Nov 02, 2020

Public workspacesci-ATAC-seq3

DOI
dx.doi.org/10.17504/protocols.io.be8mjhu6
  • Silvia Domcke1,
  • Andrew J. Hill1,
  • Riza M. Daza1,
  • Cole Trapnell1,2,
  • Darren A. Cusanovich1,3,4,
  • Jay Shendure1,2,5,6
  • 1Department of Genome Sciences, University of Washington School of Medicine, Seattle, WA, USA;
  • 2Brotman Baty Institute for Precision Medicine, Seattle, WA, USA;
  • 3Department of Cellular and Molecular Medicine, University of Arizona, Tucson, AZ, USA;
  • 4Asthma and Airway Disease Research Center, University of Arizona, Tucson, AZ, USA;
  • 5Allen Discovery Center for Cell Lineage Tracing, Seattle, WA, USA;
  • 6Howard Hughes Medical Institute, Seattle, WA, USA
  • Human Cell Atlas Method Development Community
Silvia Domcke
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.be8mjhu6
Protocol Citation: Silvia Domcke, Andrew J. Hill, Riza M. Daza, Cole Trapnell, Darren A. Cusanovich, Jay Shendure 2020. sci-ATAC-seq3. protocols.io https://dx.doi.org/10.17504/protocols.io.be8mjhu6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: April 17, 2020
Last Modified: November 02, 2020
Protocol Integer ID: 35821
Keywords: single cell ATAC-seq, single cell, chromatin accessibility, sci-ATAC-seq, sci-ATAC-seq3, combinatorial indexing, sci, ATAC,
Abstract
We developed an improved assay for single cell profiling of chromatin accessibility that both uses three levels of combinatorial indexing and, in contrast with previous iterations of sci-ATAC-seq and related methods, does not rely on molecularly barcoded Tn5 complexes (sci-ATAC-seq3). Rather, the first two rounds of indexing are achieved by ligation to either end of the conventional, uniformly loaded Tn5 transposase complex (standard Nextera™), while the final round of indexing remains through PCR. Relative to two-level sci-ATAC-seq but similar to sci-RNA-seq3, sci-ATAC-seq3 reduces the per-cell cost of library preparation as well as the rate of collisions, opening the door to experiments on the scale of 10^6 cells. This protocol no longer requires cell sorting, and we also optimized ligase and polymerase choice, kinase concentration, and oligo designs and concentrations, to maximize the number of fragments recovered from each cell. Of note, while maintaining an enrichment in accessible regions, we made the explicit choice to maximize complexity at the expense of specificity for accessible sites. In particular, we found that the fixation conditions could be tuned to adjust the sensitivity (i.e. complexity) vs. specificity (i.e. enrichment in accessible sites) of the assay.

Guidelines
The protocol workflow is as follows:
  1. Reagent preparation
  2. Nuclei isolation and fixation from cell lines
  3. Tissue pulverization, nuclei isolation and fixation from frozen tissues (steps 3-4)
  4. sci-ATAC-seq3 library construction, QC and sequencing (steps 5-13)

Oligo and primer sequences:
  • Order the barcoded oligos (see Table S7 from Domcke, Hill, Daza et al. 2020) (96-well plate format, 25 nmole DNA Oligo, standard desalting, resuspended at 100 uM in nuclease-free water, full yield) and store at -20°C until further use. Dilute oligos to 50 uM in nuclease-free water and store at -20°C.

  • Order the sequencing oligos from Table S7 from Domcke, Hill, Daza et al. 2020 (standard desalted), resuspend at 100 uM in nuclease-free water and store at -20°C.

