Jul 08, 2024

Public workspaceSaturation Mutagenesis-Reinforced Functional Assays (SMuRF) for alpha-dystroglycan glycosylation enzymes (using FKRP and LARGE1 as examples)

DOI
https://dx.doi.org/10.17504/protocols.io.8epv5x1yjg1b/v1
  • Kaiyue Ma1,
  • Shushu Huang1,
  • Jenny Xu1,
  • Angela Lek1,
  • Monkol Lek1
  • 1Yale University
Jenny Xu
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.8epv5x1yjg1b/v1
Protocol Citation: Kaiyue Ma, Shushu Huang, Jenny Xu, Angela Lek, Monkol Lek 2024. Saturation Mutagenesis-Reinforced Functional Assays (SMuRF) for alpha-dystroglycan glycosylation enzymes (using FKRP and LARGE1 as examples). protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5x1yjg1b/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 07, 2023
Last Modified: July 08, 2024
Protocol Integer ID: 84629
Keywords: coding single nucleotide variant, insights for disease gene, genetic variant, single nucleotide variant, causing genetic variant, disease gene, performing deep mutational, interpretation of unresolved variant, genes fkrp, deep mutational, saturation mutagenesi, streamlining functional assay, clinical variant interpretation, dystroglycan glycosylation enzyme, critical protein structural regions susceptible to missense disruption, gene, smurf to neuromuscular disease, genome, unresolved variant, related gene, functional assay, charting variant effects hamper, genetics, critical protein, dystroglycanopathy, reinforced functional assay
Abstract
Interpretation of disease-causing genetic variants remains a challenge in the field of human genetics and rare disease. Current costs and complexity of performing deep mutational scanning for charting variant effects hampers crowd-sourcing approaches toward genome-wide resolution of variants in all disease-related genes. Our framework, Saturation Mutagenesis-Reinforced Functional assays (SMuRF), addresses these issues by modularizing DMS components, offering simple and cost-effective saturation mutagenesis, as well as streamlining functional assays to enhance interpretation of unresolved variants. Applying SMuRF to neuromuscular disease genes FKRP and LARGE1, we have generated functional scores for over 99.8% of all possible coding single nucleotide variants (SNVs), providing an additional line of evidence for clinical variant interpretation in dystroglycanopathies. Data generated from SMuRF enables severity prediction, resolve critical protein structural regions susceptible to missense disruptions, and provide training datasets for development of computational predictors. In summary, our approach provides a framework for enabling variant-to-function insights for disease genes in a manner that is accessible for crowd-sourcing implementation across standard research laboratories.
Materials
RESOURCE AVAILABILITY

Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Kaiyue Ma ([email protected]).

Materials Availability
  • Plasmids generated in this study have been deposited to Addgene: Lenti-DAG1 (205149), Lenti-UbC-FKRP-EF1α-BSD (205150), and Lenti-UbC-LARGE1-EF1α-BSD (205151)

Data and Code Availability
  • NGS raw data have been deposited at the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) and are publically available as of the date of publication. Accession numbers are listed in the Key Resources Table.
  • All original code has been deposited on Github (https://github.com/leklab) and is publicly available as of the date of publication. DOIs are listed in the key resources table.
  • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Cell Lines
  • Wildtype HAP1 (C631) and DAG1-KO HAP1 (HZGHC000120c016) cells (male lacking Y chromosome) were ordered from Horizon Discovery. All HAP1 cells were cultured at 37ºC in Iscove’s Modified Dulbecco’s Medium (IMDM) (Gibco, 12440053) with 10% Fetal Bovine Serum (FBS, R&D Systems, S11150) and 1x Antibiotic-Antimycotic (Anti-anti, Gibco, 15240062). The medium was replaced every 2 days, unless otherwise stated. HAP1 cells tend to grow into multi-layers; hence, to keep the cells in optimal status, TrypLE Express Enzyme (Gibco, 12605010) was used to passage the cells to maintain the cells in healthy confluency (30-90%). HAP1 cells used in SMuRF were immortalized using lentivirus packaged with pLV-hTERT-IRES-hygro (Addgene, 85140), a gift from Tobias Meyer.
  • HEK293T cells (female) were cultured at 37ºC in DMEM (Gibco, 11995065) with 10% FBS and 1x Anti-anti. The medium was replaced every 2 days, unless otherwise stated.
  • MB135 cells (female) were cultured at 37ºC in Ham’s F-10 Nutrient Mix (Gibco, 11550043) with 20% FBS, 1x Anti-anti, 51 ng/ml dexamethasone (Sigma- Aldrich, D2915) and 10 ng/mL basic fibroblast growth factor (EMD/Millipore, GF003AF-MG). The medium was replaced every 2 days, unless otherwise stated. MB135 cells were differentiated in Skeletal Muscle Differentiation Medium (PromoCell, C-23061) with 1x Anti- anti. The differentiation medium was replaced every 4 days, unless otherwise stated.

