Sep 04, 2020

Public workspaceSARS-CoV-2 detection with ApharSeq V.3

DOI
dx.doi.org/10.17504/protocols.io.bkdcks2w
  • 1Silberman Institute of Life Science, Hebrew University of Jerusalem, Jerusalem 9190401, Israel;
  • 2Rachel and Selim Benin School of Computer Science, Hebrew University of Jerusalem, Jerusalem 9190401, Israel;
  • 3Edmond and Lily Safra Center for Brain Sciences, Hebrew University of Jerusalem, Jerusalem 9190401, Israel;
  • 4The Lautenberg Centre for Immunology and Cancer Research, IMRIC, Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem 9112001, Israel;
  • 5Hadassah - Hebrew University Medical Centre, Jerusalem 9112001, Israel;
  • 6Department of Developmental Biology and Cancer Research, IMRIC, Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem 9112001, Israel
  • Coronavirus Method Development Community
  • XPRIZE Rapid Covid Testing
Alon Chappleboim
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.bkdcks2w
Protocol Citation: Daphna Strauss, Ayelet Rahat, Israa Sharkia, Alon Chappleboim, Miriam Adam, Daniel Kitsberg, Gavriel Fialkoff, Matan Lotem, Omer Gershon, Anna-Kristina Schmidtner, Esther Oiknine-Djian, Agnes Klochendler, Ronen Sadeh, Yuval Dor, Dana Wolf, Naomi Habib, Nir Friedman 2020. SARS-CoV-2 detection with ApharSeq. protocols.io https://dx.doi.org/10.17504/protocols.io.bkdcks2w
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 27, 2020
Last Modified: September 04, 2020
Protocol Integer ID: 41092
Keywords: SARS-CoV-2, covid19, RNA, Aphar-Seq, NGS, ApharSeq, test, diagnostics, virus
Abstract
The global SARS-CoV-2 pandemic led to a steep increase in the need for viral detection tests worldwide. Most current tests for SARS-CoV-2 are based on RNA extraction followed by quantitative reverse-transcription PCR assays that involve a separate RNA extraction and qPCR reaction for each sample with a fixed cost and reaction time. While automation and improved logistics can increase the capacity of these tests, they cannot exceed this lower bound dictated by one extraction and reaction per sample. Multiplexed next generation sequencing (NGS) assays provide a dramatic increase in throughput, and hold the promise of richer information on viral strains and host immune response.
Here, we establish a significant improvement of existing RNA-seq detection protocols. Our workflow, ApharSeq (Amplicon Pooling by Hybridization And RNA-Seq), includes a fast and cheap RNA capture step, that is coupled to barcoding of individual samples, followed by sample-pooling prior to the reverse transcription, PCR and massively parallel sequencing. Thus, only one step is performed before pooling hundreds of barcoded samples for subsequent steps and further analysis. Considering these improvements, our proposed workflow is estimated to reduce costs by 10-50 fold, labor by 5-100 fold, automated liquid handling by 5-10 fold, and reagent requirements by 100-1000 fold compared to existing methods.
Attachments
Icon for ApharSeq_oligos.xlsx
ApharSeq_oligos.xlsx
26KB
Guidelines
This protocol was tested on samples derived by a swab into a standard Viral Transport Medium collection tube, and then mixed 1:1 with Zymo RNA/DNA shield for lysis.

The first part of this protocol, before samples are pooled, can be performed manually or roboticaly and was tested on an a Tecan / Evoware platform.


Materials
MATERIALS
ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880
ReagentKapa HiFi Hotstart ReadyMix (2x)Kapa BiosystemsCatalog #KK2612
ReagentWater, nuclease free
Reagent1M Tris pH 7.5 Sigma
ReagentSera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic), 15 mLGe HealthcareCatalog #65152105050250
Reagent20% Sodium dodecyl sulfate (SDS)
ReagentHigh Sensitivity D1000 ScreenTapeAgilent TechnologiesCatalog #5067-5584
Reagent1M Tris-HCl (pH 8.0)Thermo Fisher ScientificCatalog #15568025
ReagentEthanol
ReagentQubit 1X dsDNA High Sensitivity Assay KitThermo Fisher ScientificCatalog #Q33230
ReagentEthylenediaminetetraacetic acid (EDTA)Sigma AldrichCatalog #EDS
ReagentLithium dodecyl sulfateSigma AldrichCatalog #L4632
Reagent1M DL-Dithiothreitol solution (DTT)Sigma AldrichCatalog #646563
ReagentMagnesium chloride solutionSigma AldrichCatalog #M8787-5ML
ReagentDimethyl sulfoxideSigma AldrichCatalog #D4540
ReagentSMARTScribe™ Reverse TranscriptaseTakaraCatalog #639538
ReagentProteinase KLucigenCatalog #MPRK092
Beads conjugation
Materials for this step are listed in manufacturer conjugation protocol

Binding buffer
100 mM Tris-HCl, pH 7.5
500 mM LiCl
10 mM EDTA, pH 8.0
5 mM DTT

Wash buffer A
10 mM Tris-HCl, pH 7.5
150 mM LiCl
1 mM EDTA, pH 8.0
0.1 % SDS

Wash buffer B
10 mM Tris-HCl, pH 7.5
150 mM LiCl

Proteinase K (PK) buffer
10mM Tris pH8
5mM EDTA
1% SDS
RT reaction mix - make fresh before RT reaction
1x SmartScribe buffer
1.2 mM dNTPs
2 mM DTT
6 mM MgCl2
5% DMSO
100 U SmartScribe enzyme per reaction


