Sep 14, 2022
scNMT-seq v2
- Liyun Zhao1,
- Thomas Lefevre2,
- Thierry Voet2,
- Bernard Thienpont1
- 1Laboratory for Functional Epigenetics, Department of Human Genetics, KU Leuven;
- 2Laboratory of Reproductive Genomics, Department of Human Genetics, KU Leuven
Protocol Citation: Liyun Zhao, Thomas Lefevre, Thierry Voet, Bernard Thienpont 2022. scNMT-seq v2. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7yrz3gwz/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 08, 2022
Last Modified: September 14, 2022
Protocol Integer ID: 69707
Keywords: Single-cell, scRNA-seq, G&T-seq, BS-seq, chromatin accessibility, DNA methylation, gene expression, rna, single cell, single, cell, ASAPCRN, scNMTseq, open chromatin, seq v2 scnmt, testing modifications of the scnmt, original scnmtseq, single cell chromatin status, scnmt, transcriptome sequencing, single cell nucleosome, methylation profile, seq pipeline, methylome, strand synthesis, problem of unmapped read, unmapped read, seq,
Abstract
scNMT-seq (single cell Nucleosome, Methylome, and Transcriptome sequencing) allows the parallel study of a single cell chromatin status, methylation profile, and transcriptome.
Here, we are developing and testing modifications of the scNMT-seq pipeline. The protocol is carried out in 96w plates and typically takes 4-5 days to complete.
The number of pre-amplification cycles is adjusted to tackle the problem of poor recovery after BS conversion.Primers are optimized for first-strand and second-strand synthesis to solve the problem of unmapped reads and poor amplification. Both are testified as compatible with theoriginal the original scNMTseq.
Materials
GpC Methyltransferase (M.CviPI) - 1,000 unitsNew England BiolabsCatalog #M0227L
IGEPAL-CA630Merck MilliporeSigma (Sigma-Aldrich)Catalog #I3021 SIGMA-ALDRICH
RNase InhibitorThermo FisherCatalog #N8080119
RLT Plus BufferQiagen
Dynabeads MyOne Streptavidin T1Thermo Fisher ScientificCatalog #65601
Superscript IIInvitrogen - Thermo FisherCatalog #18064014
ERCC RNA Spike-In Mix or order custom-made synthetic sequencesThermo Fisher ScientificCatalog #4456740
dNTP Mix (10 mM ea)Thermo FisherCatalog #18427013
Nextera XT DNA Sample Preparation Kit, 96 samplesIllumina, Inc.Catalog #FC-131-1096
Nextera XT Index Kit v2 Set A (96 indexes 384 samples)Illumina, Inc.Catalog #FC-131-2001
Betaine 5MMerck MilliporeSigma (Sigma-Aldrich)Catalog #B0300
Magnesium Chloride (MgCl2) Solution - 6.0 mlNew England BiolabsCatalog #B9021S
DTTMerck MilliporeSigma (Sigma-Aldrich)Catalog #D0632
Kapa HiFi Hotstart ReadyMix (2x)Kapa BiosystemsCatalog #KK2612
Ampure XP beads Beckman CoulterCatalog #A63881
Lambda DNAThermo FisherCatalog #SD0011
EZ-96 DNA Methylation-Direct MagPrepZymo ResearchCatalog #D5044
Klenow (3′→ 5′ exo-) (High Concentration)EnzymaticsCatalog #P7010-HC-L
QuantiFluor® dsDNA SystemPromegaCatalog #E2670
| A | B | |
| Name | Sequence (5’ to 3’) | |
| Oligo-dT primer | Biotin-TEG-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN | |
| TSO | AAGCAGTGGTATCAACGCAGAGTACATrGrG+G | |
| IS PCR | AAGCAGTGGTATCAACGCAGAGT | |
