Jul 08, 2024
Saturation Mutagenesis-Reinforced Functional Assays (SMuRF) for alpha-dystroglycan glycosylation enzymes (using FKRP and LARGE1 as examples)
- Kaiyue Ma1,
- Shushu Huang1,
- Jenny Xu1,
- Angela Lek1,
- Monkol Lek1
- 1Yale University
Protocol Citation: Kaiyue Ma, Shushu Huang, Jenny Xu, Angela Lek, Monkol Lek 2024. Saturation Mutagenesis-Reinforced Functional Assays (SMuRF) for alpha-dystroglycan glycosylation enzymes (using FKRP and LARGE1 as examples). protocols.io https://dx.doi.org/10.17504/protocols.io.8epv5x1yjg1b/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 06, 2023
Last Modified: July 08, 2024
Protocol Integer ID: 84629
Keywords: coding single nucleotide variant, insights for disease gene, genetic variant, single nucleotide variant, causing genetic variant, disease gene, performing deep mutational, interpretation of unresolved variant, genes fkrp, deep mutational, saturation mutagenesi, streamlining functional assay, clinical variant interpretation, dystroglycan glycosylation enzyme, critical protein structural regions susceptible to missense disruption, gene, smurf to neuromuscular disease, genome, unresolved variant, related gene, functional assay, charting variant effects hamper, genetics, critical protein, dystroglycanopathy, reinforced functional assay
Abstract
Interpretation of disease-causing genetic variants remains a challenge in the field of human
genetics and rare disease. Current costs and complexity of performing deep mutational
scanning for charting variant effects hampers crowd-sourcing approaches toward
genome-wide resolution of variants in all disease-related genes. Our framework,
Saturation Mutagenesis-Reinforced Functional assays (SMuRF), addresses these
issues by modularizing DMS components, offering simple and cost-effective
saturation mutagenesis, as well as streamlining functional assays to enhance
interpretation of unresolved variants. Applying SMuRF to neuromuscular disease
genes FKRP and LARGE1, we have generated functional scores for
over 99.8% of all possible coding single nucleotide variants (SNVs), providing
an additional line of evidence for clinical variant interpretation in
dystroglycanopathies. Data generated from SMuRF enables severity prediction, resolve
critical protein structural regions susceptible to missense disruptions, and
provide training datasets for development of computational predictors. In
summary, our approach provides a framework for enabling variant-to-function
insights for disease genes in a manner that is accessible for crowd-sourcing
implementation across standard research laboratories.
Materials
RESOURCE AVAILABILITY
Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Kaiyue Ma ([email protected]).
Materials Availability
- Plasmids generated in this study have been deposited to Addgene: Lenti-DAG1 (205149), Lenti-UbC-FKRP-EF1α-BSD (205150), and Lenti-UbC-LARGE1-EF1α-BSD (205151)
Data and Code Availability
- NGS raw data have been deposited at the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) and are publically available as of the date of publication. Accession numbers are listed in the Key Resources Table.
- All original code has been deposited on Github (https://github.com/leklab) and is publicly available as of the date of publication. DOIs are listed in the key resources table.
- Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Cell Lines
- Wildtype HAP1 (C631) and DAG1-KO HAP1 (HZGHC000120c016) cells (male lacking Y chromosome) were ordered from Horizon Discovery. All HAP1 cells were cultured at 37ºC in Iscove’s Modified Dulbecco’s Medium (IMDM) (Gibco, 12440053) with 10% Fetal Bovine Serum (FBS, R&D Systems, S11150) and 1x Antibiotic-Antimycotic (Anti-anti, Gibco, 15240062). The medium was replaced every 2 days, unless otherwise stated. HAP1 cells tend to grow into multi-layers; hence, to keep the cells in optimal status, TrypLE Express Enzyme (Gibco, 12605010) was used to passage the cells to maintain the cells in healthy confluency (30-90%). HAP1 cells used in SMuRF were immortalized using lentivirus packaged with pLV-hTERT-IRES-hygro (Addgene, 85140), a gift from Tobias Meyer.
- HEK293T cells (female) were cultured at 37ºC in DMEM (Gibco, 11995065) with 10% FBS and 1x Anti-anti. The medium was replaced every 2 days, unless otherwise stated.
- MB135 cells (female) were cultured at 37ºC in Ham’s F-10 Nutrient Mix (Gibco, 11550043) with 20% FBS, 1x Anti-anti, 51 ng/ml dexamethasone (Sigma- Aldrich, D2915) and 10 ng/mL basic fibroblast growth factor (EMD/Millipore, GF003AF-MG). The medium was replaced every 2 days, unless otherwise stated. MB135 cells were differentiated in Skeletal Muscle Differentiation Medium (PromoCell, C-23061) with 1x Anti- anti. The differentiation medium was replaced every 4 days, unless otherwise stated.