CRISPR RNP nucleofection
ReagentSynthetic Single Guide RNA KitSynthego
ReagentSpCas9 2NLS NucleaseSynthego

Lentiviral packaging
HEK293T cells ReagentpsPAX2addgeneCatalog #12260 ReagentpMD2.G addgeneCatalog #12259 Lentiviral plasmid Polybrene

PALS-C cloning for saturation mutagenesis
ReagentQ5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL ReagentQ5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
Reagent10 mM dNTPsNew England BiolabsCatalog #N0447
ReagentQ5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
ReagentBamHI-HFNew England BiolabsCatalog #R3136S Reagent NEBuilder HiFi DNA Assembly Master MixNew England BiolabsCatalog #E2621
QC of plasmid pools/saturation mutagenesis
HEK293T cells
HAP1 cells
ReagentQ5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL ReagentQ5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
Reagent10 mM dNTPsNew England BiolabsCatalog #N0447
ReagentQ5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
ReagentAutomated Cell CounterBio-Rad LaboratoriesCatalog #TC20
Staining for FFC and FACS 15 mL tubes

NGS library construction
ReagentPureLink Genomic DNA Mini KitInvitrogenCatalog #K182002 Immunofluorescence MB135 cells
24-well plates

Packaging and infection of rVSV/ppVSV
rVSV-LASV-GPC viral particles, ppVSVDG-VSV-G viral particles, and LASV-GPC plasmid (Dr. Melinda Brindley)
HEK293T cells

Protocol materials
ReagentSE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032
Reagent4D-NucleofectorLonza
Reagent.45μm PES filterThermo ScientificCatalog #165-0045
ReagentLenti-X GoStix PlusTakara Bio Inc.Catalog #631280
ReagentBlasticidin S HCl Gibco - Thermo Fisher ScientificCatalog #A1113903
ReagentPuromycin DihydrochlorideGibco - Thermo Fisher ScientificCatalog #A1113803
ReagentLenti-X GoStix AppTakara Bio Inc.
Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144
ReagentVersene SolutionThermo FisherCatalog #15040066
ReagentViobility 405/452 Fixable DyeMiltenyi BiotecCatalog #130-130-420
ReagentMACS BSA Stock SolutionMiltenyi BiotecCatalog # 130-091-376
ReagentautoMACS Rinsing SolutionMiltenyi BiotecCatalog #130-091-222
ReagentDPBS (10X), no calcium, no magnesiumThermo FisherCatalog #14200166
ReagentUltraPure Distilled WaterThermo Fisher ScientificCatalog #10977015
ReagentIIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593
ReagentPureLink™ Genomic DNA Mini KitThermo FisherCatalog #K182002
ReagentNunc™ Thermanox™ Coverslips, 15mm diameterThermo FisherCatalog #174969
Reagent0.1% GelatinMerck MilliporeSigma (Sigma-Aldrich)Catalog #G9391
ReagentFetal Bovine SerumR&D SystemsCatalog #S11150
ReagentAntibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062
ReagentDexamethasoneMerck MilliporeSigma (Sigma-Aldrich)Catalog #D2915
ReagentBasic Fibroblast Growth FactorMerck Millipore (EMD Millipore)Catalog #GF003AF-MG
ReagentHam's F-10 Nutrient MixThermo FisherCatalog #11550043
ReagentSkeletal Muscle Differentiation MediumPromoCellCatalog #C-23061
ReagentBovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647
ReagentRabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557
ReagentAntifade Mounting Medium with DAPIVector LaboratoriesCatalog #H1500
ReagentMicroscope SlidesFisher ScientificCatalog #22-037-246
ReagentAmmonium chloride ( ≥ 99.5 %)Merck MilliporeSigma (Sigma-Aldrich)Catalog #A9434
ReagentEndura Electrocompetent CellsLucigenCatalog #60242-1
ReagentPurelink Midiprep KitInvitrogen - Thermo FisherCatalog #K210014
Reagent.1 cm CuvettesBio-Rad LaboratoriesCatalog #1652089
ReagentGene Pulser IIBio-Rad Laboratories
ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609
ReagentMspJINew England BiolabsCatalog #R0661S
ReagentDpnINew England BiolabsCatalog #R0176S
ReagentHuman BD Fc Block™Becton Dickinson (BD)Catalog #564220
Reagent40 µm Cell StrainerFalconCatalog #352340
ReagentTransIT-LT1 Transfection ReagentMirus BioCatalog #MIR 2300
ReagentpsPAX2addgeneCatalog #12260
ReagentpMD2.GaddgeneCatalog #12259
ReagentOpti-MEM Gibco - Thermo Fisher ScientificCatalog #31985062
ReagentDMEMGibco - Thermo Fisher ScientificCatalog #11995065
ReagentLenti-X ConcentratorTakara Bio Inc.Catalog #631232
ReagentParaformaldehydeMerck MilliporeSigma (Sigma-Aldrich)Catalog #158127
ReagentLipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001
Reagent10 mM dNTPsNew England BiolabsCatalog #N0447
ReagentQ5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL
ReagentPureLink Genomic DNA Mini KitInvitrogenCatalog #K182002
ReagentQ5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
ReagentAutomated Cell CounterBio-Rad LaboratoriesCatalog #TC20
ReagentBamHI-HFNew England BiolabsCatalog #R3136S
ReagentQ5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
ReagentpsPAX2addgeneCatalog #12260
ReagentpMD2.G addgeneCatalog #12259
ReagentSpCas9 2NLS NucleaseSynthego
ReagentSynthetic Single Guide RNA KitSynthego
Reagent NEBuilder HiFi DNA Assembly Master MixNew England BiolabsCatalog #E2621
Troubleshooting
Create FKRP-KO and LARGE1-KO cell lines via CRISPR RNP nucleofection
20m
Prepare RNP complexes in ReagentSE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032