| Pre-amplification primer | Biotin-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTHHHHHHH*H | |
| Adapter2 primer | ACACTCTTTCCCTACACGACGCTCTTCCGATCTDDDDDDD*D | |
| PE 1.0 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T | |
| iPCRTag primer | CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T |
All oligos should be ordered with HPLC purification
Cell isolation and GpC methylation
Prepare plates containing 2.5µl GpC methylase reaction mixture in each well:
| A | B | C | D | |
| Component (initial) | Component(final) | Volume (µl) | Mastermix (110 samples) | |
| M.CviPI reaction buffer (10x) | 1x | 0.25 | 27.5 | |
| M.CviPI (4U/µl) | 2U | 0.5 | 55 | |
| SAM (320µM) | 160µM | 1.25 | 137.5 | |
| IGEPAL (10%) | 0.1% | 0.025 | 2.75 | |
| RNasein (20U/µl) | 1U/µl | 0.125 | 13.75 | |
| Nuclease-free water | 0.35 | 38.5 |
Isolate cells manually or using FACS in 2.5 µL of GpC methylase reaction buffer
After cell isolation, spin down plates at ≥1000g for ≥10s 4 °C
Incubate the samples at 37 °C for 00:15:00
15m
Stop reaction by adding 5 µL RLT plus buffer
Stoe the plates at-80 °C until processed
Oligo-dT30VN bead preparation
30m
Add55 µL Dynabeads into a new Eppendorf tube. Place the tube on a magnet for 00:02:00 and discard supernatant
2m
Resuspend beads in 200 µL Dynabead solution A (0.1 Mass Percent NaOH, 0.05 Mass Percent NaCl). Place the tube on a magnet for 00:02:00 and discard supernatant
2m
Repeat step 8 once
Resuspend beads in 200 µL Dynabead solution B (0.1 Mass Percent NaCl). Place on a magnet for 00:02:00 and discard supernatant
2m
Resuspend the beads in55 µL of 2x B&W (2 Mass Percent NaCl, 10 millimolar (mM) Tris-HCl, 1 millimolar (mM) EDTA) and 55 µL Biotinylated Oligo-dT30VN (100 micromolar (µM) ).
Incubate 00:20:00 on a thermomixer while shaking at 2000rpm at Room temperature
In the meantime, prepare the bead resuspension buffer
| A | B | |
| Superscript FS buffer (5x) | 220µl | |
| Nuclease-free Water | 825µl | |
| RNase inhibitor (20U/µl) | 55µl |
After adding RNase inhibitor, use beads within 30min
In the meantime, prepare 1x B&W buffer by mixing 440 µL Nuclease-free water with 440 µL 2x B&W buffer
20m
Place beads on a magnet for00:02:00 and discard supernatant
2m
Resuspend the beads in 200 µL 1x B&W buffer. Place beads on a magnet for 00:02:00 and discard supernatant
2m
Repeat step 13 three more times
Resuspend the beads in the bead resuspension buffer
Physical separation of mRNA and gDNA
Thaw the 96-well plate containing the single cell lysates on ice
Add 1 µL ERCC spike-ins at 1:1Million - 1:128Million dilution to each sample using a multi-dispensing pipette. Run the pulse centrifugation program to spin ERCCs down to the bottom
Take 4 tubes(1069 µL per tube ) of G&T wash buffer(50 millimolar (mM) Tris–HCl8.3 , 75 millimolar (mM) KCl, 3 millimolar (mM) MgCl2, 0.5% Tween 20 Solution) and add to each tube137.5 µL DTT and 25 µL RNaseIn
Add 50 µL G&T-Seqwash buffer per well to the“G&T-Seq wash plate”
Add 10 µL Oligo-dT beads per well to the“bead plate”
Add an empty non-skirted 96 well plate labeled “gDNA collection”
Spin all plates and run the adapted G&T-separation program robotically or manually.
