature for 30 min with rotation, then 120 min at 42 C with rotation.
Wash beads once with 1 mL TE-SDS (10 mM Tris-HCl pH 8.0, 1 mM EDTA, and 0.5% SDS), twice with 1 mL TE-TW, then store the beads at 4°C over-night (in TE-TW buffer). [This is a Stop point. Store at 4C overnight (in TE-Tw buffer).]
Exonuclease I treatment
Exonuclease I treatment
Prepare Exonuclease mix (makes 200 μL):
| A | B | |
| Reagents | Vol. (μL) | |
| 10X Exonuclease I buffer | 20 | |
| H2O | 170 | |
| Exonuclease I | 10 |
Wash beads once with 1 mL 10mM Tris-HCl pH 8.0, re-suspend in 190 μL of exonuclease mix.
Incubate beads at 37 C for 45 min with rotation.
Wash beads once with 1 mL TE-SDS, and twice with 1 mL TE-TW. [This is a Stop point. Store at 4C overnight (in TE-Tw buffer).]
Run 1st round of TSO-PCR using 6,000-beads as templates
Run 1st round of TSO-PCR using 6,000-beads as templates
Wash beads once with 1 mL H2O. Spin at 1,000x g for 1 min.
Remove supernatant and re-suspend the beads with 1 mL of H2O. Quickly transfer 2 μL of beads into a well of a 96-well plate (containing 198 μL of H2O) and count the number of beads. Repeat bead counting three times and take the average.
Transfer an aliquot of 6,000 beads (corresponding to ~100 cells) into a PCR tube. Spin down and remove the supernatant, then re-suspend the beads with 50 μL PCR mix:
| A | B | |
| Reagents | Vol. (μL) | |
| KAPA HiFi HS Readymix | 25 | |
| 100 μM TSO-PCR primer | 0.4 | |
| H2O | 24.6 |
TSO-PCR master mix
Run 1st round of TSO-PCR. PCR program:
Very important: run 1st round of TSO-PCR to determine the exact number of amplification cycles. Over-amplification of the cDNA library will lead to fewer detected nuclei in the end).
95 C for 3 minutes
4 cycles of:
98 C for 20 seconds
65 C for 45 s
72C for 3 min
9 cycles of:
98 C for 20 s
67 C for 20 s
72 C for 3 min
Then:
72 C for 5 min
4 C forever
Purify PCR products once with 0.7X (35 μL) SPRI beads once and elute in 15 μL Elution buffer.
Measure the concentration of PCR products by Qubit.
Perform real-time PCR to determine the additional number of PCR cycles needed for optimal cDNA amplification.
| A | B | |
| Reagents | Vol. (μL) | |
| Purified cDNA | 1 | |
| 25 μM TSO-PCR primer | 0.2 | |
| 2X KAPA FAST qPCR Readymix | 5 | |
| H2O | 3.8 |
Real-time PCR master mix
Run real-time PCR with the following program, and determine the optimal PCR cycle number
95 C for 3 min
25 cycles of:
95 C for 15 s
63 C for 30 s
72 C for 30 s
Second strand synthesis
Second strand synthesis
Prepare second strand synthesis mix:
| A | B | |
| Reagents | Vol. (μL) | |
| 10X Isothermal Amplification Buffer II | 10 | |
| 20% Ficoll PM-400 | 20 | |
| 10 mM dNTPs | 14 | |
| Bst 3.0 DNA Polymerase (NEB) | 5 | |
| TSO-N3G2N4B primer (100 μM) | 10 | |
| MgSO4 (100 mM) | 6 | |
| H2O | 35 |
Second strand synthesis master mix
After aspiration of TE-TW buffer, resuspend beads in 500 μL 0.1 M NaOH.
Incubate beads at room temperature for 5 min with rotation.
Add 500 μL 0.2M Tris-HCl (pH 7.5) to neutralize the solution.
Wash beads once with TE-TW and once with 10 mM Tris-HCl (pH 8.0).
Add 200 μL second strand synthesis mix to the beads. [Add Bst3 enzyme right before the reaction.]
Incubate beads at 15 min at 60 C with rotation.
Wash beads once with 1 mL TE-SDS, and twice with 1 mL TE-TW and twice with H2O.
Large-scale TSO-PCR
Large-scale TSO-PCR
After determining the optimal PCR cycle number (usually an additional 0-4 cycles), perform large-scale TSO-PCR with the remaining beads. Wash the remaining beads twice with 1 mL H2O. Apportion 6,000 beads for each PCR reaction. Spin down and remove the supernatant, then resuspend the beads with 50 μL PCR mix. PCR program:
95 C for 3 min
4 cycles of:
98 C for 20 s
65 C for 45 s
72 C for 3 min
X plus additional cycles of:
98 C for 20 s
67 C for 20 s
72 C for 3 min
Then:
72 C for 5 min
4 C forever
Combine the PCR product for a given sample into a 1.5 mL Low Binding tube and purify twice with SPRI-select beads (0.6X Volume for the 1st & 0.7X Volume for the 2nd purification).
Elute the cDNA with 40 μL Low-EDTA TE.
Quantify the cDNA library by Qubit and run the bioanalyzer to check the average fragment size of the purified cDNA library (the expected average size of cDNA library is 800-1,500 bp).
Tagmentation (Nextera® XT DNA Sample Preparation kit)
Tagmentation (Nextera® XT DNA Sample Preparation kit)
Preheat the thermocycler to 55 C. For each sample, take out 1 ng of purified cDNA with H2O in a total volume of 5 μL to a PCR tube.
Add 10 μL of Nextra TD buffer and 5 μL of Amplicon Tagmentation enzyme to each reaction. Mix by pipetting ~5 times.
Incubate at 55 C for 5 min.
Add 5 μL of Neutralization Buffer to each reaction. Mix by pipetting ~5 times. Spin down and incubate at room temperature for 5 min.
Add to each PCR tube in the following order:
| A | B | |
| Reagents | Vol. (μL) | |
| Nextra PCR mix | 15 | |
| 2 μM P5-TSO hybrid primer | 5 | |
| 2 μM Nextera N70X oligo | 5 |
PCR program:
95 C for 30 s
12 cycles of:
95 C for 10 s
55 C for 30 s
72 C for 30 s
Then:
72 C for 5 min
4 C forever
Purify PCR product twice with 0.6X SPRI beads. Elute the cDNA in 12 μL H2O.
Quantify the concentration of cDNA library by Qubit and check the average fragment size of the purified cDNA library by Bioanalyzer (the expected fragment size is 500-700 bp).
Sequencing
Sequencing
Dilute the library to 2 nM and pool the libraries according to the estimated cell numbers (100 cells/6000 beads).
Protocol references
1. Hu, Peng, et al. "Dissecting cell-type composition and activity-dependent transcriptional state in mammalian brains by massively parallel single-nucleus RNA-seq." Molecular cell 68.5 (2017): 1006-1015.
2. Qiu, Qi, et al. "Massively parallel and time-resolved RNA sequencing in single cells with scNT-seq." Nature methods 17.10 (2020): 991-1001.