Jul 31, 2019
Version 3
scNMT-seq V.3
- 1Babraham Institute, Cambridge
Protocol Citation: Stephen Clark 2019. scNMT-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.4iiguce
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 21, 2019
Last Modified: July 31, 2019
Protocol Integer ID: 24874
Keywords: Single-cell, chromatin accessibility, DNA methylation, gene expression
Abstract
Here we describe the full wetlab protocol for scNMT-seq (single-cell nucleosome position, methylome and transcriptome sequencing), a plate-based single-cell multi-omic method.
In scNMT-seq, a GpC methyltransferase is used to label non-nucleosome bound DNA thus encoding chromatin accessiblity information within the genomic DNA. Bisulfite conversion is then used to discriminate the two chromatin states which can be read from GpC dinucleotide positions. Endogenous DNA methylation is read from the CpG positions of the same molecules and gene expression data is obtained by capturing poly-A RNA on magnetic beads and pysically separating before the gDNA is bisulfite converted. This mRNA on beads is pocessed using Smart-seq2. The protocol is carried out in 96w plates and typically takes 3-4 days to complete.
Guidelines
scNMT-seq is essentially a combination of the following methods:
1. NOMe-seq:
Kelly T., Liu Y. et al 2012
doi: 10.1101/gr.143008.112
2. G&T-seq:
Macaulay I. et al 2015
doi: 10.1038/nmeth.3370
3. Smartseq2:
Picelli S. et al 2013
doi: 10.1038/nmeth.2639
4. scBS-seq:
Smallwood S., Lee H. et al 2014
doi: 10.1038/nmeth.3035
Protocols for each of these individual methods have been published elsewhere, however the full step-by-step protocol for scNMT-seq had not previously been available as a single document.
General guidelines
As with other single-cell sequencing methods it is important to minimise sources of contamination. We perform all pre-PCR pipetting steps in a dedicated pre-PCR room. Prior to starting, all surfaces and pipettes are wiped down with a dilute bleach solution (e.g. RNAse away or similar) to mitigate RNase and DNA contamination and all tubes and PCR plates are subjected to UV iradiation. We also reccomend aliquoting reagents such as oligos and dNTPs so that each tube is used once then discarded.
We use an automated pipetting robot (Agilent Bravo Workstation) for each of the pre-PCR magnetic bead portions of the protocol. This reduces hands-on time and increases reproducibility of the method. However, it is also possible to perform the whole protocol by hand with an appropriate magnet and multichanel pipettes.
Sequencing of libraries should be possible on any Illumina instrument unless certain restrictions are programmed in such as with the X10. We routinely use HiSeq 2000/2500 v4 and NextSeq500. RNA-seq libraries should be sequenced on a separate lane or flowcell to the BS-seq libraries. We have had success with read-depths of 0.5-2M per cell for the RNA-seq and 2-10M per cell for the BS-seq. We reccommend paired-end with mid-long read lengths (75-125bp) for the BS-seq to maximise cytosine coverage. However, it is possible that much lower read-depths could yeild informative data, especially in studies with large numbers of cells.
Indexes are incorporated into the BS-seq libraries during the final amplification step. We use the iPCRTag indexing system, which means that a custom index read primer needs to be spiked-in with the other i7 index primers for sequencing. However, another indexing system (e.g. Truseq) could be used by re-desigining the second strand synthesis oligo (SSO) appropriately.