While the separation program is running, prepare the RT master mix
| A | B | C | D | |
| Component (C_initial) | C_final | Volume(µl) | Mastermix (110 samples) | |
| dNTP (10mM) | 1mM | 0.5 | 55 | |
| TSO (100µM) | 1µM | 0.05 | 5.5 | |
| MgCl2 (1M) | 6mM | 0.03 | 3.3 | |
| Betain (5M) | 1M | 1 | 110 | |
| S II First strand buffer (5x) | 1x | 1 | 110 | |
| DTT (100mM) | 5mM | 0.25 | 27.5 | |
| Nuclease-free water | 1.8 | 198 | ||
| RNase inh (20U/µl) | 0.5U/µl | 0.125 | 13.75 | |
| Superscript reverse transcriptase II (200U/µl) | 10U/µl | 0.25 | 27.5 |
Adding enzyme within less than 30 min before running the Reverse Transcription program
Note
Separation is performed robotically on the Hamilton platform in this protocol. If performed manually, steps should be as follows
Manually pipette 10 µL of prepared oligo-dT beads to each well of the sample plate using a multichannel pipette
Mix at maximum speed for 00:20:00
20m
Place on magnet for 00:05:00 . Aspirate 17.5 µL and transfer to the empty low-bind plate for gDNA collection
5m
Add 15 µL of G&T-seq wash buffer off magnet.
Mix at maximum speed for 00:10:00
10m
Place on magnet for 00:02:00 . Aspirate 15 µL and transfer to the empty low-bind plate for gDNA collection
2m
Repeat steps 22.3-22.6 twice more
Note
Lysate (17.5ul) combined with 3 washes (15ul each) should now have been collected into the gDNA plate
Reverse transcription
1h 45m
Collect the polyA(+) mRNA plate and using the multi-dispenser dispense 5 µL RT master mix into each well of the bead-containing 96-well plate
Seal the mRNA and gDNA plates and spin.
Store gDNA at -80 °C until processed
Incubate the polyA(+) mRNA 96-well plate on a thermomixer C using the program below (approx. duration 01:45:00 )
| A | B | C | D | |
| Cycle | Temp (°C) | Time | Mixing (rpm) | |
| 1 | 42 | 2 min | 2000 | |
| 2 | 42 | 60 min | 1500 | |
| 3 | 50 | 30 min | 1500 | |
| 4 | 60 | 10 min | 1500 |
1h 45m
In the meantime prepare PCR mastermix
| A | B | C | |
| Component | Volume(µl) | Mastermix (110 samples) | |
| KAPA HiFi HotStart ReadyMix (2x) | 6.25 | 687.5 | |
| IS PCR primer (10µM) | 0.124 | 13.64 | |
| Nuclease-free water | 1.13 | 124.3 |
PCR amplification of cDNA
30s
Add 7.5 µL PCR reaction mastermix, seal the plate and centrifuge
Resuspend the beads for00:00:30 at 2000rpm using the Thermomixer
30s
Perform cDNA amplification as follows
| A | B | C | |
| Cycles | Temperature(°C) | Time | |
| 1 | 98 | 3 min | |
| 18-25 | 98 | 20 s | |
| 67 | 15 s | ||
| 72 | 6 min | ||
| 1 | 72 | 5 min | |
| 1 | 4 | Hold |
Amplification cycles differ
PCR cleanup of amplified cDNA
22m 10s
Add 12.5 µL Agencourt AMPure beads (1:1 ratio), mix thoroughly by pipetting up and down
Incubate00:05:00 at Room temperature
5m
Pellet the beads on a Low-elution magnet for 00:05:00
5m
Remove the supernatant without disturbing the beads
Wash the beads twice with 150 µL of freshly prepared 80% ethanol for 00:00:10
10s
Allow the beads to dry for approximately 00:05:00 . Resuspend in25 µL nuclease-free water. Incubate for 00:02:00 Room temperature
7m
Return the 96-well plate to the magnet and allow the Agencourt AMPure beads to settle for 00:05:00