CRISPR RNP nucleofection
Synthetic Single Guide RNA KitSynthego
SpCas9 2NLS NucleaseSynthego
Lentiviral packaging
HEK293T cells
psPAX2addgeneCatalog #12260
pMD2.G addgeneCatalog #12259
Lentiviral plasmid
Polybrene
PALS-C cloning for saturation mutagenesis
Q5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL
Q5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
10 mM dNTPsNew England BiolabsCatalog #N0447
Q5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
BamHI-HFNew England BiolabsCatalog #R3136S NEBuilder HiFi DNA Assembly Master MixNew England BiolabsCatalog #E2621
QC of plasmid pools/saturation mutagenesis
HEK293T cells
HAP1 cells
Q5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL
Q5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
10 mM dNTPsNew England BiolabsCatalog #N0447
Q5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
Automated Cell CounterBio-Rad LaboratoriesCatalog #TC20
Staining for FFC and FACS
15 mL tubes
NGS library construction
PureLink Genomic DNA Mini KitInvitrogenCatalog #K182002
Immunofluorescence
MB135 cells
24-well plates
Packaging and infection of rVSV/ppVSV
rVSV-LASV-GPC viral particles, ppVSVDG-VSV-G viral particles, and LASV-GPC plasmid (Dr. Melinda Brindley)
HEK293T cells
Protocol materials
SE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032
4D-NucleofectorLonza
.45μm PES filterThermo ScientificCatalog #165-0045
Lenti-X GoStix PlusTakara Bio Inc.Catalog #631280
Blasticidin S HCl Gibco - Thermo Fisher ScientificCatalog #A1113903
Puromycin DihydrochlorideGibco - Thermo Fisher ScientificCatalog #A1113803
Lenti-X GoStix AppTakara Bio Inc.
1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144
Versene SolutionThermo FisherCatalog #15040066
Viobility 405/452 Fixable DyeMiltenyi BiotecCatalog #130-130-420
MACS BSA Stock SolutionMiltenyi BiotecCatalog # 130-091-376
autoMACS Rinsing SolutionMiltenyi BiotecCatalog #130-091-222
DPBS (10X), no calcium, no magnesiumThermo FisherCatalog #14200166
UltraPure Distilled WaterThermo Fisher ScientificCatalog #10977015
IIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593
PureLink™ Genomic DNA Mini KitThermo FisherCatalog #K182002
Nunc™ Thermanox™ Coverslips, 15mm diameterThermo FisherCatalog #174969
0.1% GelatinMerck MilliporeSigma (Sigma-Aldrich)Catalog #G9391
Fetal Bovine SerumR&D SystemsCatalog #S11150
Antibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062
DexamethasoneMerck MilliporeSigma (Sigma-Aldrich)Catalog #D2915
Basic Fibroblast Growth FactorMerck Millipore (EMD Millipore)Catalog #GF003AF-MG
Ham's F-10 Nutrient MixThermo FisherCatalog #11550043
Skeletal Muscle Differentiation MediumPromoCellCatalog #C-23061
Bovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647
Rabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557
Antifade Mounting Medium with DAPIVector LaboratoriesCatalog #H1500
Microscope SlidesFisher ScientificCatalog #22-037-246
Ammonium chloride ( ≥ 99.5 %)Merck MilliporeSigma (Sigma-Aldrich)Catalog #A9434
Endura Electrocompetent CellsLucigenCatalog #60242-1
Purelink Midiprep KitInvitrogen - Thermo FisherCatalog #K210014
.1 cm CuvettesBio-Rad LaboratoriesCatalog #1652089
Gene Pulser IIBio-Rad Laboratories
NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609
MspJINew England BiolabsCatalog #R0661S
DpnINew England BiolabsCatalog #R0176S
Human BD Fc Block™Becton Dickinson (BD)Catalog #564220
40 µm Cell StrainerFalconCatalog #352340
TransIT-LT1 Transfection ReagentMirus BioCatalog #MIR 2300
psPAX2addgeneCatalog #12260
pMD2.GaddgeneCatalog #12259
Opti-MEM Gibco - Thermo Fisher ScientificCatalog #31985062
DMEMGibco - Thermo Fisher ScientificCatalog #11995065
Lenti-X ConcentratorTakara Bio Inc.Catalog #631232