Materials
MATERIALS
GpC Methyltransferase (M.CviPI) - 1,000 unitsNew England BiolabsCatalog #M0227L
RLT Plus BufferQiagen
IGEPAL-CA630Merck MilliporeSigma (Sigma-Aldrich)Catalog #I3021 SIGMA-ALDRICH
Kapa HiFi Hotstart ReadyMix (2x)Kapa BiosystemsCatalog #KK2612
Recombinant RNasin(R) RNase Inhibitor, 10,000uPromegaCatalog #N2515
Agencourt AMPure XP SPRI beadsBeckman CoulterCatalog #A63881
Nextera XT DNA Sample Preparation Kit, 96 samplesIllumina, Inc.Catalog #FC-131-1096
Nextera XT Index Kit, 96 indices, 384 samplesIllumina, Inc.Catalog #FC-131-1002
Dynabeads MyOne Streptavidin C1Invitrogen - Thermo FisherCatalog #65001
Superscript IIInvitrogen - Thermo FisherCatalog #18064014
EZ-96 DNA Methylation-Direct MagPrepZymo ResearchCatalog #D5044
Klenow (3′→ 5′ exo-) (High Concentration)EnzymaticsCatalog #P7010-HC-L
| Name | Sequence (5′ to 3′) | |
| bio-Smartseq2-dT | /5BiotinTEG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN | |
| Smartseq2 TSO | AAGCAGTGGTATCAACGCAGAGTACATrGrG+G | |
| ISPCR | AAGCAGTGGTATCAACGCAGAGT | |
| First strand oligo | /5SpC3/CTACACGACGCTCTTCCGATCTNNNNNN | |
| Second strand oligo | TGCTGAACCGCTCTTCCGATCTNNNNNN | |
| PE1.0 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T | |
| iPCRTag | CAAGCAGAAGACGGCATACGAGATXXXXXXXXGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T | |
| iTag sequencing primer | AAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTC |
Oligo sequences. All oligos should be ordered with HPLC purification.
Single-cell collection and methylase reaction
Single-cell collection and methylase reaction
Prepare GpC methylase reaction buffer:
| Reagent | amount per sample | 96 well plate (x120) | |
| Nuclease free water | 1.425 | 171 | |
| GpC methyltransferase buffer (10x) | 0.25 | 30 | |
| SAM | 0.0125 | 1.5 | |
| IGEPAL CA-630 (1%) | 0.25 | 30 | |
| RNase-in (40U/ul) | 0.0625 | 7.5 | |
| M.CviPI (4U/ul) | 0.5 | 60 | |
| Total | 2.5 | 300 |
Collect single cells in 2.5 µL of freshly prepared GpC methylase reaction mix (keep chilled on ice)
Centrifuge at ≥1000g for ≥10s.
Note
We have successfully used both flow sorting and manual pipetting for single-cell collections.
Incubate on a thermocycler:
00:15:00 37 °C
Add 5 µL RLT plus
Centrifuge at ≥1000g for ≥10s.
Store at -80 °C
Prepare oligo-dT on beads
Prepare oligo-dT on beads
Pipette 55 µL Dynabeads (MyOne Streptavidin C1) into a microcentrifuge tube. Place on a magnet and remove supernatent.
Resuspend beads in 55 µL solution A (0.1M NaOH, 0.05M NaCl) by pippetting. Place on a magnet and remove supernatent.
: Repeat solution A wash one more time
Resuspend beads in 55 µL solution B (0.1M NaCl) . Place on magnet and remove supernatent.
: Repeat solution B wash once.
Resuspend beads in 55 µL 2x B&W (2 M NaCl, 10 mM Tris-HCl, 1 mM EDTA) . Place on magnet and remove supernatent.
Resuspend beads in 55 µL 2x B&W and 55 µL bio-Smartseq2-dT (100uM) .
Note
bio-Smartseq2-dT: 5'-Biotin-TEG-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3' (IDT, purified with HPLC and resuspended in nuclease free water)
Rotate tube containing beads such that beads remain in solution for a minimum of 00:15:00 .
Note
Beads can be prepared in advance and stored at 4 °C for up to 1 month
Wash oligo dT beads and prepare for dispensing
Wash oligo dT beads and prepare for dispensing
Place on magnet and remove supernatent. Resuspend beads in 110 µL 1x B&W buffer (1M NaCl, 5mM Tris, 0.5mM EDTA) . Place on magnet and remove supernatent.
