Dec 25, 2022

Schistosome DNA Isolation and Colorimetric LAMP protocol for the detection of Schistosomiasis

Schistosome DNA Isolation and Colorimetric LAMP protocol for the detection of Schistosomiasis
  • 1Biomedical and Public Health Research Unit, CSIR - Water Research Institute;
  • 2Department of Clinical Microbiology, Kwame Nkrumah University of Science and Technology;
  • 3Department of Parasitology, Noguchi Memorial Institute for Medical Research, College of Health Sciences, University of Ghana;
  • 4CSIR - Water Research Institute
  • Linda B Debrah: Kumasi Centre for Collaborative Research into Tropical Medicine (KCCR);
  • Mike Y Osei-Atweneboana: CSIR College of Science and Technology;
  • protocols.io Ambassadors
  • Practical Assessment of Molecular Diagnostic Tools for Parasitic Infections
Icon indicating open access to content
QR code linking to this content
Protocol CitationIsaac Owusu-Frimpong, Linda B Debrah, samuel.k.armoo , Edward J Tettevi, Yvonne A. Ashong, Naa A. Kuma, Frank Twum Aboagye, Idun Bright, Mike Y Osei-Atweneboana 2022. Schistosome DNA Isolation and Colorimetric LAMP protocol for the detection of Schistosomiasis. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvor97xv4o/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 15, 2022
Last Modified: December 25, 2022
Protocol  Integer ID: 74016
Keywords: Schistosomiasis, Loop-medicated isothermal amplification, LAMP assay, S. haematobium, S. mansoni, pH indicator, Neglected Tropical Diseases, Molecular parasitology, Diagnosis, successful isolation of schistosome dna, schistosome dna isolation, schistosome dna, diagnosis of schistosomiasi, schistosome mitochondrial genome, gene of the schistosome mitochondrial genome, schistosomiasis schistosomiasi, schistosomiasi, specific schisto, molecular diagnostic, colorimetric lamp protocol for the detection, dna miniprep kit, neutral red dye changes from pale yellow, lamp assay, colorimetric lamp protocol, significant role in the detection
Funders Acknowledgements:
Department for International Development (DFID)
Grant ID: DFID 203089
Abstract
Schistosomiasis keeps devastating the world despite many measures put in place by control programs. Molecular diagnostics has played a significant role in the detection and monitoring of the treatment of the disease. Loop-medicated isothermal amplification has been developed with increased sensitivity and specificity to help the diagnosis of schistosomiasis. This protocol aids the successful isolation of schistosome DNA from urine and stool using Quick-DNA Miniprep kits (ZymoResearch, USA) with slight modification. Progressively, specific-specific Schisto-LAMP assay has been developed from the cytochrome c oxidase subunit 1 (COX1) gene of the schistosome mitochondrial genome. In addition, to effectively detect successful amplification, a laboratory-based colorimetric buffer which is pH dependent, was used. The neutral red dye changes from pale yellow to pink when positive and to a deep yellow color if negative. This protocol spells out the performance of two LAMP assays to detect S. haematobium and S. mansoni in urine and stool, respectively.
Guidelines
  1. Schistosoma-DNA Extraction from Stool (Zymo Kits) Protocol
  2. Schistosoma-DNA Extraction from Urine (Zymo Kit Plus) Protocol
  3. Preparation of 2X colorimetric solution mix protocol
  4. Preparation of 50 mM Neutral Red Dye Stock protocol.
  5. Preparation of 25X Dye Stocks of Neutral red protocol.
  6. Preparation of 10X SCH-LAMP Primer mix protocol
  7. Preparation of Colourimetric LAMP reaction protocol
  8. Agarose Gel Electrophoresis Protocol
Materials
DNA isolation
  • Quick-DNA Miniprep kits (ZymoResearch, USA)
  • Sterile 1.5ml microcentrifuge tube
  • Sterile 2.0ml microcentrifuge tube
  • Phosphate buffered saline tablet (PBS) – 500g
  • polyvinylpolypyrrolidone (PVPP) - 500g
  • Dithiothreitol (DTT)
  • Proteinase K
  • Cryobox
  • Nuclease-free water
  • Glass beads: 1mm and 0.2-0.4mm

Polymerase Chain Reaction
  • PCR tube (8 strip)
  • OneTaq® 2X Master Mix with Standard Buffer (New England Biolabs)
  • 1 M Tris-HCl, pH 7.5 (500 mL)
  • dNTP mix