5m
Carefully transfer the supernatant to a new 96-well plate
Note
Quality control: QUBIT+BIOANALYZER
expected cDNA concentration: >= 1ng/µl
expected cDNA length: 500-2000bp, peaking at 1-1.5kb
Library preparation of cDNA (Nextera XT)
9m
Dilute the cDNA of each sample to 0.2ng/μl with nuclease-free water
Add 2.5 µL Tagment DNA(TD) buffer to a new Hard-Shell skirted 96-well plate
Add 1.25 µL diluted cDNA and 1.25 µL amplicon tagment mix (ATM) to TD buffer and mix
Centrifuge the plate at 280 x g, 20°C, 00:01:00
1m
Incubate on a thermal cycler
| A | B | C | |
| Segment | Temp(°C) | Duration(min) | |
| 1 | 55 | 10 | |
| 2 | 10 | Hold |
Add 1.25 µL Neutralize Tagment Buffer (NT)
Vortex & spin down at 800 x g, 20°C, 00:01:00
1m
Incubate at Room temperature 00:05:00
5m
Add 1.25 µL Index (i7) adapter to each column and 1.25 µL Index 2 (i5) adapter to each row
Add3.75 µL Nextera PCR mastermix and mix
Centrifuge the samples at 280 x g, 20°C, 00:01:00 and amplify as follows:
| A | B | C | |
| Cycle | Temp (°C) | Duration | |
| 1 | 72 | 3min | |
| 2 | 95 | 30s | |
| 3-14 | 95 | 10s | |
| 55 | 30s | ||
| 72 | 30s | ||
| 15 | 72 | 5min | |
| 16 | 4 | Hold |
1m
Centrifuge the plate at 280 x g, 20°C, 00:01:00
1m
Purify libraries at a 0.66:1 ratio and elute in 12.5 µL EB buffer
Note
Libraries can be stored for at least a year at -20°C
Pool libraries and quantify using qPCR
Note
expected pool concentration: 4nM
expected pool size: 250-1500bp
scBS-seq library preparation (gDNA)
Bisulfite conversion
39m
Prepare the CT conversion reagent by mixing 7.9 mL M-Solubilisation buffer and 3 mL M-Dilution buffer and 00:15:00 vortexing at Room temperature
Finally,add1.6 mL M-Reaction buffer and vortex00:04:00 at Room temperature
19m
Add 32.5 µL AMPure XP beads to the gDNA plate (0.65:1 ratio)
Incubate00:20:00 Room temperature
20m
Place the plate on the magnet for 00:20:00 and discard the supernatant
20m
Wash the beads twice with 200 µL 80% ethanol
Resuspend the beads in10 µL elution buffer, optionally containing 60fg unmethylated lambda DNA
Note
Do not transfer the samples from the beads
Do not dry the beads after the second wash, a dry step when purifying gDNA lowers recovery
Add 65 µL CT conversion reagent without mixing
Note
Watch out for bubbles, centrifuge shortly if necessary
Incubate the mixture as follows:
| A | B | C | |
| Segment | Temperature(ºC) | Duration(min) | |
| 1 | 98 | 8 | |
| 2 | 65 | 180 | |
| 3 | 4 | Hold |
Note
BS converted DNA is stable for 3 days at -20°C or 20h at 4°C
Purification of the bisulfite converted DNA
33m
Mix 300 µL M-binding buffer and 5 µL MagBinding beads
Note
Tip: to minimize loss of sample due to pipetting use a thermomixer to mix instead of pipetting
Use a deep-well plate
Transfer the samples to the M-binding buffer - MagBinding beads mix and incubate 00:05:00 Room temperature
5m
Pellet the beads on a magnet for 00:03:00 and discard the supernatant
3m
Resuspend the beads in200 µL M-Wash buffer
Pellet beads on the magnet and discard the supernatant. Resuspend the beads in 100 µL M-Desulphonation buffer and incubate 00:15:00 Room temperature
Note