ParaformaldehydeMerck MilliporeSigma (Sigma-Aldrich)Catalog #158127
Lipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001
10 mM dNTPsNew England BiolabsCatalog #N0447
Q5 Reaction BufferNew England BiolabsCatalog #B9027SVIAL
PureLink Genomic DNA Mini KitInvitrogenCatalog #K182002
Q5 High-Fidelity DNA Polymerase New England BiolabsCatalog #M0491SVIAL
Automated Cell CounterBio-Rad LaboratoriesCatalog #TC20
BamHI-HFNew England BiolabsCatalog #R3136S
Q5 High GC Enhancer New England BiolabsCatalog #B9028AVIAL
psPAX2addgeneCatalog #12260
pMD2.G addgeneCatalog #12259
SpCas9 2NLS NucleaseSynthego
Synthetic Single Guide RNA KitSynthego
NEBuilder HiFi DNA Assembly Master MixNew England BiolabsCatalog #E2621
Create FKRP-KO and LARGE1-KO cell lines via CRISPR RNP nucleofection
20m
Prepare RNP complexes in SE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032
Combine 18 µL supplemented SE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032 , 6 µL of 30 micromolar (µM) sgRNA, and 1 µL of 20 micromolar (µM) Cas9 protein at Room temperature . Incubate at Room temperature for 00:10:00 .
10m
Spin down 150k cells at 100 x g, 00:10:00 , resuspend in 5 µL supplemented SE Cell Line Nucleofector SolutionLonzaCatalog #V4XC-1032 . Add the RNP complexes to the cells.
10m
Transfer the mixed samples to the wells of the 16-well Nucleocuvette Strips
Perform nucleofection with 4D-NucleofectorLonza
Use EN-138 for HAP1; CA-137 for MB135
Allow the nucleofected cells to recover in the growth medium
Plate the nucleofected cells sparsely and allow them to form monoclonal clusters
Pick monoclonal cells under microscope
Determine indel event of each clonal line via targeted Sanger sequencing.
Primers used:
FKRP-GT-F: CATCACCCTCAACCTTCTGGTC
FKRP-GT-R: CATCAGGTACTAGGGCCACAAACTC
LARGE1-GT-F: GGCAATCGGGACTTTGGACA
LARGE1-GT-R: GCCTCGCCATGTAGTAAGGG
Lentivirus packaging
Grow HEK293T cells to 90% confluency in a 10-cm dish with 10 mL HEK cell growth media.
Create the plasmid mixture and perform packaging
Mix 1.5 mL Opti-MEM Gibco - Thermo Fisher ScientificCatalog #31985062 , 10 µg psPAX2addgeneCatalog #12260 , 2 µg pMD2.GaddgeneCatalog #12259 , 9 µg lentiviral plasmid, and 50 µL TransIT-LT1 Transfection ReagentMirus BioCatalog #MIR 2300 .
Incubate at Room temperature for 00:15:00 .
15m
Add mixture dropwise to HEK293T cells.
Add 3.5 mL DMEMGibco - Thermo Fisher ScientificCatalog #11995065 to the 10 cm dish.
Incubate at 37 °C for 72:00:00 in a cell incubator.
3d
Collect and concentrate packaged virus.
Remove supernatant and filter through a .45μm PES filterThermo ScientificCatalog #165-0045 .
Add 5 mL Lenti-X ConcentratorTakara Bio Inc.Catalog #631232 to filtered supernatant.
Incubate on a rocker at 4 °C Overnight .
3d
Collect concentrated virus.
Transfer mixture to 50 mL tube.
Centrifuge at 1800 x g, 4°C, 01:00:00 .
1h
Discard supernatant.
Resuspend pellet in 200 µL DMEMGibco - Thermo Fisher ScientificCatalog #11995065 .
Titrate lentivirus with Lenti-X GoStix PlusTakara Bio Inc.Catalog #631280 per manufacturer's instructions. For long-term storage, store lentivirus in cryovials at -80 °C .
Transduction
Plate cells to transduce in wells.
(Perform pre-experiments following the steps below to decide optimal MOI/drug concentration)
One day later, refresh medium and add final concentration 8 µg/mL polybrene.
Add lentivirus for a spinfection at 800 x g, 30°C, 01:00:00 .
1h
After one day, refresh medium and start drug selection if applicable. Perform drug selection for 7 days-14 days, using a well of un-transduced cells as a negative control.
If construct contains BSD, add final concentration 5 µg/mL Blasticidin S HCl Gibco - Thermo Fisher ScientificCatalog #A1113903 .