Combine Amount18 µL supplemented ReagentSE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032 , Amount6 µL of Concentration30 micromolar (µM) sgRNA, and Amount1 µL of Concentration20 micromolar (µM) Cas9 protein at TemperatureRoom temperature . Incubate at TemperatureRoom temperature for Duration00:10:00 .

10m
Spin down 150k cells at Centrifigation100 x g, 00:10:00 , resuspend in Amount5 µL supplemented ReagentSE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032 . Add the RNP complexes to the cells.

10m
Transfer the mixed samples to the wells of the 16-well Nucleocuvette Strips
Perform nucleofection with Reagent4D-NucleofectorLonza
Use EN-138 for HAP1; CA-137 for MB135
Allow the nucleofected cells to recover in the growth medium
Plate the nucleofected cells sparsely and allow them to form monoclonal clusters
Pick monoclonal cells under microscope

Determine indel event of each clonal line via targeted Sanger sequencing.
Primers used:
FKRP-GT-F: CATCACCCTCAACCTTCTGGTC
FKRP-GT-R: CATCAGGTACTAGGGCCACAAACTC
LARGE1-GT-F: GGCAATCGGGACTTTGGACA
LARGE1-GT-R: GCCTCGCCATGTAGTAAGGG
Lentivirus packaging
Grow HEK293T cells to 90% confluency in a 10-cm dish with 10 mL HEK cell growth media.
Create the plasmid mixture and perform packaging

Mix Amount1.5 mL ReagentOpti-MEM Gibco - Thermo Fisher ScientificCatalog #31985062 , Amount10 µg ReagentpsPAX2addgeneCatalog #12260 , Amount2 µg ReagentpMD2.GaddgeneCatalog #12259 , Amount9 µg lentiviral plasmid, and Amount50 µL ReagentTransIT-LT1 Transfection ReagentMirus BioCatalog #MIR 2300 .

Incubate at TemperatureRoom temperature for Duration00:15:00 .
15m
Add mixture dropwise to HEK293T cells.
Add Amount3.5 mL ReagentDMEMGibco - Thermo Fisher ScientificCatalog #11995065 to the 10 cm dish.
Incubate at Temperature37 °C for Duration72:00:00 in a cell incubator.
3d
Collect and concentrate packaged virus.

Remove supernatant and filter through a Reagent.45μm PES filterThermo ScientificCatalog #165-0045 .

Add Amount5 mL ReagentLenti-X ConcentratorTakara Bio Inc.Catalog #631232 to filtered supernatant.
Incubate on a rocker at Temperature4 °C DurationOvernight .
3d
Collect concentrated virus.
Transfer mixture to 50 mL tube.
Centrifuge at Centrifigation1800 x g, 4°C, 01:00:00 .