Required equipment:
Tissue culture hood
Tissue culture incubator
Freezer (-20°C, -80°C) and refrigerator (4°C)
Eppendorf Mastercycler (thermal cycler)
FACSAria III cell sorter (BD)
Microscope
Bright-Line™ Hemacytometer (Sigma)
Centrifuge (cooled to 4°C) (Eppendorf, 5810R)
Agilent 4200 TapeStation System
Gel imager
NextSeq 500 platform (Illumina)
Liquid nitrogen tank for sample storage
DynaMag™-96 Side Skirted Magnet (Thermo Fisher Scientific, 12027)
Gel box
Ice bucket
Multi-channel pipettes (10ul, 200ul) (Rainin Instrument)
Rainin Liquidator 96 Manual Pipetting System
Pipettors
Materials
0.5 M EDTA (Thermo Fisher Scientific, AM9260G)
100 bp ladder (New England Biolabs (NEB), N3231L)
1000X Sybr (Invitrogen (Gibco/BRL Life Tech), S7563)
10mM ATP (New England Biolabs (NEB), PO756S)
10X HBSS (Gibco/BRL Life Tech, 14065-056)
10X PNK Buffer (New England Biolabs (NEB), M0201L)
1M MgCl2 (Thermo Fisher Scientific, AM9530G)
1X DPBS (Thermo Fisher Scientific, 14190-144)
5% Digitonin (Thermo Fisher Scientific, BN2006)
5M NaCl (Thermo Fisher Scientific, AM9759)
6% TBE PAGE (Invitrogen (Gibco/BRL Life Tech), EC6265BOX)
6x Orange dye (New England Biolabs (NEB), B7022S)
AMPure Beads (Beckman Coulter, A63882)
BSA, Molecular Biology Grade (New England Biolabs (NEB), B9000S)
DNA LoBind Tube 1.5 ml, PCR clean (Eppendorf North America, 22431021)
DL-Dithiothreitol, 1M 10 x 0.5ML (Sigma Aldrich, 64563-10x.5ML)
EB Buffer (Qiagen, 19086)
Falcon Tubes, 15 ml (VWR Scientific, 21008-936)
Falcon Tubes, 50 ml (VWR Scientific, 21008-940)
Falcon® 5mL Round Bottom w/ Cell Strainer (Fisher Scientific, 352235)
Green pack LTS 200ul filter tips (GP-L200F) (Rainin Instrument, 17002428)
Green pack LTS 20ul filter tips (GP-L20F) (Rainin Instrument, 17002429)
Glycerol (Sigma Aldrich, G5516-500ML)
Glycine (Sigma Aldrich, 50046-250G)
IGEPAL CA-630 (Sigma Aldrich, I8896-50ML)
Liquidator tips - 10 ul (Rainin Instrument, 17011117)
Liquidator tips - 200 ul (Rainin Instrument, 17010646)
LoBind clear, 96-well PCR Plate (Eppendorf North America, 30129512)
Low-Profile 0.2 ml 8-tube white tube w/o cap (Bio-rad Laboratories, TLS0851)
Magnesium acetate tetrahydrate (Sigma Aldrich, M5661-50G)
Microseal ‘B’ Adhesive seal (Bio-Rad Laboratories, MSB1001)
Nalgene MF 75 Sterilization Filter Unit, 0.2 um – 250 ml (VWR, 28199-112)
Nalgene MF 75 Sterilization Filter Unit, 0.2 um – 500 ml (VWR, 28198-505)
NEBNext Hi-Fidelity master mix (2x) (New England Biolabs (NEB), M0541L)
NextSeq 500 High Output kit (150 cycle) (Illumina Inc., FC-404-2002)
Non-woven gauze (Dukal, 6114)
Nuclease-free water (Thermo Fisher Scientific, AM9937)
Optical flat 8-cap strips (Bio-Rad Laboratories, TCS-0803)
Protease Inhibitors (Sigma Aldrich, P8340-1 ml)
RT-L250WS wide-orifice LTS 250 ul (Rainin Instrument, 30389249)
Reagent reservoirs (Fisher Scientific, 07-200-127)
Spermidine (Sigma Aldrich, S2626-1G)
Sybr gold (Invitrogen (Gibco/BRL Life Tech), S-11494)
Steriflip, Disposable Vacuum Filter Unit, 0.22 um pore (Fisher Scientific, SCGP00525)
T4 PNK (New England Biolabs (NEB), M0201L)
T7 Ligase (New England Biolabs (NEB), M0318L)
T7 Ligase Buffer (New England Biolabs (NEB), M0318L)
Tapestation (D5000 reagent) (Agilent Technologies, 5067-5589)
Tapestation (screentape) (Agilent Technologies, 5067-5588)
TD Buffer (2x) (Illumina Inc., FC-121-1031)
TDE1 (Tn5) (Illumina Inc., FC-121-1031)
Tris-HCl pH 7.5 (1M) (Thermo Fisher Scientific, 15567027)
Tween-20 (Thermo Fisher Scientific, BP337-500)
UltraPure Distilled Water (DNAse, RNAse, Free) (Thermo Fisher Scientific, 10977023)
DNA Clean and Concentrate (DCC-5) (Zymo Research, D4014)