If construct contains PuroR, add final concentration 1 µg/mL Puromycin DihydrochlorideGibco - Thermo Fisher ScientificCatalog #A1113803 .
PALS-C cloning for saturation mutagenesis
Synthesize 64-bp ssDNA oligos for each variant of all possible CDS SNVs using Twist Bioscience
Calculate plasmid template input weight:
Coverage = 10^6
Oligo library input weight = (gene cds length * coverage * block number) * (relative moleuclar mass of one oligo)/(Avogadro constant)
Plasmid template input weight = [(oligo library input weight) * (plasmid length) * 2]/(oligo length)
Anneal primers carrying degenerate nucleotides to the plasmid template and extend towards the 5' end. Conditions as below:
| Reagent | Volume | |
| 10 mM dNTPs | 1 μL | |
| Oligo library | ||
| Plasmid template | ||
| Q5 Enh buffer | 10 μL | |
| Q5 polymerase* | 2 μL | |
| Q5 Rxn buffer | 10 μL | |
| Water | To 50 μL* |
| Temperature | Time | |
| 98 °C | hot start | |
| 98 °C | 4 min | |
| Annealing temperature* | 20 s | |
| 72 °C | Elongation time* | |
| 12 °C | hold |
Notes:
Q5 polymerase is likely to be limiting factor--optimize volume if necessary.
Determine annealing temperature/elongation time based on the product that is most difficult to amplify. If different blocks require vastly different conditions, multiple reactions can be performed. 70 °C and 00:00:40 were used for FKRP, and 68 °C and 00:01:30 were used for LARGE1.
2m 10s
Perform PCR purification using NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 per manufacturer's instructions.
Isolate products using block-specific primers.
PALS-C step 2: use universal F1 primer and block-specific adaptor primer R1s to amplify variant strands using the conditions below.
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1 μL | |
| Purified Step1 product | * | |
| 10 μM Universal F1 | 2.5 μL | |
| 10 μM Block specific R1 | 2.5 μL | |
| Q5 polymerase | 0.5 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| 98 °C | hot start | |
| 98 °C | 3 min | |
| 98 °C | 8 s | |
| Annealing temperature | 20 s | |
| 72 °C | Elongation time | |
| Repeat 3-5 for 34 more cycles | ||
| 72 °C | 5 min | |
| 12 °C | hold |
*The input should be decided based on the position of the block. The more distant a block is from the 5’ side, the more input is required. Evenly distributed input for all 6 blocks of FKRP generated enough yield for subsequent steps, while the 3’ side blocks of LARGE1 required extra input. Step1-2 should be repeated if product yield is insufficient for subsequent steps.
Perform PCR purification on 19.1 products using NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 .
PALS-C Step 3: Use type2S enzyme to remove the block-specific adaptor via restriction enzyme digest.
| Reagent | Volume | |
| Type2S enzyme* | 2 μL | |
| Purified Step2 product | 1.2 μg | |
| Reaction buffer | 5 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| Reaction temperature (Lid: 60 °C) | 50 min | |
| 12 °C | hold |
*BsmBI was used for FKRP and BsaI was used for
LARGE1. The type2S enzymes were picked to avoid the presence of their
recognition sites within the CDS.
Perform gel purification using NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 .
PALS-C Step 4: Add WT template and extend variant strands towards 3' end.
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1 μL | |
| Purified Step3 product | ||
| Plasmid template | ||
| Q5 polymerase* | 2 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| 98 °C | hot start | |
| 98 °C | 5 min | |
| 72 °C | 5 s | |
| 66 °C | 20 s | |
| 72 °C | Elongation time* | |
| 12 °C | hold |
*Q5 polymerase is likely to be the limiting factor of Step4, volume of which requires optimization.
*Optional: the purpose is to enhance the annealing of all strands.
*The elongation time should be sufficient for the shortest strand to be elongated to the R2 primer site
PALS-C Step 5: Use type2M enzyme MspJINew England BiolabsCatalog #R0661S and DpnINew England BiolabsCatalog #R0176S to remove templates.
| Reagent | Volume | |
| DpnI | 0.5 μL | |
| MspJI | 0.5 μL | |
| CutSmart | 5 μL | |
| Enzyme activator | 1 μL | |
| Purified Step4 product | 500 ng | |
| Water | To 50 μL |
| Temperature | Time | |
| 37 °C (Lid: 60 °C) | 1 hr | |
| 12 °C | Hold |
Perform column purification per manufacturer's instruction.