1h
Discard supernatant.
Resuspend pellet in Amount200 µL ReagentDMEMGibco - Thermo Fisher ScientificCatalog #11995065 .
Titrate lentivirus with ReagentLenti-X GoStix PlusTakara Bio Inc.Catalog #631280 per manufacturer's instructions. For long-term storage, store lentivirus in cryovials at Temperature-80 °C .

Transduction
Plate cells to transduce in wells.
(Perform pre-experiments following the steps below to decide optimal MOI/drug concentration)

One day later, refresh medium and add final concentration Concentration8 µg/mL polybrene.
Add lentivirus for a spinfection at Centrifigation800 x g, 30°C, 01:00:00 .

1h
After one day, refresh medium and start drug selection if applicable. Perform drug selection for 7 days-14 days, using a well of un-transduced cells as a negative control.

If construct contains BSD, add final concentration Concentration5 µg/mL ReagentBlasticidin S HCl Gibco - Thermo Fisher ScientificCatalog #A1113903 .
If construct contains PuroR, add final concentration Concentration1 µg/mL ReagentPuromycin DihydrochlorideGibco - Thermo Fisher ScientificCatalog #A1113803 .

PALS-C cloning for saturation mutagenesis
Synthesize 64-bp ssDNA oligos for each variant of all possible CDS SNVs using Twist Bioscience
Calculate plasmid template input weight:
Coverage = 10^6
Oligo library input weight = (gene cds length * coverage * block number) * (relative moleuclar mass of one oligo)/(Avogadro constant)
Plasmid template input weight = [(oligo library input weight) * (plasmid length) * 2]/(oligo length)

Anneal primers carrying degenerate nucleotides to the plasmid template and extend towards the 5' end. Conditions as below:

ReagentVolume
10 mM dNTPs1 μL
Oligo library
Plasmid template
Q5 Enh buffer10 μL
Q5 polymerase*2 μL
Q5 Rxn buffer10 μL
WaterTo 50 μL*

TemperatureTime
98 °C hot start
98 °C4 min
Annealing temperature*20 s
72 °CElongation time*
12 °Chold

Notes:
Q5 polymerase is likely to be limiting factor--optimize volume if necessary.
Determine annealing temperature/elongation time based on the product that is most difficult to amplify. If different blocks require vastly different conditions, multiple reactions can be performed. Temperature70 °C and Duration00:00:40 were used for FKRP, and Temperature68 °C and Duration00:01:30 were used for LARGE1.

2m 10s
Perform PCR purification using ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 per manufacturer's instructions.

Isolate products using block-specific primers.
PALS-C step 2: use universal F1 primer and block-specific adaptor primer R1s to amplify variant strands using the conditions below.

ReagentVolume
Q5 Rxn buffer10 μL
Q5 Enh buffer10 μL
10 mM dNTPs1 μL
Purified Step1 product*
10 μM Universal F12.5 μL
10 μM Block specific R12.5 μL
Q5 polymerase0.5 μL
WaterTo 50 μL

TemperatureTime
98 °C hot start
98 °C3 min
98 °C8 s
Annealing temperature20 s
72 °CElongation time
Repeat 3-5 for 34 more cycles
72 °C5 min
12 °Chold
*The input should be decided based on the position of the block. The more distant a block is from the 5’ side, the more input is required. Evenly distributed input for all 6 blocks of FKRP generated enough yield for subsequent steps, while the 3’ side blocks of LARGE1 required extra input. Step1-2 should be repeated if product yield is insufficient for subsequent steps.

Perform PCR purification on 19.1 products using ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 .

PALS-C Step 3: Use type2S enzyme to remove the block-specific adaptor via restriction enzyme digest.
ReagentVolume
Type2S enzyme* 2 μL
Purified Step2 product 1.2 μg
Reaction buffer 5 μL
Water To 50 μL

TemperatureTime
Reaction temperature (Lid: 60 °C) 50 min
12 °C hold
*BsmBI was used for FKRP and BsaI was used for LARGE1. The type2S enzymes were picked to avoid the presence of their recognition sites within the CDS.

Perform gel purification using ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 .