Place on magnet and remove supernatent. Resuspend beads in:
830 µL Nuclease free water ,
110 µL 5x first strand buffer (Invitrogen, Superscript II) ,
43 µL RNasin (Promega) ,
10 µL Diluted ERCC spike-in
Note
This assumes 2.5ul GpC reaction plus 5ul RLTplus. If using bigger volumes, adjust upward in proportion.
Note
ERCC spike-in is optional. The concentration used will depend on cell type (RNA content).
mRNA separation
mRNA separation
Prepare G&T-seq wash buffer:
| Reagent | 96 well plate | |
| Nuclease free water | 3430 | |
| 5x First strand buffer (Invitrogen Superscript II) | 430 | |
| DTT (100mM, Invitrogen Superscript II) | 430 | |
| Tween-20 (100%) | 22 | |
| Recombinant RNasin (40U/ul) | 43 | |
| Total | 4355 |
Prepare RT mastermix:
| Reagent | amount per sample | 96 well plate (x110) | |
| Nuclease free water | 3.715 | 408.65 | |
| 5x First strand buffer (Superscript II) | 2 | 220 | |
| Betaine (5M) | 2 | 220 | |
| DTT (100mM, Superscript II) | 0.5 | 55 | |
| dNTPs (10mM each) | 1 | 110 | |
| MgCl2 (1M) | 0.06 | 6.6 | |
| Smartseq2 TSO (100uM) | 0.1 | 11 | |
| Recombinant RNasin (40U/ul) | 0.125 | 13.75 | |
| Superscript II (200U/ul) | 0.5 | 55 | |
| Total | 10 | 1100 |
Manually pipette 10 µL of prepared oligo-dT beads to each well of the sample plate using a multichannel pipette.
Mix at maximum speed for 00:10:00
Note
We perform mRNA separation steps on an Agilent Bravo liquid handling robot. If performing this step manually, intermittent vortexing for 10 minutes achieves the same result.
Place on magnet until beads pelette. Aspirate 17.5 µL and transfer to empty lobind plate for gDNA collection.
Add 15 µL of G&T-seq wash buffer off magnet.
Mix at maximum speed for 00:01:00
Note
If performing manually, a thorough vortexing here suffices.
Place on magnet until beads pelette. Aspirate 15 µL and transfer to empty lobind plate for gDNA collection.
Repeat steps 22-25 twice more.
Note
Lysate (17.5ul) combined with 3 washes (15ul each) should now have been collected into the gDNA plate
Note
Pause point. gDNA can be frozen at -20C for later processing.
Add 10 µL RT mastermix to beads.
Mix at maximum speed for 00:01:00
Reverse transcription
Reverse transcription
Incubate on a thermocycler as follows:
01:00:00 42 °C
00:30:00 50 °C
00:10:00 60 °C
Note
Vortex plate at 30 and 60 minute time points to resuspend beads.
cDNA amplification
cDNA amplification
Add 12 µL PCR mastermix by hand using a multichannel pipette.
| Reagent | amount per cell | 96 well plate | |
| KAPA Hifi 2x Readymix | 11 | 1210 | |
| ISPCR primer (10uM) | 0.25 | 27.5 | |
| Water | 0.75 | 82.5 | |
| Total | 12 | 1320 |
Cycle as follows:
00:03:00 98 °C
18 Cycles of:
00:00:20 98 °C
00:00:15 67 °C
00:06:00 72 °C
Followed by:
00:05:00 72 °C
00:00:00 pause - usually overnight 4 °C
Note
Cycle number depends on cell type. 18 is sufficient for mouse ES cells and embryo cells.
Note
Pause point. cDNA can be frozen at -20C for later processing.
cDNA purification using 1x AMPure XP
cDNA purification using 1x AMPure XP
Note
This section is performed outside of pre-PCR room.