PALS-C Step 6: Use Primer F2 and primer R2 to amplify full-length strand.
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1.5 μL | |
| Purified Step5 product | 100 ng | |
| 10 μM F2 | 2.5 μL | |
| 10 μM R2 | 2.5 μL | |
| Q5 polymerase | 1 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| 98 °C | hot start | |
| 98 °C | 5 min | |
| 98 °C | 6 s | |
| Annealing temperature | 20 s | |
| 72 °C | Elongation time | |
| Repeat 3-5 for 34 more cycles | ||
| 72 °C | 5 min | |
| 12 °C | Hold |
Perform electrophoresis and cut correct bands from gels.
IMPORTANT: Use 20 uL or less of water to dissolve after gel purification, or use vacuum concentrator to evaporate less water
Insert purified Step6 product into plasmid backbone.
PALS-C Step 7: Prepare backbone.
| XbaI | 1.5 μL | |
| BamHI-HF | 1.5 μL | |
| Plasmid template | 3 μg | |
| CutSmart | 5 μL | |
| Water | To 50 μL |
| 37 °C (Lid: 60 °C) | 40 min | |
| 12 °C | Forever |
Perform Gibson assembly.
| NEBuilderMaster Mix | 20 μL | |
| Backbone | 210 ng | |
| Purified Step6 product | 140 ng | |
| Water | To 30 μL |
| 50 °C (Lid: 60 °C) | 60 min | |
| 12 °C | Forever |
Deliver Gibson assembly products to Endura Electrocompetent CellsLucigenCatalog #60242-1 via electrotransformation.
PALS-C Step 8: Assemble the following reaction for each block.
| Reagent | Volume | |
| Electrocompetent cells | 40 μL | |
| Assembly reaction | 4 μL | |
| Water | 160 μL |
Split sample into 2 pre-chilled .1 cm CuvettesBio-Rad LaboratoriesCatalog #1652089
Use Gene Pulser IIBio-Rad Laboratories @ 25 μF; 200 Ohms; 1800 volts. Avoid bubbles.
Add sample to 900 µL recovery media per cuvette.
1h
Combine transformed bacteria from both cuvettes in one tube. Shake at 250 rpm, 37°C, 01:00:00 .
Add 1/500 volume of the bacteria to 200 µL LB broth and plate it on an ampicillin LB agar plate for quick estimation of complexity
Seed all remaining bacteria in 150 mL LB broth with 100 µg/mL ampicillin. Grow bacteria overnight. (Standard 37 °C 16hrs condition can be used but 30°C 20hrs is preferred)
Extract plasmid using Purelink Midiprep KitInvitrogen - Thermo FisherCatalog #K210014
Calculate colony forming units.
QC of plasmid pools and saturation mutagenesis
Perform QC on plasmid pools using GENEWIZ Amplicon-EZ service.
For the plasmid pool of each FKRP block, perform the following reaction.
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1 μL | |
| Plasmid | ~300 ng | |
| 10 μM F primer | 2.5 μL | |
| 10 μM R primer | 2.5 μL | |
| Q5 polymerase | 0.5 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| 98 ºC | hot start | |
| 98 °C | 3 min | |
| 98 °C | 6 s | |
| 70 °C | 15 s | |
| 72 °C | 5 s | |
| Repeat 3-5 for 32 more cycles | ||
| 72 °C | 5 min | |
| 12 °C | hold |
For the plasmid pool of each LARGE1 block, perform the following reaction:
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1 μL | |
| Plasmid | ~50 ng | |
| 10 μM F primer | 2.5 μL | |
| 10 μM R primer | 2.5 μL | |
| Q5 polymerase | 0.5 μL | |
| Water | To 50 μL |
| Temperature | Time | |
| 98 °C | hot start | |
| 98 °C | 3 min | |
| 98 °C | 6 s | |
| Annealing temperature | 15 s | |
| 72 °C | 7 s | |
| Repeat 3-5 for 33 more cycles | ||
| 72 °C | 5 min | |
| 12 °C | Hold |
| Annealing temperature | Blocks | |
| 61 °C | 1, 4, 6, 7 | |
| 64 °C | 5, 9, 10 | |
| 66 °C | 2, 3, 8 |
Perform electrophoresis and gel purification (using NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 ). Send products for sequencing.