Reagent preparation (30-45 mins)
Reagent preparation (30-45 mins)
  • ATAC-RSB buffer (Corces et al. Nature Methods 2017 PMCID: PMC5623106)
In a 50 ml falcon tube, combine 500 ul 1M Tris-HCl pH 7.4 (10 mM Tris-HCl final), 100 ul 5M NaCl (10 mM NaCl final), 300 ul 0.5M MgCl2 (3 mM MgCl2 final) and 49.1 ml nuclease free water. Filter sterilize by using Millipore “Steriflip” Sterile Disposable Vacuum Filter Unit, PES membrane; Pore size: 0.22 um (SCGP00525). Store buffer at 4°C for up to 6 months.

  • Make 10% Tween-20 in nuclease free water and filter sterilize by using Millipore “Steriflip” Sterile Disposable Vacuum Filter Unit, PES membrane; Pore size: 0.22 um (SCGP00525). Store buffer at 4°C for up to 6 months.

  • Make 10% IGEPAL CA-630 in nuclease free water and filter sterilize by using Millipore “Steriflip” Sterile Disposable Vacuum Filter Unit, PES membrane; Pore size: 0.22 um (SCGP00525). Store buffer at 4°C for up to 6 months.

  • Dilute 5% digitonin to 1% with nuclease-free water, store at 4°C for up to 6 months

  • Freezing buffer (FB) (Saunders et al. Genes Dev 2013 PMCID: PMC3672648)
In a 50 ml falcon tube, combine 50 mM Tris at pH 8.0, 25% glycerol, 5 mM Mg(OAc)2, 0.1 mM EDTA, and nuclease free water. Filter sterilize by using Millipore “Steriflip” Sterile Disposable Vacuum Filter Unit, PES membrane; Pore size: 0.22 um (SCGP00525). Store buffer at 4°C for up to 6 months. On the day of nuclei isolation, mix 975 ul of FB, 5 ul 5 mM DTT (Sigma-Aldrich cat. no. 646563-10X0.5ml) and 20 ul 50× protease inhibitor cocktail (Sigma-Aldrich cat. No. P8340).

  • 2.5 M glycine
Make 2.5 M glycine, combine 46.92 g of glycine in 250 ml of water, then filter sterilize (Nalgene filtration system, 0.2 um cellulose nitrate membrane (VWR, 28199-112). Store reagent at room temperature for up to 6 months.

  • 40 mM EDTA
Make 40 mM EDTA from 0.5 M EDTA stock (Invitrogen, AM9262) with water, then filter sterilize (VWR, 28198-505). Store reagent at room temperature for up to 6 months.

On the day of experiment prepare the following fresh and keep on ice:

  • Omni-ATAC lysis buffer (ATAC-RSB, 0.1% NP40, 0.1% Tween-20 and 0.01% Digitonin)

  • ATAC-RSB with 0.1% Tween-20
Nuclei isolation and fixation of cell lines (~2 hours for 4 cell lines)
Nuclei isolation and fixation of cell lines (~2 hours for 4 cell lines)
Before starting, prepare Omni-ATAC lysis buffer and ATAC-RSB with 0.1% Tween-20.
Note
GM12878 cells were cultured and maintained in RPMI 1640 medium (Thermo Fisher Scientific cat. no. 11875-093) with 15% FBS (Thermo Fisher cat. no. SH30071.03) and 1% Pen-strep (Penicillin and Streptomycin, Thermo Fisher cat. no 15140122). They were counted and split at 300,000 cells/ml three times a week.

CH12-LX murine cell line was gifted by Michael Snyder’s lab (Stanford). The cells were cultured in RPMI 1640 medium with 10% FBS, 1% Pen-strep and 10 uM beta-mercaptoethanol. They were counted and maintained at a density of 100,000 cells/ml, splitting three times a week to maintain cell concentration.