Add 18 µL AMPure XP beads. Mix thoroughly and incubate for 5 minutes.
Place on magnet until beads precipitate. Remove supernatent. Wash twice with 80% ethanol. Remove supernatent and air-dry beads for 5 minutes at room temperature.
Elute cDNA in 25 µL water
Check quality of a subet (e.g. 11 samples) of cDNA samples using a Bioanalyzer high sensitivty DNA chip.
Expected result
Fragment size range of 1kb to 5kb. Concentration of 100 to 500 pg/ul. If concentration is higher then dilute samples with water prior to Nextera XT library prep.
Nextera XT library prepation
Nextera XT library prepation
Note
This section is performed outside of pre-PCR room.
In a 96 well or a 384 well plate, add 2.25ul Tagmentation mastermix to each well:
| Reagent | amount per sample | 96 well plate (x120) | 384 well plate | |
| Tagment DNA buffer | 1.5 | 180 | 650 | |
| Amplicon tagment mix | 0.75 | 90 | 325 | |
| Total | 2.25 | 270 | 975 |
Using a multi-channel pipette, add 0.75ul of cDNA sample (100-500pg/ul) to the mastermix. Vortex the plate and spin down.
In a thermocycler incubate as follows:
55 °C 00:05:00 ,
4 °C pause
Add 0.75 µL NT buffer using multichannel pipette. Centrifuge then vortex to mix and centrifuge again.
Add 2.25 µL NPM (from Nextera XT kit)
Add 1.5 µL pre-mixed and diluted i7 and i5 primers
Using a multichannel pipette. Centrifuge and vortex to mix.
Note
We prepare pre-mixed indexing primers in 96w plates for this step. Using multichannel pipettes, transfer each of 8 i5 primers to 12 columns and each of 12 i7 primers to 8 rows, then dilute 5-fold with water.
Cycle as follows:
72 °C 00:05:00
95 °C 00:02:00
10 cycles of:
95 °C
65 °C
72 °C
Followed by:
72 °C 00:05:00
4 °C hold.
Pool 1 µL of each indexed cDNA library. Purify using 0.7x AMPure XP beads with 2x 80% ethanol washes.
QC using Bioanalyzer.
Genomic DNA purification
Genomic DNA purification
Add 50 µL AMPure XP beads to gDNA samples. Vortex thoroughly and incubate for 00:30:00
Place on a magnet until beads pellet. Remove supernatent, wash twice with 100 µL 80% ethanol . Remove supernatent. Immediatley resuspend in 10 µL of nuclease free water.
Note
We use an Agilent Bravo for these wash steps.
Prepare bisulfite conversion reagent
Prepare bisulfite conversion reagent
Bisulfite reagent is prepared according to manufacturers instructions (Zymo EZ-methylation direct):
Add 7.9 mL M-Solubilization Buffer and 3 mL M-Dilution Buffer to a bottle of CT Conversion Reagent. Mix at room temperature with frequent vortexing or shaking for at least 10 minutes. Add 1.6 mL M-Reaction Buffer and vortex thoroughly.
Bisulfite conversion
Bisulfite conversion
Place gDNA sample plate on magnet to pellet beads.
Add 65 µL of prepared CT Conversion Reagent solution to each sample on the magnet.
Note
Do not mix sample and beads with CT reagent – beads should remain pelleted during conversion to avoid excessive disolving of magnetic beads.
Incubate on a thermocycler as follows:
98 °C 00:08:00
64 °C 03:00:00
4 °C pause until purification (maximum duration of overnight)
Desulphonation and purification
Desulphonation and purification
Add 533 µL Zymo Magbinding beads to 32 mL M-Binding buffer , mix and dispense 305 µL per well of deepwell plate using multichannel and reservoir.