Mix purified products and perform the following reaction:
| Reagent | Volume | |
| Q5 Rxn buffer | 10 μL | |
| Q5 Enh buffer | 10 μL | |
| 10 mM dNTPs | 1 μL | |
| Mixed purified products | 100 ng | |
| 10 μM NGS-PCR3-F | 2.5 μL | |
| 10 μM NGS-PCR3-R | 2.5 μL | |
| Q5 polymerase | 1 μL | |
| Water | To 50 μL |
| Temperature | B | |
| 98 ºC | hot start | |
| 98 ºC | 3 min | |
| 98 ºC | 6 s | |
| 72 ºC | 15 s | |
| 72 ªC | 8 s | |
| Repeat 3-5 for 19 more cycles | ||
| 72 °C | 5 min | |
| 12 ºC | Forever |
Perform PCR purification (NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 )and send sample for sequencing.
Lentiviral packaging
Perform lentiviral packaging on one 10-cm dish of HEK293T cells. Use small-scale pre-experiments to determine viral dosage for optimal separation
Using GoStix Value as quantified by the Lenti-X GoStix AppTakara Bio Inc. , scale the dosage for each block.
For each block, plate 600k HAP1 cells or 200k MB135 cells in a well of a 6-well plate. After transduction and drug selection, for FACS, expand this number to 30M+.
Package lentiviral pools of all blocks at the same time using reagents and helper plasmids from the same batch to avoid batch effects. Use 1e3 - 1e4 GV x µL of lentivirus per block.
Staining for FFC and FACS
Wash cells twice with 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 .
Digest cells with Versene SolutionThermo FisherCatalog #15040066 and count with an Automated Cell Counter (Bio-Rad, TC20).
Spin down 30M cells at 700 x g, 4°C, 00:15:00 . Resuspend in 3 mL 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 supplemented with 30 µL Viobility 405/452 Fixable DyeMiltenyi BiotecCatalog #130-130-420 .
15m
Perform all following steps in the dark. Rock sample for 00:30:00 .
30m
Add 7 mL PEB buffer (1 volume of MACS BSA Stock SolutionMiltenyi BiotecCatalog # 130-091-376 , 19 volumes of autoMACS Rinsing SolutionMiltenyi BiotecCatalog #130-091-222 ) to the tube.
Spin cells down at 700 x g, 4°C, 00:15:00 .
15m
Remove and discard supernatant.
Resuspend in 3 mL 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 supplemented in 30 µL Human BD Fc Block™Becton Dickinson (BD)Catalog #564220 .
Rock sample gently at room temperature for 00:30:00 .
30m
Add 7 mL 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 . Spin cells down at 700 x g, 4°C, 00:15:00 . Resuspend in 3 mL MAGIC buffer (5% FBS; 0.1% NaAz w/v; 10% 10× DPBS (10X), no calcium, no magnesiumThermo FisherCatalog #14200166 ; UltraPure Distilled WaterThermo Fisher ScientificCatalog #10977015 ) supplemented with 1:200 IIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593 (discontinued, or the same antibody made in Dr. Kevin Campbell's lab).
15m
Rock sample gently at 4 °C for 20:00:00 .
20h
Add 7 mL MAGIC buffer.
.
Spin down at 700 x g, 4°C, 00:10:00 .
10m
Discard supernatant.
Resuspend in 3 mL MAGIC buffer supplemented with 1:50Rabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557 .
Rock sample gently at 4 °C for 20:00:00 in the dark.
20h
Add 7 mL 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 to the sample.
Spin down at 700 x g, 4°C, 00:10:00 .
10m
Remove supernatant.
Resuspend in 4 mL 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144
Filter resuspended cells using 40 µm Cell StrainerFalconCatalog #352340 .
NGS library construction
Spin down the cells harvested from FACS at 800 x g, 4°C, 00:10:00 .
10m
Harvest gDNA from each sample using PureLink™ Genomic DNA Mini KitThermo FisherCatalog #K182002
Step 1: Use primers specific to the lentiviral backbone to amplify the lentiviral CDS sequences of each sample
Perform the following reaction:
| Primer name | Sequence | |
| PCR1-F | GATCGTCACTTGGTACCGGTTCTAGA | |
| PCR1-R (FKRP) | TGGCACTTTTCGGGGGATCCTC | |
| PCR1-R (LARGE1) | TGGCACTTTTCGGGGGATCCCT |
| Reagent | Catalog | Volume/weight | |
| Q5 Reaction Buffer | NEB, B9027SVIAL | 10 µL | |
| Q5 High GC Enhancer | NEB, B9028AVIAL | 10 µL | |
| 10 mM dNTPs | NEB, N0447 | 1 µL | |
| Q5 High-Fidelity DNA Polymerase | NEB, M0491SVIAL | 1 µL | |
| 10µM PCR1-F | 2.5 µL | ||
| 10µM PCR1-R | 2.5 µL | ||
| gDNA | 0.3-1 µg | ||
| Nuclease-Free Water | To 50 µL |
| Step | Temperature | Time | |
| Step1 | 98 °C | Hot start | |
| Step2 | 98 °C | 3 mins | |
| Step3 | 98 °C | 8 s | |
| Step4 | 68 °C | 20 s | |
| Step5 | 72 °C | 45 s | |
| Step 3-5, 35 cycles | |||
| Step6 | 72 °C | 5 mins | |
| Step7 | 12 °C | hold |
Perform electrophoresis in 1% agarose gel. Expected band sizes are 1534 bp for FKRP and 2317 bp for LARGE1. Perform gel purification using NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 and elute in 25 µL nuclease-free water.