Both cell lines were incubated at 37°C with 5% CO2.


  • Pellet ~10-100 million cells by centifugation at 500 x g for 5 min at room temperature.
  • Aspirate supernatant, resuspend pellet in 1 ml Omni-ATAC lysis buffer and incubate on ice for 3 min.
  • Add 5 ml of ATAC-RSB with 0.1% Tween-20 and pellet nuclei for 5 min at 500 x g at 4°C.
  • Aspirate supernatant and resuspend nuclei in 5 ml 1X DPBS (Thermo Fisher cat. no. 14190144).
  • To crosslink the nuclei, add 140 ul of 37% formaldehyde (VWR cat. no. MK501602) in one shot for a final concentration of 1%.
  • Incubate the fixation mixture at room temperature for 10 minute inverting every 1-2 min.
  • To quench the crosslinking reaction, add 250 ul of 2.5 M glycine and incubate at room temperature for 5 minutes and then on ice for 15 minutes to stop cross-linking completely.
  • Take 20 ul of the quenched crosslinked mixture and combine with 20 ul of trypan blue for counting on a hemocytometer.
  • Spin crosslinked nuclei at 500 x g for 5 minutes at 4°C and aspirate the supernatant.
  • Resuspend fixed nuclei in appropriate amount of freezing buffer to obtain 2 million nuclei per 1 ml aliquots, snap freeze in liquid nitrogen and store at -80°C.

Note
This is a good stopping point. All samples can be stored at -80°C until further processing.

Tissue pulverization, nuclei isolation and fixation of frozen tissues (~3 hours for 6 tissues)
Tissue pulverization, nuclei isolation and fixation of frozen tissues (~3 hours for 6 tissues)
Before starting, label 2 tubes per tissue sample. The number of tubes may vary from tissue to tissue depending on size and weight of tissue.
Note
Tissues were rinsed in 1X HBSS pH 7.4 (with Ca2+ and Mg2+, no phenol red (Gibco BRL (500 ml) 14065-056) then blotted dry on semi-damp non-woven gauze (Dukal # 6114). Dried tissues were placed on heavy duty foil (Fisher Scientific, NC19180132) or in cryotube. Tissues were snap-frozen in liquid nitrogen and stored at -80°C.

Note: cryotubes can create “frost” of water crystals inside the tube due to trapped air/moisture during the snap-freeze process.

  • On the day of pulverization, cool pre-labeled tubes and hammer on dry ice beforehand with a cloth towel between the dry ice and metal.
  • Create tin foil “padding” by taking an 18” x 18” heavy duty foil, fold in half twice creating a rectangle. Fold twice more to create a square.
  • Place frozen tissue inside the foil “padding” then place padded tissue inside a pre-chilled 4 mm plastic bag to prevent tissue from falling out onto the dry ice in case the foil should rupture.
  • Chill this tissue packet between 2 slabs of dry ice.
  • Using the pre-chilled hammer, manually pulverize the tissue inside the packet; 3 to 5 impacts avoiding a grinding motion before taking a break to avoid heating the sample.
  • Chill the hammer and repeat pulverization as needed until the tissue is uniform.
  • Aliquot pulverized tissue into pre-labeled and pre-chilled 1.5 ml LoBind and nuclease-free snap cap 1.5 ml tubes (Eppendorf cat. no. 022431021).
  • Aliquots of powdered tissues can be stored at -80°C.
Note
This is a good stopping point. All samples can be stored at -80°C until further processing.

Before starting, prepare Omni-ATAC lysis buffer and ATAC-RSB with 0.1% Tween-20.

Note
On day of nuclei isolation, add lysis buffer directly to tube or pour out the frozen
aliquot into a 60 mm dish with cell lysis buffer and further mince with a blade. As long as the aliquot has not thawed at some point during storage, the powdered tissue aliquot should easily slide out of the storage tube without sample loss.

We estimate ~20,000 cells per mg of original tissue weight and performance may vary from tissue to tissue.