Add sample to deepwell plate containing beads and binding buffer. Mix thoroughly then transfer 100 µL back to sample plate, mix thoroughly and transfer back to deepwell plate to maximise recovery of bisuflite converted DNA. Mix for 00:05:00
Plate on magnet until beads pellet. Remove supernatent.
Add 180 µL freshly prepared 80% ethanol . Mix thoroughly.
Place on magnet until beads pellet. Remove supernatent.
Add 100 µL M-Desulphonation buffer (Zymo) . Mix thoroughly.
Incubate 00:15:00
Note
Incubate for ≥ 15 minutes and ≤ 25 minutes
Place on magnet and remove supernatent.
Add 180 µL freshly prepared 80% ethanol . Mix thoroughly.
Place on magnet until beads pellet. Remove supernatent.
: Repeat once more.
Dry beads 60 °C 00:10:00
Prepare first strand master mix for elution:
| Reagent | amount per sample | 96 well plate (x120) | |
| Nuclease free water | 31.8 | 3816 | |
| 10x Blue buffer (Enzymatics) | 4 | 480 | |
| dNTP mix (10mM each) | 1.6 | 192 | |
| First strand oligo (10uM) | 1.6 | 192 | |
| Total | 39 | 4680 |
Note
First strand oligo: /5SpC3/CTACACGACGCTCTTCCGATCTNNNNNN (IDT, HPLC purified).
This primer contains the Illumina PE read 1 sequence.
Resuspend beads in 20 µL first strand synthesis mix . incubate at 60 °C 00:05:00
Place on magnet until beads pellet. Transfer 20 µL supernatent to fresh lobind PCR plate.
: Repeat elution once more.
First strand synthesis
First strand synthesis
Place sample plate on thermocycler at 65 °C 00:03:00 then immediately cool on ice.
Add 1 µL Klenow exo- (50 U/ul, Enzymatics) using multichannel and PCR strip.
Incubate on a thermocyler as follows:
4 °C 00:05:00
Slow ramp from 4 °C to 37 °C at 30s per 1C
37 °C 00:30:00
4 °C hold.
95 °C 00:00:45 95 °C for 45 seconds then immediately cool 4 °C using two ice blocks.
Add 2.5 µL first-strand extra cycles mix
| Reagent | amount per sample | 96 well plate (x110) | |
| Nuclease free water | 0.65 | 71.5 | |
| 10x Blue buffer | 0.25 | 27.5 | |
| dNTP mix (10mM each) | 0.1 | 11 | |
| First strand oligo (10uM) | 1 | 110 | |
| Klenow exo- (50U/ul) | 0.5 | 55 | |
| Total | 2.5 | 275 |
Note
First strand oligo: /5SpC3/CTACACGACGCTCTTCCGATCTNNNNNN (IDT, HPLC purified).
This primer contains the Illumina PE read 1 sequence.
Incubate on a thermocylcer as follows:
4 °C 00:05:00
Slow ramp from 4 °C to 37 °C at 30s per 1C
37 °C 00:30:00
Repeat first strand synthesis an additional 3 times
For the fifth and final round, incubate for an additional 1 hour:
37 °C 01:00:00
4 °C hold.
Exonuclease treatment
Exonuclease treatment
50 µL Exonuclease mix
| Reagent | amount per sample | 96 well plate(x120) | |
| Nuclease free water | 48 | 5760 | |
| Exonuclease I (NEB) | 2 | 240 | |
| Total | 50 | 600 |
37 °C for 1 hour.37 °C 01:00:00
1st Strand Purification
1st Strand Purification
Add 70 µL AMPureXP beads per well of a deepwell plate. Transfer 100 µL sample to deepwell plate. Mix thoroughly and incubate at room temperature for 10 minutes.
Place plate on magent and wait until beads pellet. Remove supernatent.
Add 180 µL 80% ethanol off the magnet and mix thoroughly with pipetting.
Place plate on magent and wait until beads pellet. Remove supernatent.
Add 180 µL 80% ethanol on the magnet.