Colorimetric Buffer
  • 2 M KCl
  • 100 mM MgSO4
  • Tween-20
  • Betaine
  • KOH
  • 50 mL Falcon tubes
  • Autoclavable Lab Bottles (500mL)
  • Neutral red powder

LAMP Reaction
  • LAMP Primer (SH and SM)
  • Bst. 2.0 WarmStart DNA polymerase (8000 units)

Consumables
  • Filtered tips 100-1000μL
  • Filtered tips 2-20μL
  • Filtered tips 20-200μL
  • Yellow tips (1000/bag)
  • Tips clear 0.1-10μL (1000/bag)

Agarose Gel
  • NaOH
  • Disodium ethylenediamine tetraacetate.2H2O (EDTA)
  • Tris-Base
  • Acetic acid
  • Ethidium Bromide (EtBr)
  • Bromophenol Blue
  • Xylene Cyanol FF
  • Glycerol
  • DNA Ladder
  • Agarose powder
  • Glass beaker or flask

Equipment
  • Vortex mixer
  • Incubator
  • Centrifuge
  • MagNa Lyser
  • Thermocycler (Gradient)
  • Heating block
  • Micropipette (10, 20, 200, 1000µL)
  • Microwave
  • Horizontal Gel electrophoresis apparatus
  • UV transilluminator
Safety warnings
Please handle ethidium bromide with care.
Before start
Make sure urine and stool specimens are well stored since storage can affect the integrity of the DNA.
Please make to sterilize all consumables to be used for this experiment.
Please work in a sterile environment to prevent carryover contamination.
pH adjustment of the colorimetric buffer must be made with a well-cleaned pH meter to prevent contamination.
Schistosoma-DNA Extraction from Stool (Zymo Kits) Protocol
0.12-gram stool is suspended in 300µL of PBS (1X phosphate-buffered saline) with 2% PVPP (polyvinylpolypyrrolidone) in a 2ml microcentrifuge tube containing glass beads and vortex.
Freeze the sample for 1 hour at -50 ºC or overnight at -20 ºC.
Defrost and bead beat in MagNA lyser for 5 minutes at 3000 rpm.
Add 400μL Genomic Lysis Buffer and 10μL Proteinase K to the mixture and mix completely by vortexing for 15-30 seconds, then incubate at 56ºC overnight (14-16 hours).
Mix by vortexing at 3000rpm for 15-30 seconds and centrifuge at 10,000 x g for one minute.
Transfer the supernatant to a Zymo-Spin™ IIC Column in a Collection Tube. Centrifuge at 10,000 x g for one minute. Discard the Collection Tube with the flow-through.
Transfer the Zymo-Spin™ IIC Column to a new Collection Tube. Add 200μl of DNA Pre-Wash Buffer to the spin column. Centrifuge at 10,000 x g for one minute.
Add 500μl of g-DNA Wash Buffer to the spin column. Centrifuge at 10,000 x g for one minute. Repeat the centrifugation to dry the spin column.
Transfer the spin column to a clean microcentrifuge tube. Add 70μl DNA Elution Buffer to the spin column. Incubate for 15-30 minutes at room temperature and then centrifuge at top speed for 30 seconds to elute the DNA.
Repeat the elution step into a different microcentrifuge tube as the second elution. The eluted DNA can be used immediately for molecular-based applications or stored ≤-20ºC for future use.
Schistosoma-DNA Extraction from Urine (Zymo Kit Plus) Protocol
Mix urine sample by pipetting up and down, and aliquot 300µL in a sterile 1.5ml microcentrifuge.
Add 200µL of PBS (1X phosphate-buffered saline) with 2% PVPP (polyvinylpolypyrrolidone) to the sample and vortex.
Add 300μL BioFluid & Cell Buffer and 10μL Proteinase K to the mixture and mix completely by vortexing for 15-30 seconds, then incubate at 56ºC overnight (14-16 hours).
Mix by vortexing at 3000rpm for 15-30 seconds and centrifuge at 10,000 x g for one minute.
Add 300μL Genomic Binding Buffer to the digested sample. Mix thoroughly or vortex for 10-15 seconds.
Transfer the supernatant to a Zymo-Spin™ IIC Column in a Collection Tube. Centrifuge at 10,000 x g for one minute. Discard the Collection Tube with the flow-through.
Transfer the Zymo-Spin™ IIC Column to a new Collection Tube. Add 200μl of DNA Pre-Wash Buffer to the spin column. Centrifuge at 10,000 x g for one minute.
Add 500μl of g-DNA Wash Buffer to the spin column. Centrifuge at 10,000 x g for one minute. Repeat the centrifugation to dry the spin column.
Transfer the spin column to a clean microcentrifuge tube. Add 70μl DNA Elution Buffer to the spin column. Incubate for 15-30 minutes at room temperature and then centrifuge at top speed for 30 seconds to elute the DNA.
Repeat the elution step again in a different microcentrifuge tube as the second elution. The eluted DNA can be used immediately for molecular-based applications or stored ≤-20ºC for future use.
Preparation of 2X colorimetric solution mix protocol