  • Resuspend pulverized tissue in 1 ml Omni-ATAC lysis buffer, then transfer to a 15 ml falcon tube.
  • Incubate these nuclei for 3 minutes on ice then add 5 ml ATAC-RSB + 0.1% Tween-20
  • Centrifuge the nuclei at 500 x g for 5 minutes at 4°C.
  • Aspirate supernatant and resuspend in 5 ml 1X DPBS.
  • Pass nuclei in 1X DPBS through a 100 um cell strainer (VWR cat. no. 10199-658) to remove tissue clumps.
  • In the fume hood, crosslink the nuclei by adding 140 uL of 37% formaldehyde (VWR, MK501602) for 1% final concentration. Mix quickly but gently by inverting the tube several times.
  • Incubate at room temperature for exactly 10 minutes with gentle inversion of the tube every 1-2 min.
  • Add 250 uL of 2.5 M glycine to quench the cross-linking reaction, mix well by inverting the tube several times.
  • Incubate for 5 minutes at room temperature, then on ice for 15 minutes to stop the cross-linking completely.
  • Count nuclei using a hemocytometer to know the final volume of freezing buffer to add. The goal is to freeze ~1-2 million nuclei in 1 ml of freezing buffer per tube.
  • Centrifuge the cross-linked nuclei at 500 x g for 5 minutes at 4°C, aspirate the supernatant and resuspend pellet in the appropriate amount of freezing buffer supplemented with 1x protease inhibitors and 5 mM DTT.
  • Snap-freeze nuclei in liquid nitrogen and store nuclei at -80°C.

Note
This is a good stopping point. All samples can be stored at -80°C until further processing.

Library construction, QC and sequencing
Library construction, QC and sequencing
Thawing, permeabilization, counting and tagmentation (~4 hours)

  • Before starting, prepare the Omni-ATAC lysis buffer (200 ul per sample). Also prepare RSB supplemented with 0.1% Tween-20.
  • Take frozen fixed nuclei out of the -80°C and place on a bed of dry ice.
  • Incubate nuclei in 37°C water bath until thawed (~30 sec – 1 min) and transfer nuclei to a 15 ml tube.
  • Pellet nuclei at 500 x g for 5 minutes at 4°C.
  • Aspirate supernatant without disturbing the pellet and resuspend pellet in 200 ul of Omni-ATAC lysis buffer.
  • Incubate on ice for 3 minutes.
  • Wash out the lysis buffer with 1 ml ATAC-RSB supplemented with 0.1% Tween-20 and gently invert the tube 3 times to mix.
  • Count the nuclei by combining 20 ul of nuclei and 20 ul of Trypan blue and loading 10ul on a hemocytometer. While counting and throughout the remainder of the protocol, keep nuclei on ice whenever possible.
  • For 3-level indexing experiments (with 384 barcodes introduced at each level for a total of 56,623,104 unique barcode combinations), we typically start with 4.8 million nuclei
  • For tagmentation, these nuclei are distributed at 50,000 nuclei per well spread across a 96-well LoBind plate. Different tissues or samples can be arranged in different wells of this plate.
  • Make a master mix for tagmentation reaction (to account for volume loss when multi-channel pipetting from troughs to plates we make enough for 110 reactions):
Tagmentation Master Mix1 reaction (in uL)110 reactions (in uL)
TD buffer 2X (110 rxn)252750
1X DPBS8.25907.5
1% Digitonin0.555
10% Tween-200.555
Water13.251457.5
NexteraV2 enzyme2.5
Total505225
  • Pellet nuclei at 500 x g for 5 min at 4°C.
  • Aspirate supernatant and resuspend pellet in tagmentation reaction master mix.
  • Aliquot 47.5 ul of nuclei resuspended in the tagmentation master mix using a wide bore tip (Rainin Instrument Co cat. no.30389249) across wells of a LoBind 96-well plate (Eppendorf cat. No. 30129512).
Note
Note: for the experiments described in Domcke, Hill, Daza, et al. 2020, we processed 24 samples at a time laid out as shown in the diagram below.