The beads sink quite fast to the bottom, during these 15 mins you can slowly mix on regular basis with the thermomixer
15m
Pellet beads on the magnet and discard the supernatant. Wash the beads twice with 200 µL M-Wash buffer
Dry the beads on a heating element at 55 °C for 00:10:00
In the meantime, prepare the pre-amplification mix as follows
| A | B | C | D | |
| Component | Amount (µl) | Final concentration | Mastermix (110 samples) | |
| Blue buffer (10×) | 4 | 1x | 440 | |
| dNTP mix (10mM) | 1.6 | 0.4mM | 176 | |
| Preamp Oligo (10 µM) | 1.6 | O.4 µM | 176 | |
| H2O | 32.8 | 3608 | ||
| Total volume | 40 | 4400 |
10m
Pre-amplification
8m 5s
Resuspend the beads in a 40 µL pre-amplification mix
Incubate the mixture at 55 °C for 00:04:00 and place it on the magnet
4m
After the beads are pelleted transfer 39 µL to a new plate
Incubate the samples 00:03:00 at65 °C and immediately cool on a pre-cooled aluminum rack
Centrifuge the plate at 500 x g, Room temperature, 00:00:10
3m 10s
Add 1 µL klenow exo- polymerase (50U/µl)
Vortex the samples and amplify as follows:
| A | B | C | D | |
| Segment | Temp (ºC) | Duration (min) | Ramp speed (ºC/min) | |
| 1 | 4 | 5 | - | |
| 2 | 4-37 | 8.25 | 4 | |
| 3 | 37 | 30 | - | |
| 4 | 4 | Hold |
In the meantime, prepare 6 tubes of pre-amplification mix
Note
Only add klenow exo to the mix before use
| A | B | C | D | |
| Component | Amount (µl) | Final concentration | Mastermix ( samples) | |
| Blue buffer (10×) | 0.25 | 1x | ||
| dNTP mix (10mM) | 0.1 | 0.4mM | ||
| Preamp Oligo (10 µM) | 1 | 4 µM | ||
| Klenow exo- (50 U/µl) | 0.5 | 10 U/µl | ||
| H2O | 0.65 | |||
| Total volume | 2.5 |
Heat the plate to 95 °C for 00:00:45 and transfer it to an aluminum rack pre-cooled on ice
45s
Centrifuge the plate at 500g for 00:00:10 at 15-25°C
10s
Add 2.5 µL of the pre-amplification mix
Repeat steps 72-76 five more times
Incubate as follows:
| A | B | C | D | |
| Segment | Temp (ºC) | Duration (min) | Ramp speed (ºC/min) | |
| 1 | 4 | 5 | - | |
| 2 | 4-37 | 8.25 | 4 | |
| 3 | 37 | 90 | - | |
| 4 | 4 | Hold |
Note
The first-strand product can be stored ON at 4°C or for at least a month at -20°C
Exonuclease I treatment
1h
Dilute the samples to a volume of98 µL with nuclease-free water
Add 2 µL exonuclease I (20U/µl) to the pre-amplified product and incubate 01:00:00 at 37 °C with the heated lid set to 50 °C
1h
Purification
18m
Add 75 µL AMPure XP beads (0.75:1 ratio) and mix thoroughly by pipetting up and down
Note
Tip check the volume of some samples first and adjust volumes of beads to add accordingly
Incubate 00:10:00 Room temperature
In the meantime, prepare Adaptor 2 mix
| A | B | C | D | |
| Component | Amount (µl) | Final concentration | Mastermix ( samples) | |
| Blue buffer (10×) | 4.7 | 1x | ||
| dNTP mix (10mM) | 1.9 | 0.4mM | ||
| Adapter 2 Oligo (10 µM) | 1.9 | 0.4µM | ||
| H2O | 38 | |||
| Total volume | 46.5 |
10m
Place on the magnet for 00:03:00 and discard the supernatant
3m
Add 200 µL of 80% (vol/vol) ethanol while keeping the plate on the magnet then discard ethanol after ±10sec
Repeat 84 once. Dry the AMPure XP beads for 00:05:00 Room temperature
5m
Adapter 2 tagging
