May 07, 2023

SARS-CoV-2 Spike Gene N terminal Domain targeted Sequencing 

  • 1Department of Biotechnology, College of Science, University of Baghdad
Icon indicating open access to content
QR code linking to this content
Protocol CitationNoor Saber Jawad, Nuha Joseph Kandala 2023. SARS-CoV-2 Spike Gene N terminal Domain targeted Sequencing . protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9d63zg3e/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 05, 2023
Last Modified: May 07, 2023
Protocol  Integer ID: 81494
Keywords: sar, variant surveillance, gene, sequencing
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

Abstract
We use a simple and effective method for generating 757bp of the N terminal domain of thetheSARS-CoV-2 Spike gene for variant surveillance,
RNA Extraction
The Automated extraction was handled using the ExiPrep™ 96 Lite (A-5250, BIONEER) with the ExiPrep™ Viral DNA/RNA extraction kit (K-4614, BIONEER).
RT-PCR Amplification
TaqPath™ COVID‑19 CE‑IVD RT‑PCR Kit (Multiplex real-time RT-PCR test intended for qualitatively detecting nucleic acid from SARS‑CoV‑2) used for viral detection. follow the user manual recommendation as listed in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0019215_TaqPathCOVID-19_CE-IVD_RT-PCR%20Kit_IFU.pdf
Results can be distinguished to:
1- samples with three positive targets for (ORF1ab, N, and S genes)
2- sample with two positive targets for (ORF1ab and N genes), negative for theS gene. Failure of Spike gene amplification is referred to as S gene target failure (SGTF) or S gene signal dropdown.
3- SGTF resulted due to 69/70 codons deletion of Valine and Histidine, respectively.
C-CDNA Synthesis and Quality checking
Promega GoScript™ Reverse Transcription Mix with Random Primers system (A2800) is used to generate complementary DNA. following the same kit-recommended procedure.
Quality checking is considered for all steps using the Fluorometer Quantus using Quantifluor dye
Primers
the forward primer is: SubA_21587F: CCACTAGTCTCTAGTCAGTGTGTT

Reverse primer: SubA_22344R: CCAGCTGTCCAACCTGAAGA

these primers generate an amplicon of 757bp.
Primer's preparation:
These primers were supplied by Macrogen Company in a lyophilized form. Lyophilized primers were dissolved in nuclease-free water to give a final concentration of 100pmol/μl as a stock solution. A working solution of these primers was prepared by adding 10μl of primer stock solution (stored at freezer -20 C) to 90μl of nuclease-free water to obtain a working primer solution of 10pmol/μl.
Reagent preparation for Amplicon synthesis
Amplification reaction carried on using the flowing calculations:

1- 10 ul of GoTag Green Master Mix, Promega (M7122).
2- 1 ul of Forward primer
3- 1ul of Reverse primer
4- 6 ul of nuclease-free water
5- 2ul of cDNA template.

PCR adopted program and
The following program was considered for amplification:


Gel visualization
We use the classic gel visualization method through gel electrophoresis (100-1500 bp ladder gel marker) and gel documentation.
Sequencing
We referred our amplicons to a sequencing company (Macrogen, South Korea).