S1S1S1S1S9S9S9S9S17S17S17S17
S2S2S2S2S10S10S10S10S18S18S18S18
S3S3S3S3S11S11S11S11S19S19S19S19
S4S4S4S4S12S12S12S12S20S20S20S20
S5S5S5S5S13S13S13S13S21S21S21S21
S6S6S6S6S14S14S14S14S22S22S22S22
S7S7S7S7S15S15S15S15S23S23S23S23
S8S8S8S8S16S16S16S16S24S24S24S24
S = sample

  • Add 2.5 ul of Nextera v2 enzyme (Illumina Inc cat. no. FC-121-1031) per well, seal plate with adhesive tape and spin at 500 x g for 30 sec.
  • Incubate the tagmentation plate at 55°C for 30 minutes.
  • During the incubation, make a 2X stop reaction master mix by combining 25 ml of 40 mM EDTA and 3.9 ul of 6.4 M Spermidine (final concentration will be 20 mM EDTA and 1 mM Spermidine)
  • After incubation, add 50 ul of stop reaction mixture to each well and re-seal the plate.
  • Incubate at 37°C for 15 min.
Pooling, PNK reaction and N5 ligation (2.5 hours)

  • Using wide-bore tips, pool tagmented nuclei into an Eppendorf tube. Note: if more than one sample was tagmented, each sample should be pooled separately.
  • Pellet the nuclei at 500 x g for 5 minutes at 4°C.
  • Aspirate supernatant and resuspend the pellet in 500 ul of ATAC-RSB with 0.1% Tween-20.
  • Pellet the nuclei at 500 x g for 5 minutes at 4°C and aspirate the supernatant.
Note
Note: for the experiments described in Domcke, Hill, Daza, et al. 2020, we processed 24 samples at a time.

  • Resuspend the pellet in 18 ul ATAC-RSB with 0.1% Tween-20 per sample.
  • Create a PNK reaction master mix
PNK master mix1 reaction (in uL)440 reactions (in uL)
10x PNK buffer0.5220
rATP 10 mM0.5220
water1440
T4 PNK2880
Total1760

  • Add 72 ul of PNK master mix to each sample
  • Aliquot 5 ul of PNK reaction mix across 16 wells of four 96-well plates
Note
Note: Alternatively, aliquot 22.5 ul across 4 wells per sample of a 96-well plate. Use a multichannel to stamp out 5 ul of PNK reaction with nuclei across an additional three 96-well plates.


  • Seal with adhesive tape and spin at 500 x g for 5 minutes at 4°C.
  • Incubate PNK reactions at 37°C for 30 minutes.
  • Create a N5 ligation master mix for 440 reactions

N5 Ligation Master Mix1 reaction (in uL)440 reactions (in uL)
2X T7 ligase buffer104400
1000 uM_N5_splint0.1879.2
water1.12492.8
T7 DNA ligase2.51100
50 uM_N5_oligo1.2 Add separately
Total6072

  • Using a multichannel, directly add 13.8 ul of ligation master mix to each PNK reaction.
  • Using a multi-channel or a 96 head dispenser (Liquidator, cat. No. 17010335), add 1.2 ul of 50 uM N5_oligo (IDT) to each well across four 96-well plates.
  • Seal with adhesive tape and spin at 500 x g for 30 seconds then incubate at 25°C for 1 hour.
  • After the first round of ligation, add 20 ul of EDTA and Spermidine mix (20 mM EDTA and 1mM Spermidine) from a trough to stop ligation reaction and incubate at 37°C for 15 minutes.
  • Using wide bore tips, pool each well in a trough and transfer into a 50 ml falcon tube.
  • Pellet nuclei at 500 x g for 5 minutes at 4°C, aspirate supernatant and resuspend nuclei in 1 ml of ATAC-RSB with 0.1% Tween-20 to wash any residual ligation reaction mix.
  • Pellet nuclei at 500 x g for 5 minutes at 4°C and aspirate supernatant without disturbing the pellet.

N7 ligation (2 hours)

  • Create N7 ligation master mix, making enough for 440 reactions and resuspend the nuclei with the ligation master mix.