12m
Resuspend the beads in 46.5 µL Adapter 2 mix
Incubate for 00:10:00 Room temperature
10m
Transfer samples to a new plate
Heat mixture to 95 °C for 00:00:45 then immediately cool on ice using an aluminum rack
45s
Spin down at 500g for 00:00:10 at 15–25°C
10s
Add 1 µL Klenow exo- (50 U/µl), vortex gently, and spin down at 500g for 00:00:10 at 15–25°C
10s
incubate as follows:
| A | B | C | D | |
| Segment | Temp (ºC) | Duration (min) | Ramp speed (ºC/min) | |
| 1 | 4 | 5 | - | |
| 2 | 4-37 | 8.25 | 4 | |
| 3 | 37 | 30 | - | |
| 4 | 4 | Hold |
In the meantime, prepare 1 tube of Adapter 2 mix
| A | B | C | D | |
| Component | Amount (µl) | Final concentration | Mastermix ( samples) | |
| Blue buffer (10×) | 0.25 | 1x | ||
| dNTP mix (10mM) | 0.1 | 0.4mM | ||
| Preamp Oligo (10 µM) | 1 | 4 µM | ||
| Klenow exo- (50 U/µl) | 0.5 | 10 U/µl | ||
| H2O | 0.65 | |||
| Total volume | 2.5 |
Heat the plate to 95 °C for 00:00:45 and transfer it to an aluminum rack pre-cooled on ice
45s
Centrifuge the plate at 500g for 00:00:10 at 15-25°C
10s
Add 2.5 µL of the Adapter 2 mix
Incubate as follows:
| A | B | C | D | |
| Segment | Temp (ºC) | Duration (min) | Ramp speed (ºC/min) | |
| 1 | 4 | 5 | - | |
| 2 | 4-37 | 8.25 | 4 | |
| 3 | 37 | 90 | - | |
| 4 | 4 | Hold |
Purification
21m 10s
Add 37.5 µL AMPure XP beads (0.75:1 ratio)
Incubate 00:10:00 at room temperature
In the meantime, prepare the library amplification mix
| A | B | C | D | |
| Component | Amount (µl) | Final Concentration | Mastermix ( samples) | |
| KAPA HIFI HotStart ReadyMix (2x) | 25 | 1x | ||
| PE1.0 (10µM) | 1 | 0.2µM | ||
| Nuclease-free water | 23 | |||
| Total volume | 49 |
10m
Place on a magnet for 00:03:00
3m
Place on a magnet for 00:03:00 and discard the supernatant
3m
Add 200 µL ethanol (70%) without disturbing the beads. After 00:00:10 remove ethanol
10s
Repeat step 102 once then dry beads 00:05:00 at room temperature
5m
Library amplification
10m
Resuspend the beads in 49 µL library amplification mix
Incubate the mixture 00:10:00 Room temperature
10m
Place on a magnet and transfer supernatant to a new plate
Add 1 µL 10µM reverse iPCRTag primer(containing a sample-specific index)
Amplify as follows:
| A | B | C | |
| Cycles | Temperature (°C) | Time | |
| 1 | 95 | 3 min | |
| 17-20 | 98 | 80 s | |
| 65 | 30 s | ||
| 72 | 30 s | ||
| 1 | 72 | 3 min | |
| 1 | 4 | Hold |
Note
The PCR product can be stored ON at 4°C or for at least a month at -20°C
Purification of amplified libraries
28m
Add 37.5µl AMPure XP beads (0.75:1 ratio) and mix well
Incubate 00:10:00 Room temperature
10m
Place on the magnet for 00:03:00 and discard supernatant
3m
Add 200 µL ethanol (70%) without removing the plate from the magnet then discard the ethanol
Repeat step 111 once then dry beads 00:05:00
5m
Resuspend the beads in 15 µL EB
Incubate 00:10:00 Room temperature
10m
Place on a magnet then transfer supernatant to a new plate
Note
Library quantity and quality can be checked using Qubit HS Assay and Bioanalyzer
expected gDNA concentration: >= 1ng/µl
expected fragment length: >200bp and on average 400-600bp
Libraries can be stored for at least a year at -20°C