ABCD
ComponentVolume (µL)2X Concentration1X Concentration
1 M Tris-HCl, pH 7.5102 mM1 mM
10 mM dNTP mix14002.8 mM1.4 mM
2 M KCl250100 mM50 mM
100 mM MgSO480016 mM8 mM
Tween-20100.2% v/v0.1% v/v
Betaine0.938g1.6 M0.8 M
ddH2O 1500
Total Volume5000
Note: Adjust pH to 8.6 – 8.8 with 1 M KOH, and top up with ddH2O to the 5000 µL mark.

Preparation of 50 mM Neutral Red Dye Stock protocol.
Weigh 0.7222g of Neutral red powder in a beaker and dissolve in 40 mL ddH2O.
Mix thoroughly with a magnetic stirrer, and adjust the pH to 8.6 – 8.8 with 1 M KOH.
Top up the solution to the 50 mL mark with ddH2O.
Preparation of 25X Dye Stocks of Neutral red protocol.



ABC
ComponentVolume (µL)25X Concentration
50 mM Stock Dye solution502.5 mM
ddH2O950
Total Volume1000

Preparation of 10X SCH-LAMP Primer mix protocol

ABC
SpeciesPrimer NameSequence, 5' - 3'
S. haematobiumSh-COX1-Loop-FATCCATAATACCCAAACGATG
Sh-COX1-Loop-BGGTTGGTTTAGATTATTTGACTGC
Sh-COX1-F3CTGGATTTGGAATAGTTAGTCAT
Sh-COX1-B3TTTATACCTGTAGGAATCCCTAT
Sh-COX1-FIPTCGAAGCCATAGCACAAATCAAGAGGATAAGTAATAATGATTCATCG
Sh-COX1-BIPGCTTAGGAAGTGTAGTTTGAGCCCACTGAACTAAAAAATATAGCAGTC
S. mansoniSm-COX1-Loop-FTCAAAACATAAACCTCTGGAT
Sm-COX1-Loop-BTAGTATGCTTAGGTAGAGTAG
Sm-COX1-F3CGATCCTATTTTGTTTCAGCATT
Sm-COX1-B3TCCAGTTAACGAATCAAAGC
Sm-COX1-FIPCCTAACTATACCAAAACCCGGAAGATTTTGGTTTTTTGGTCATCCA
Sm-COX1-BIPGGATTGATTTGCGCTATGGCTCATAAACATATGATGACCCCAT

ABC
ComponentVolume (µL)1X Concentration
100 µM FIP321.6 µM
100 µM BIP321.6 µM
100 µM F340.2 µM
100 µM B340.2 µM
100 µM Loop-F80.4 µM
100 µM Loop-B80.4 µ
ddH2O 112
Total Volume200
Note: LAMP primer mix should be prepared independently for the two schistosome species

Preparation of Colourimetric LAMP reaction protocol



ABC
ComponentVolume (µL)/rxnMaster mix volume (µL)/100 rxn
2X Colorimetric solution101000
10X LAMP primer mix2200
2.5 mM Neutral red dye0.880
ddH2O 2.4240
Bst. 2.0 WarmStart DNA polymerase (8000 units) 0.880
DNA Template4*
Total Volume20
Note 1.: Do not centrifuge the master mix; only pulse vortex to mix thoroughly. This is because the centrifugation will precipitate the neutral red dye reducing its concentration in the solution, thus, making it non-uniform. This is done before the addition of the DNA template. Again, do not centrifuge the mixture after adding the sample DNA. Instead, mix briefly with the pipette tip.

Note 2.: A standard LAMP incubation protocol is set at 63°C(S. haematobium detection) and 65°C (S. mansoni detection) for 90 minutes, followed by 80°C for 20 minutes to inactivate the enzyme. A positive LAMP amplification shows a pink color change from pale or light yellow (before incubation). A negative LAMP assay shows a deep yellow color.

The successful LAMP amplification can be confirmed with agarose gel electrophoresis and visualized under UV light. The steps for the gel preparation is as follows;