Remove supernatent and air dry at 50 °C 00:05:00
Resuspend beads in 49 µL second strand master mix
| Reagent | amount per sample | 96 well plate (x120) | |
| Nuclease free water | 40 | 4800 | |
| 10x Blue buffer | 5 | 600 | |
| dNTP mix (10mM each) | 2 | 240 | |
| Second strand oligo (10uM) | 2 | 240 | |
| Total | 49 | 5880 |
Note
Second strand oligo: TGCTGAACCGCTCTTCCGATCTNNNNNN (HPLC purified from IDT).
This primer contains the Illumina PE read 2 sequence. Users wishing to use Truseq indexing primers (instead of iPCRTag) should redesign this so that it matches the Truseq read 2 sequence (TCAGACGTGTGCTCTTCCGATC).
Transfer second strand mix containing beads to a fresh 96w PCR plate.
Second strand synthesis
Second strand synthesis
Incubate on a thermocyler:
98 °C 00:02:00 , then immediatly cool on ice.
Add 0.5 µL Klenow exo- (50U/ul, Enzymatics) and incubate:
4 °C 00:05:00
Slow ramp from 4 °C to 37 °C at 30s per 1C
37 °C 01:30:00
4 °C hold.
2nd Strand Purification
2nd Strand Purification
Prepare an aliquot of AMPure buffer by pelleting AMPure XP beads using a magnet or centrifuge and taking the supernatent.
Add 70 µL AMPure buffer and 50 µL water per well of a deepwell plate.
Transfer sample, containing beads, to the deepwell plate containing AMPure buffer and water. Mix thoroughly then incubate at room temperature 00:10:00
Place plate on magnet and wait until beads pellet.
Remove supernatent.
Wash twice with 80% ethanol.
Remove supernatent. Air dry 50 °C 00:05:00
Resuspend beads in 48 µL PCR master mix :
| Reagent | amount per sample | 96 well plate(x120) | |
| Water | 22 | 2640 | |
| KAPA Hifi readymix (2x) | 25 | 3000 | |
| PE1.0 (10uM) | 1 | 120 | |
| Total | 48 | 5760 |
Note
PE1.0: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T (IDT, HPLC)
This primer contains the full Illumina P5 and PE read 1 sequences.
Add 2 µL iTAG indexing primer (5uM)
Note
We prepare iTAG primers in 96w plates for this step.
iPCRTag: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGAGATCGGTCTCGGCATT CCTGCTGAACCGCTCTTCCGATC*T (IDT, HPLC, XXXXXXXX = 8nt index)
This primer contains the full Illumina P7 sequence, followed by an index, followed by the Illumina PE read 2 sequence.
Tranfer samples to fresh 96w PCR plate.
Library amplification
Library amplification
Cycle as follows:
95 °C 00:02:00
14 cycles of:
94 °C 00:01:20
65 °C 00:00:30
72 °C 00:00:30
Followed by:
72 °C 00:05:00
4 °C hold.
Library purification
Library purification
All subsequent steps are performed outside of pre-PCR room.
Make 2 pools of 48 libraries (5ul each) in 1.5ml tubes.
Note
The number of samples per pool depends on the number of indexes used. e.g. we typically use only 48 indexes and so make two pools of 48 samples each.
Purify each pool with 168 µL AMPure XP beads (i.e. 0.7x ratio), 2x 80% ethanol washes and elute in 100 µL water .
Purify each pool a second time 70 µL AMPure XP beads (i.e. 0.7x ratio), 2x 80% ethanol washes and elute in 100 µL water .
QC using a Bioanalyser high sensitivity chip.
Expected result
Pooled and purified scBS libraries should have a fragment length of 300-1000bp (average 450-500). Pools containing smaller fragments (especially <200bp) will result in poor alignment rates due to the presence of adapter concatemers. These should be subjected to an additional 0.7x AMPure XP purification.