PALS-C Step 4: Add WT template and extend variant strands towards 3' end.
ReagentVolume
Q5 Rxn buffer 10 μL
Q5 Enh buffer 10 μL
10 mM dNTPs 1 μL
Purified Step3 product
Plasmid template
Q5 polymerase* 2 μL
Water To 50 μL

TemperatureTime
98 °C hot start
98 °C 5 min
72 °C 5 s
66 °C 20 s
72 °C Elongation time*
12 °C hold

*Q5 polymerase is likely to be the limiting factor of Step4, volume of which requires optimization.
*Optional: the purpose is to enhance the annealing of all strands.
*The elongation time should be sufficient for the shortest strand to be elongated to the R2 primer site


PALS-C Step 5: Use type2M enzyme ReagentMspJINew England BiolabsCatalog #R0661S and ReagentDpnINew England BiolabsCatalog #R0176S to remove templates.

ReagentVolume
DpnI 0.5 μL
MspJI 0.5 μL
CutSmart 5 μL
Enzyme activator 1 μL
Purified Step4 product 500 ng
Water To 50 μL

TemperatureTime
37 °C (Lid: 60 °C) 1 hr
12 °C Hold

Perform column purification per manufacturer's instruction.
PALS-C Step 6: Use Primer F2 and primer R2 to amplify full-length strand.

ReagentVolume
Q5 Rxn buffer 10 μL
Q5 Enh buffer 10 μL
10 mM dNTPs 1.5 μL
Purified Step5 product 100 ng
10 μM F2 2.5 μL
10 μM R2 2.5 μL
Q5 polymerase 1 μL
Water To 50 μL

TemperatureTime
98 °C hot start
98 °C 5 min
98 °C 6 s
Annealing temperature 20 s
72 °C Elongation time
Repeat 3-5 for 34 more cycles
72 °C 5 min
12 °C Hold

Perform electrophoresis and cut correct bands from gels.
IMPORTANT: Use 20 uL or less of water to dissolve after gel purification, or use vacuum concentrator to evaporate less water
Insert purified Step6 product into plasmid backbone.
PALS-C Step 7: Prepare backbone.

XbaI 1.5 μL
BamHI-HF 1.5 μL
Plasmid template 3 μg
CutSmart 5 μL
Water To 50 μL

37 °C (Lid: 60 °C) 40 min
12 °C Forever

Perform Gibson assembly.

NEBuilderMaster Mix 20 μL
Backbone 210 ng
Purified Step6 product 140 ng
Water To 30 μL

50 °C (Lid: 60 °C) 60 min
12 °C Forever

Deliver Gibson assembly products to ReagentEndura Electrocompetent CellsLucigenCatalog #60242-1 via electrotransformation.

PALS-C Step 8: Assemble the following reaction for each block.

ReagentVolume
Electrocompetent cells 40 μL
Assembly reaction 4 μL
Water 160 μL

Split sample into 2 pre-chilled Reagent.1 cm CuvettesBio-Rad LaboratoriesCatalog #1652089

Use ReagentGene Pulser IIBio-Rad Laboratories @ 25 μF; 200 Ohms; 1800 volts. Avoid bubbles.
Add sample to Amount900 µL recovery media per cuvette.
1h
Combine transformed bacteria from both cuvettes in one tube. Shake at Shaker250 rpm, 37°C, 01:00:00 .
Add 1/500 volume of the bacteria to Amount200 µL LB broth and plate it on an ampicillin LB agar plate for quick estimation of complexity

Seed all remaining bacteria in Amount150 mL LB broth with Concentration100 µg/mL ampicillin. Grow bacteria overnight. (Standard 37 °C 16hrs condition can be used but 30°C 20hrs is preferred)
Extract plasmid using ReagentPurelink Midiprep KitInvitrogen - Thermo FisherCatalog #K210014

Calculate colony forming units.
QC of plasmid pools and saturation mutagenesis
Perform QC on plasmid pools using GENEWIZ Amplicon-EZ service.
For the plasmid pool of each FKRP block, perform the following reaction.
ReagentVolume
Q5 Rxn buffer 10 μL
Q5 Enh buffer 10 μL
10 mM dNTPs 1 μL
Plasmid ~300 ng
10 μM F primer 2.5 μL
10 μM R primer 2.5 μL
Q5 polymerase 0.5 μL
Water To 50 μL

TemperatureTime
98 ºC hot start
98 °C 3 min
98 °C 6 s
70 °C 15 s
72 °C 5 s
Repeat 3-5 for 32 more cycles
72 °C 5 min
12 °C hold

For the plasmid pool of each LARGE1 block, perform the following reaction:
ReagentVolume
Q5 Rxn buffer 10 μL
Q5 Enh buffer 10 μL
10 mM dNTPs 1 μL
Plasmid ~50 ng
10 μM F primer 2.5 μL
10 μM R primer 2.5 μL
Q5 polymerase 0.5 μL
Water To 50 μL

TemperatureTime
98 °C hot start
98 °C 3 min
98 °C 6 s
Annealing temperature 15 s
72 °C 7 s
Repeat 3-5 for 33 more cycles
72 °C 5 min
12 °C Hold

Annealing temperatureBlocks
61 °C 1, 4, 6, 7
64 °C 5, 9, 10
66 °C 2, 3, 8
Perform electrophoresis and gel purification (using ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 ). Send products for sequencing.