N7 Ligation Master Mix1 reaction (in uL)440 reactions (in uL)
2X T7 ligase buffer104400
1000 uM_N7_splint0.1879.2
water6.122692.8
T7 DNA ligase2.51100
50 uM_N7_oligo1.2 Add separately
Total8272

  • Transfer nuclei suspended in master mix into a trough and using wide bore tips, aliquot 18.8 ul of ligation master mix into four 96-well LoBind plates then add 1.2 ul of 50 uM N7_oligo (IDT) to each well across four 96-well plates.
  • Seal plates with adhesive tape and spin at 500 x g for 30 seconds then incubate at 25°C for 1 hour
  • Stop ligation by adding 20 ul of EDTA and Spermidine mix (20 mM EDTA and 1 mM Spermidine) and incubate at 37°C for 15 minutes.
Pooling, counting and dilution (1.5 hours)

  • Pool wells in a trough using wide bore tips and then transfer into a 50 ml falcon tube.
  • Pellet nuclei at 500 x g for 5 minutes at 4°C, aspirate supernatant and resuspend nuclei in 2 ml of Qiagen EB buffer (Qiagen cat. no. 19086).
  • Filter nuclei using FACS tube with 40 um filtered cap (Fisher Scientific cat. no # 352235)
  • Take 20 ul of resuspended and filtered nuclei and 20 ul of trypan blue to count nuclei with hemocytometer.
  • Dilute nuclei to 100 – 300 nuclei per ul and aliquot 10 ul per well into four 96-well LoBind plates.
  • In another 96-well LoBind plate, aliquot 10 ul per well into 8 wells, this will be used as a test to determine the optimal cycle number.
Note
This is a good stopping point. All 96-well plates including test PCR plate can be stored at -20°C until further processing. Otherwise, proceed to uncrosslinking step.

Reverse crosslink nuclei (overnight incubation)

  • To reverse crosslink the nuclei, make a reverse crosslink master mix for 440 reactions consisting of EB buffer, Proteinase K (Qiagen, cat. no. 19133) and 1% SDS; 1ul/0.5 ul/0.5 ul respectively per well) and add 2 ul to each well of nuclei.
  • Seal with adhesive tape, spin at 500 x g for 30 seconds and incubate at 65°C for 16 hours.
Test PCR and gel QC (~2 hours)

  • Briefly spin down uncrosslinked plates before starting.
  • Make a PCR master mix for 6 reactions
Test PCR Master Mix 1 reaction (in uL)6 reactions (in uL)
P7_10uM_row____1.25Add separately
P5_10uM_column____1.25Add separately
NEBNext Hi-Fidelity 2x Master Mix25150
100X BSA1.06
100X SYBR Green0.251.5
Water9.2555.5
Total213

  • Aliquot 35.5 ul of PCR master mix into an 8-strip tube (white without cap) (Bio-Rad Laboratories, TLS0851).
  • Add 1.25 ul each of 10 uM P7 and P5 primers.
  • Add 12 ul of uncrosslinked nuclei to the PCR and primer mix.
  • Cap reaction tubes with optical flat 8-cap strips (Bio-Rad Laboratories, TCS-0803).
  • Place test PCR reactions in the qPCR machine and monitor amplification to determine optimal cycle number.
72ºC 5 min
98ºC 30 sec
10-20 Cycles:
98ºC 10 sec
63ºC 30 sec
72ºC 1 min
Hold at 10ºC

Note: Based on the test wells, choose cycle number such that test wells were all clearly amplifying but before the fluorescence intensity in any of the wells has saturated

  • Take 1 ul of PCR product for QC.
Samples = 1 ul + 9 ul nuclease free water + 2 ul 6x loading dye
100 bp ladder (1:10) = 1 ul + 9 ul nuclease free water + 2 ul 6x loading dye
  • Run 6% TBE polyacrylamide gel, 180 volts for 35 mins.
  • Stain with 5 ul SYBR Gold in 50 ml 0.5X TBE buffer, incubate at room temperature for 5 min.
Test PCR QC - image above is unpurified PCR product run with 100 bp ladder from NEB. Nucleosome banding is evident betwen 280-300 bp (subnucleosomal), 400-500 bp (mononucleosomal) and above 500 bp for dinucleosomal etc.
PCR plate set-up for the rest of the plates (1 hour)
  • Briefly spin down the plate. Set aside on ice until the test PCR result becomes available.
  • Make a PCR master mix
PCR Master Mix1 reaction (in uL)440 reactions (in uL)
P7_10uM_row____1.25Add separately
P5_10uM_column____1.25Add separately
NEBNext Hi-Fidelity 2x Master Mix2511000
100X BSA1.0440
Water9.54180
Total15620

  • Using a multi-channel pipette, aliquot 35.5 ul of PCR master mix into each well containing uncrosslinked nuclei (make sure to change tips at every addition).
  • Add 1.25 ul each of 10 uM P7 and P5 primers.