Step 2: Isolate blocks.
Perform the following reaction. See Supp. Method 8 for primers.
| Reagent | Catalog | Volume/Weight | |
| Q5 Reaction Buffer | NEB, B9027SVIAL | 10 µL | |
| Q5 High GC Enhancer | NEB, B9028AVIAL | 10 µL | |
| 10 mM dNTPs | NEB, N0447 | 1 µL | |
| Q5 High-Fidelity DNA Polymerase | NEB, M0491SVIAL | 1 µL | |
| 10µM PCR2-F | 2.5 µL | ||
| 10µM PCR2-R | 2.5 µL | ||
| gDNA | 0.2-0.5 µg | ||
| Nuclease-Free Water | To 50 µL |
| Step | Temperature | Time | |
| Step1 | 98 °C | Hot start | |
| Step2 | 98 °C | 3 mins | |
| Step3 | 98 °C | 6 s | |
| Step4 | Annealing temperature | 15 s | |
| Step5 | 72 °C | 7 s | |
| Step 3-5, 25 cycles | |||
| Step6 | 72 °C | 5 mins | |
| Step7 | 12 °C | hold |
Annealing temperatures:
| Temperature | Primers | |
| 61 °C | LARGE1-blk1, LARGE1-blk4, LARGE1-blk6, LARGE1-blk7 | |
| 64 °C | FKRP-blk1, LARGE1-blk5, LARGE1-blk9, LARGE1-blk10 | |
| 66 °C | LARGE1-blk2, LARGE1-blk3, LARGE1-blk8 | |
| 68 °C | FKRP-blk6 | |
| 72 °C | FKRP-blk2, FKRP-blk3, FKRP-blk4, FKRP-blk5 |
Perform PCR purification with NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 . Elute with 40 µL nuclease-free water.
Perform adaptor addition.
Mix purified PCR2 products (200 ng each) and dilute to 11 ng/µL . Perform the following reaction:
| Reagent | Catalog | Time | |
| Q5 Reaction Buffer | NEB, B9027SVIAL | 10 µL | |
| Q5 High GC Enhancer | NEB, B9028AVIAL | 10 µL | |
| 10 mM dNTPs | NEB, N0447 | 1 µL | |
| Q5 High-Fidelity DNA Polymerase | NEB, M0491SVIAL | 1 µL | |
| 10µM PCR3-F | 2.5 µL | ||
| 10µM PCR3-R | 2.5 µL | ||
| Mixed sample | 23 µL |
| Step | Temperature | Time | |
| Step1 | 98 °C | Hot start | |
| Step2 | 98 °C | 3 mins | |
| Step3 | 98 °C | 6 s | |
| Step4 | 72 °C | 15 s | |
| Step5 | 72 °C | 8 s | |
| Step 3-5, 25 cycles | |||
| Step6 | 72 °C | 5 mins | |
| Step7 | 12 °C | Infinite |
Set 3 * 50 µL reactions.
Perform NucleoSpin Gel and PCR Clean-Up KitTakara Bio Inc.Catalog #740609 and elute with 50 µL nuclease free water.
Send PCR3 product for next generation sequencing and use GENEWIZ Amplicon-EZ service to check quality and coverage. Sequence using Hiseq X service.
Immunofluorescence
Place Nunc™ Thermanox™ Coverslips, 15mm diameterThermo FisherCatalog #174969 in a 24-well plate.
Coat coverslips in 0.1% GelatinMerck MilliporeSigma (Sigma-Aldrich)Catalog #G9391 and immediately remove. Air-dry.