Mix purified products and perform the following reaction:
ReagentVolume
Q5 Rxn buffer 10 μL
Q5 Enh buffer 10 μL
10 mM dNTPs 1 μL
Mixed purified products 100 ng
10 μM NGS-PCR3-F 2.5 μL
10 μM NGS-PCR3-R 2.5 μL
Q5 polymerase 1 μL
Water To 50 μL

TemperatureB
98 ºC hot start
98 ºC3 min
98 ºC6 s
72 ºC15 s
72 ªC8 s
Repeat 3-5 for 19 more cycles
72 °C 5 min
12 ºCForever
Perform PCR purification (ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 )and send sample for sequencing.

Lentiviral packaging
Perform lentiviral packaging on one 10-cm dish of HEK293T cells. Use small-scale pre-experiments to determine viral dosage for optimal separation
Using GoStix Value as quantified by the ReagentLenti-X GoStix AppTakara Bio Inc. , scale the dosage for each block.

For each block, plate 600k HAP1 cells or 200k MB135 cells in a well of a 6-well plate. After transduction and drug selection, for FACS, expand this number to 30M+.

Package lentiviral pools of all blocks at the same time using reagents and helper plasmids from the same batch to avoid batch effects. Use 1e3 - 1e4 GV x µL of lentivirus per block.
Staining for FFC and FACS
Wash cells twice with Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 .

Digest cells with ReagentVersene SolutionThermo FisherCatalog #15040066 and count with an Automated Cell Counter (Bio-Rad, TC20).

Spin down 30M cells at Centrifigation700 x g, 4°C, 00:15:00 . Resuspend in Amount3 mL Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 supplemented with Amount30 µL ReagentViobility 405/452 Fixable DyeMiltenyi BiotecCatalog #130-130-420 .

15m
Perform all following steps in the dark. Rock sample for Duration00:30:00 .

30m
Add Amount7 mL PEB buffer (1 volume of ReagentMACS BSA Stock SolutionMiltenyi BiotecCatalog # 130-091-376 , 19 volumes of ReagentautoMACS Rinsing SolutionMiltenyi BiotecCatalog #130-091-222 ) to the tube.

Spin cells down at Centrifigation700 x g, 4°C, 00:15:00 .

15m
Remove and discard supernatant.
Resuspend in Amount3 mL Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 supplemented in Amount30 µL ReagentHuman BD Fc Block™Becton Dickinson (BD)Catalog #564220 .
Rock sample gently at room temperature for Duration00:30:00 .

30m
Add Amount7 mL Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 . Spin cells down at Centrifigation700 x g, 4°C, 00:15:00 . Resuspend in Amount3 mL MAGIC buffer (5% FBS; 0.1% NaAz w/v; 10% 10× ReagentDPBS (10X), no calcium, no magnesiumThermo FisherCatalog #14200166 ; ReagentUltraPure Distilled WaterThermo Fisher ScientificCatalog #10977015 ) supplemented with 1:200 ReagentIIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593 (discontinued, or the same antibody made in Dr. Kevin Campbell's lab).

15m
Rock sample gently at Temperature4 °C for Duration20:00:00 .

20h
Add Amount7 mL MAGIC buffer.
.
Spin down at Centrifigation700 x g, 4°C, 00:10:00 .
10m
Discard supernatant.
Resuspend in Amount3 mL MAGIC buffer supplemented with 1:50ReagentRabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557 .

Rock sample gently at Temperature4 °C for Duration20:00:00 in the dark.

20h
Add Amount7 mL Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 to the sample.

Spin down at Centrifigation700 x g, 4°C, 00:10:00 .
10m
Remove supernatant.
Resuspend in Amount4 mL Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144
Filter resuspended cells using Reagent40 µm Cell StrainerFalconCatalog #352340 .
NGS library construction
Spin down the cells harvested from FACS at Centrifigation800 x g, 4°C, 00:10:00 .