Note row and column primer combination used during amplification.
Experiment_plate_ID3lv2_PCR_P73lv2_PCR_P5
Ex. Exp1_P1Row AColumn 1
Ex. Exp1_P2Row BColumn 2
Ex. Exp1_P3Row CColumn 3
Ex. Exp1_P4Row DColumn 4
Example for combination of row and column indices.

  • Seal with an adhesive tape then spin at 500 x g for 30 sec.
  • Run PCR plate with the optimal cycle number from test PCR result:
72ºC 5 min
98ºC 30 sec
10-20 Cycles:
98ºC 10 sec
63ºC 30 sec
72ºC 1 min
Hold at 10ºC
PCR Amplification Clean-up and QC (~1.5 hour)

Clean PCR products with Zymo Clean&Concentrator-5
  • Combine 25 ul of each PCR reaction into a trough (2.4 ml).
  • Add 2 volumes binding buffer (4.8 ml).
  • Split across 4 C&C columns (600 ul spun 3 times in each column).
  • Add 200 ul Zymo wash buffer and spin (2 washes total).
  • Use an extra spin to dry columns for 1 min after last wash.
  • Elute in 25 ul Qiagen elution buffer (let buffer stand on column 1 min, then spin 1 min at max speed).
  • Combine all 4 eluates and clean a second time with 1X AMPure beads: Add 100 ul AMPure beads.
  • Place on MPC (magnetic particle collector) until supernatant is clear.
  • Aspirate supernatant.
  • Wash beads with 200 ul 80% ethanol twice.
  • Dry beads for 30 sec – 1 min until beads are dull in color without over drying the beads.
  • Elute beads in 25 ul Qiagen EB buffer, place back in MPC and transfer supernatant to a fresh tube.

For library QC using Tapestation, follow manufacturer’s specification using D5000 ScreenTape Assay.
  • For fragment analysis with the Tapestation software, create a region table from 200 – 1000 bp in which a region molarity is calculated. Use that nM concentration to dilute library to 2 nM with buffer EB (Qiagen) and 0.1% Tween-20.


Sample_IDAvg lengthnMLibrary0.1% Tween/EB
Example. Exp1_P143017.65 ul39

  • If pooling multiple libraries, normalize each library to 2 nM and create an equimolar pool for sequencing.
  • Purified libraries and normalized 2 nM dilutions can be stored at -20°C for long term storage.
Sequencing - Illumina 150 cycle kit, high output (~1.5 hours)


Libraries can be assessed for quality with a NextSeq run before deep sequencing on a NovaSeq.

Library denaturation
  • Dilute 2N NaOH to 0.2N NaOH (10 ul 1N to 90 ul nuclease-free water).
  • In a new 1.5 Lo-Bind tube, transfer 10 ul 0.1N NaOH and add 10 ul 2nM pooled libraries.
  • Incubate at room temperature for 5 minutes.
  • Add 980 ul HT1 to dilute denatured libraries to 20 pM.
  • Dilute denatured library to 1.8 pM loading concentration (135 ul 20 pM + 1365 ul HT1).
  • Dilute custom primers to 0.6 uM (stock primers are in 100 uM)
Position Final conc. 0.6 uM (ul)HTI (ul)Volume (ml)
7Read 1914911.5
8Read 2914911.5
9Index 1 + Index 29 + 91491 + 14913.0
10sample1.8 pM15001.5
NextSeq Sequencing recipe name: 3LV2_sciATAC_high
NOTE: remember to check boxes for custom primers 7, 8 and 9
R1 - 50 bases for gDNA
R2 - 50 bases for gDNA
Index 1 - 20 bases (10 bases for N7 oligo, 15 dark cycle, 10 bases PCR barcode)
Index 2 - 20 bases (10 bases for N5 oligo, 15 dark cycle, 10 bases PCR barcode)
Sequencing Primers
3Lv2_R1_seq TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
3Lv2_R2_seqGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
3Lv2_IDX1CTCCGAGCCCACGAGACGACAAGTC
3Lv2_IDX2ACACATCTGACGCTGCCGACGACTGATTAC