Plate MB135 cells
Resuspend 250k MB135 cells in .5 mL growth medium (Ham's F-10 Nutrient MixThermo FisherCatalog #11550043 with 20% Fetal Bovine SerumR&D SystemsCatalog #S11150 , 1x Antibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062 , 51 ng/mL DexamethasoneMerck MilliporeSigma (Sigma-Aldrich)Catalog #D2915 , and 10 ng/mL Basic Fibroblast Growth FactorMerck Millipore (EMD Millipore)Catalog #GF003AF-MG )
Seed cells into each well.
One day later, change out the medium for Skeletal Muscle Differentiation MediumPromoCellCatalog #C-23061 with 1x Antibiotic-Antimycotic (100X)Thermo Fisher ScientificCatalog #15240062 .
Differentiate cells for 3-7 days until myotubes are formed.
Fix cells.
Wash cells with 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 .
Fix with 4% ParaformaldehydeMerck MilliporeSigma (Sigma-Aldrich)Catalog #158127 for 00:10:00 at Room temperature .
10m
Block cells with 2 % (w/v) Bovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at Room temperature for 01:00:00
1h
Incubate with 1:200 IIH6C4 AntibodyMerck MilliporeSigma (Sigma-Aldrich)Catalog #05-593 in 2 % (w/v) Bovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at 4 °C for 20:00:00 .
20h
Wash cells in 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 and incubate in 1:100 Rabbit anti-Mouse IgM FITC Secondary AntibodyInvitrogenCatalog #31557 in 2 % (w/v) Bovine Serum AlbuminMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9647 in 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 at Room temperature for 02:00:00 . Keep cells in the dark.
2h
Drop Antifade Mounting Medium with DAPIVector LaboratoriesCatalog #H1500 onto Microscope SlidesFisher ScientificCatalog #22-037-246
Wash coverslips with 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 . Place facedown on slides over drops of DAPI and keep at Room temperature in the dark for 00:30:00 .
30m
Image on a Revolve ECHO microscope
(DAPI - EX:380/30 EM:450/50 DM:425)
(FITC - EX:470/40 EM:525/50 DM:495)
Packaging and infection of rVSV/ppVSV
12h
Transfect HEK293T cells with LASV-GPC plasmid
Transduce cells with ppVSVΔG-VSV-G viral particles. Resulting particles will be referred to as ppVSV-LASV-GPC-Generation1.
Seed HEK293T cells in a well of a 6-well plate. Incubate @ 37 °C Overnight .
Once cells reach 70-90% confluency, transfect cells using 4 µg LASV-GPC plasmid and Lipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001 per manufacturer's instructions. Incubate @ 37 °C 24:00:00 .
1d
Add ppVSVΔG-VSV-G (MOI=0.5). Calculate viral dose given estimated cell number of ~2 M.
01:00:00 later, remove medium, wash with 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 , and add fresh medium to the well.
1h
The next day, collect the newly generated viral particles (referred to as ppVSV-LASV-GPC-Generation1). Perform titration to determine viral titer.
Infect LASV-GPC transfected HEK293T cells with ppVSV-LASV-GPC-Generation1 to produce ppVSV-LASV-GPC-Generation2. This reduces residual VSV-G in pseudotyped particles. ppVSV-LASV-GPC-Generation2 used moving forward.
Seed 6M HEK293T cells in a 10-cm dish. Incubate @ 37 °C Overnight .
Transfect cells using 30 µg LASV-GPC plasmid and Lipofectamine 3000Invitrogen - Thermo FisherCatalog #L3000001 per manufacturer's instructions. Incubate @ 37 °C 24:00:00 .
1d
Add ppVSV-LASV-GPC-Generation1 (MOI=0.1) to the well. Determine viral dose using estimated cell number of ~12M.
01:00:00 later, remove medium, wash with 1x DPBSGibco - Thermo Fisher ScientificCatalog #14190144 , and add fresh medium to the well.
1h
The next day, collect the newly generated viral particles (referred to as ppVSV-LASV-GPC-Generation1). Perform titration to determine viral titer.
Determine 50% tissue culture infectious dose using Spearman-Karber method.
Determine MOI of ppVSV (performed at MOI 1-3)
Perform transduction and blasticidin drug selection as in FACS assay
Divide cells into 2 ~1M groups. Infect one group with rVSV at a concentration of 2e5 TCID50/mL (MOI ~0.5). Add 5 millimolar (mM) final concentration Ammonium chloride ( ≥ 99.5 %)Merck MilliporeSigma (Sigma-Aldrich)Catalog #A9434 during infection and recovery.
60:00:00 later, refresh medium. Allow cells to recover for 12:00:00 (cell count ~1M).
3d
Harvest cells