10m
Harvest gDNA from each sample using ReagentPureLink™ Genomic DNA Mini KitThermo FisherCatalog #K182002

Step 1: Use primers specific to the lentiviral backbone to amplify the lentiviral CDS sequences of each sample
Perform the following reaction:
Primer nameSequence
PCR1-F GATCGTCACTTGGTACCGGTTCTAGA
PCR1-R (FKRP) TGGCACTTTTCGGGGGATCCTC
PCR1-R (LARGE1) TGGCACTTTTCGGGGGATCCCT

ReagentCatalogVolume/weight
Q5 Reaction Buffer NEB, B9027SVIAL 10 µL
Q5 High GC Enhancer NEB, B9028AVIAL 10 µL
10 mM dNTPs NEB, N0447 1 µL
Q5 High-Fidelity DNA Polymerase NEB, M0491SVIAL 1 µL
10µM PCR1-F 2.5 µL
10µM PCR1-R 2.5 µL
gDNA 0.3-1 µg
Nuclease-Free Water To 50 µL

StepTemperatureTime
Step1 98 °C Hot start
Step2 98 °C 3 mins
Step3 98 °C 8 s
Step4 68 °C 20 s
Step5 72 °C 45 s
Step 3-5, 35 cycles
Step6 72 °C 5 mins
Step7 12 °C hold

Perform electrophoresis in 1% agarose gel. Expected band sizes are 1534 bp for FKRP and 2317 bp for LARGE1. Perform gel purification using ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 and elute in Amount25 µL nuclease-free water.

Step 2: Isolate blocks.
Perform the following reaction. See Supp. Method 8 for primers.
ReagentCatalogVolume/Weight
Q5 Reaction Buffer NEB, B9027SVIAL 10 µL
Q5 High GC Enhancer NEB, B9028AVIAL 10 µL
10 mM dNTPs NEB, N0447 1 µL
Q5 High-Fidelity DNA Polymerase NEB, M0491SVIAL 1 µL
10µM PCR2-F 2.5 µL
10µM PCR2-R 2.5 µL
gDNA 0.2-0.5 µg
Nuclease-Free Water To 50 µL

StepTemperatureTime
Step1 98 °C Hot start
Step2 98 °C 3 mins
Step3 98 °C 6 s
Step4 Annealing temperature 15 s
Step5 72 °C 7 s
Step 3-5, 25 cycles
Step6 72 °C 5 mins
Step7 12 °C hold
Annealing temperatures:
TemperaturePrimers
61 °C LARGE1-blk1, LARGE1-blk4, LARGE1-blk6, LARGE1-blk7
64 °C FKRP-blk1, LARGE1-blk5, LARGE1-blk9, LARGE1-blk10
66 °C LARGE1-blk2, LARGE1-blk3, LARGE1-blk8
68 °C FKRP-blk6
72 °C FKRP-blk2, FKRP-blk3, FKRP-blk4, FKRP-blk5

Perform PCR purification with ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 . Elute with Amount40 µL nuclease-free water.

Perform adaptor addition.
Mix purified PCR2 products (Amount200 ng each) and dilute to Concentration11 ng/µL . Perform the following reaction:
ReagentCatalogTime
Q5 Reaction Buffer NEB, B9027SVIAL 10 µL
Q5 High GC Enhancer NEB, B9028AVIAL 10 µL
10 mM dNTPs NEB, N0447 1 µL
Q5 High-Fidelity DNA Polymerase NEB, M0491SVIAL 1 µL
10µM PCR3-F 2.5 µL
10µM PCR3-R 2.5 µL
Mixed sample 23 µL

StepTemperatureTime
Step1 98 °C Hot start
Step2 98 °C 3 mins
Step3 98 °C 6 s
Step4 72 °C 15 s
Step5 72 °C 8 s
Step 3-5, 25 cycles
Step6 72 °C 5 mins
Step7 12 °C Infinite
Set 3 * Amount50 µL reactions.

Perform ReagentNucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 and elute with Amount50 µL nuclease free water.

Send PCR3 product for next generation sequencing and use GENEWIZ Amplicon-EZ service to check quality and coverage. Sequence using Hiseq X service.
Immunofluorescence
Place ReagentNunc™ Thermanox™ Coverslips, 15mm diameterThermo FisherCatalog #174969 in a 24-well plate.

Coat coverslips in Reagent0.1% GelatinMerck MilliporeSigma (Sigma-Aldrich)Catalog #G9391 and immediately remove. Air-dry.

Plate MB135 cells
Resuspend 250k MB135 cells in Amount.5 mL growth medium (ReagentHam's F-10 Nutrient MixThermo FisherCatalog #11550043 with 20% ReagentFetal Bovine SerumR&D SystemsCatalog #S11150 , 1x ReagentAntibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062 , Concentration51 ng/mL ReagentDexamethasoneMerck MilliporeSigma (Sigma-Aldrich)Catalog #D2915 , and Concentration10 ng/mL ReagentBasic Fibroblast Growth FactorMerck Millipore (EMD Millipore)Catalog #GF003AF-MG )

Seed cells into each well.
One day later, change out the medium for ReagentSkeletal Muscle Differentiation MediumPromoCellCatalog #C-23061 with 1x ReagentAntibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062 .
Differentiate cells for 3-7 days until myotubes are formed.
Fix cells.
Wash cells with Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 .

Fix with 4% ReagentParaformaldehydeMerck MilliporeSigma (Sigma-Aldrich)Catalog #158127 for Duration00:10:00 at TemperatureRoom temperature .
10m
Block cells with Concentration2 % (w/v) ReagentBovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at TemperatureRoom temperature for Duration01:00:00

1h
Incubate with 1:200 ReagentIIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593 in Concentration2 % (w/v) ReagentBovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at Temperature4 °C for Duration20:00:00 .

20h
Wash cells in Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 and incubate in 1:100 ReagentRabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557 in Concentration2 % (w/v) ReagentBovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at TemperatureRoom temperature for Duration02:00:00 . Keep cells in the dark.

2h
Drop ReagentAntifade Mounting Medium with DAPIVector LaboratoriesCatalog #H1500 onto ReagentMicroscope SlidesFisher ScientificCatalog #22-037-246

Wash coverslips with Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 . Place facedown on slides over drops of DAPI and keep at TemperatureRoom temperature in the dark for Duration00:30:00 .

30m
Image on a Revolve ECHO microscope
(DAPI - EX:380/30 EM:450/50 DM:425)
(FITC - EX:470/40 EM:525/50 DM:495)
Packaging and infection of rVSV/ppVSV
12h
Transfect HEK293T cells with LASV-GPC plasmid
Transduce cells with ppVSVΔG-VSV-G viral particles. Resulting particles will be referred to as ppVSV-LASV-GPC-Generation1.
Seed HEK293T cells in a well of a 6-well plate. Incubate @ Temperature37 °C DurationOvernight .

Once cells reach 70-90% confluency, transfect cells using Amount4 µg LASV-GPC plasmid and ReagentLipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001 per manufacturer's instructions. Incubate @ Temperature37 °C Duration24:00:00 .
1d
Add ppVSVΔG-VSV-G (MOI=0.5). Calculate viral dose given estimated cell number of ~2 M.

Duration01:00:00 later, remove medium, wash with Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 , and add fresh medium to the well.
1h
The next day, collect the newly generated viral particles (referred to as ppVSV-LASV-GPC-Generation1). Perform titration to determine viral titer.
Infect LASV-GPC transfected HEK293T cells with ppVSV-LASV-GPC-Generation1 to produce ppVSV-LASV-GPC-Generation2. This reduces residual VSV-G in pseudotyped particles. ppVSV-LASV-GPC-Generation2 used moving forward.

Seed 6M HEK293T cells in a 10-cm dish. Incubate @ Temperature37 °C DurationOvernight .
Transfect cells using Amount30 µg LASV-GPC plasmid and ReagentLipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001 per manufacturer's instructions. Incubate @ Temperature37 °C Duration24:00:00 .
1d
Add ppVSV-LASV-GPC-Generation1 (MOI=0.1) to the well. Determine viral dose using estimated cell number of ~12M.
Duration01:00:00 later, remove medium, wash with Reagent1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 , and add fresh medium to the well.
1h
The next day, collect the newly generated viral particles (referred to as ppVSV-LASV-GPC-Generation1). Perform titration to determine viral titer.
Determine 50% tissue culture infectious dose using Spearman-Karber method.
Determine MOI of ppVSV (performed at MOI 1-3)
Perform transduction and blasticidin drug selection as in FACS assay
Divide cells into 2 ~1M groups. Infect one group with rVSV at a concentration of 2e5 TCID50/mL (MOI ~0.5). Add Concentration5 millimolar (mM) final concentration ReagentAmmonium chloride ( ≥ 99.5 %)Merck MilliporeSigma (Sigma-Aldrich)Catalog #A9434 during infection and recovery.

Duration60:00:00 later, refresh medium. Allow cells to recover for Duration12:00:00 (cell count ~1M).

3d
Harvest cells