Primers
As an example, for the N1 amplicon the following primers were used (barcodes in bold):
RT -
GCGTCAGATGTGTATAAGAGACAGNNNNCTGACNNNNCGGCANNTCTGGTTACTGCCAGTTGAATCTG
PCR F -
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
PCR R -
CAAGCAGAAGACGGCATACGAGATTGATACGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACCCCAAAATCAGCGAAA

See complete primer list in attached file, and review "methods" section in accompanying paper for more details.
Safety warnings
A risk assessment should be made when working with potenetially infectious specimen. Be sure that samples were properly handled and deactivated by certified personnal. Consult your local bio-safety staff.
Before start
  • Take out beads and buffers and bring to room temp
  • Pre-warm 72C heating block
  • Prepare fresh 70% EtOH
  • Prepare poly dT beads: Use commercial polyT beads (ThermoFisher dynabeads cat# 61002), or prepare oligo dT beads by conjugating an amine-C12 5' modified 25 dT oligonucleotide to carboxylate coated beads (GE healthcare Sera-Mag SpeedBeads cat# 65152105050250), and follow the manufacturer conjugation protocol
  • Clinical samples are assumed to have been collected in viral transport media and inactivated by 1:1 mix with lysis buffer
  • Before using RT primers for the first time we recommend testing them for cross-contamination and performance variation. We do so by pooling (e.g.) every other column to two pools and prepararing libraries using these oligo pools. If a barcode appears in a pool where it was not used there is contamination that should be accounted for. In case of significnat variance or contmaination between primers either discard the extreme primers, or consider pooling several primers together (e.g. every sample will have 3 barcodes) to reduce sample-to-sample variability.
Apharseq
Apharseq
14h
14h
Prepare poly dT beads
  1. Use 5 µl poly dT beads/sample
  2. Wash beads twice in binding buffer:
2.1 Resuspend in binding buffer
2.2 Magnetize and remove buffer
3. Resuspend beads in 320 µl binding buffer
Hybridization to beads
  1. Add 320 µl inactivated viral sample to 320 µl beads in binding buffer
  2. Incubate Duration00:10:00 at TemperatureRoom temperature while mixing
  3. Magnetize and remove supernatant
1m
Primer annealing
1. Resuspend beads in 50 µl 1:1 mix of binding buffer and 10 µM RT primer(s)
2. Heat sample to Temperature72 °C for Duration00:02:00 then incubate TemperatureOn ice for at least Duration00:02:00
2. Incubate samples Duration00:10:00 at TemperatureRoom temperature . Mix by rotating or by pipetting every 5 minutes
3. Magnetize beads and discard supernatant
15m
Wash and Pool
1. Resuspend beads in 450 µl wash buffer A
2. Magnetize and remove 380 µl
2. Resuspend beads in remaining 70µl and pool samples.
3. Wash beads twice in wash buffer B:
2.1 Resuspend in 500 µl buffer B
2.2 Magnetize and carfully remove buffer
Note
Pool can be stored in RNA later at Temperature4 °C for a week. If stored, prior to step 5, wash twice in Wash buffer B

15m
Proteinase K (PK) treatment
  1. Wash with 500 µl PK buffer
  2. Resuspend in 500 µl PK mix (0.4mg/ml PK in PK bufer)
  3. Incubate Duration01:00:00 at TemperatureRoom temperature while rotating.
  4. Magnetize and wash three times in 1ml wash buffer A
  5. Magnetize and wash twice in 1ml wash buffer B
Note
This step may need calibration to shorten incubation time at RT or 37C

1h 15m
Reverse Transcription
  1. Magnetize PCR tube and wash pooled beads in 1x RT buffer:
1.1 Resuspend in 50 µl 1xRT buffer
1.2 Magnetize and remove buffer
2. Resuspend in 50 µl RT reaction mix
3. Incubate
Duration00:15:00 Temperature25 °C
Duration00:45:00 Temperature42 °C
Duration00:15:00 Temperature70 °C
Note
We also found a standard RT-PCR kit to work on the beads (PrimeScript™ One Step RT-PCR). Importantly we execute the RT part of the reaction, and only then add the PCR primers.

1h 30m
cDNA elution
1. Incubate the beads for Duration00:02:00 at Temperature98 °C
2. Magnetize and transfer the supenatant immediately to a new tube
3m
Cleanup by 2x SPRI
1. Add 100 µl SPRI beads and mix well
2. Incubate Duration00:04:00
3. Magnetize: keep on magnet for Duration00:04:00 and remove supernatant
4. Keep on magnet and wash twice with 70% ethanol
4.1 Add 100 µl 70% ethanol
4.2 Incubate Duration00:00:30
4.3 Remove the ethanol without disturbing the beads
5. Air dry to remove traces of ethanol Duration00:04:00
6. Resuspend in 23 µl 10 mM Tris 8.0
7. Incubate Duration00:02:00
8. Magnetzie and transfer 21 µl to new tube
20m
Library PCR
1. Add to each sample pool
  • 25 µl Kapa RM
  • 2 µl 10 µM PCR-primer F
  • 2 µl 10 µM PCR-primer R
2. PCR program:
  • 98°C 3 minutes
  • 30 x {95°C 20sec, 59°C 15sec, 72°C 50sec};
  • 72°C 10 min
  • 10°C
1h 30m
Cleanup by 1x SPRI (see step 8)
Elute in 15 µl 10 mM Tris 8.0
Library assessment
1. Determine library concentration (e.g. by Qubit) and size (by tape/gel)
2. If necessary, clean primer dimers by running on gel or by 1x SPRI
Sequence
On an Illumina machine.
Assign 5 million reads per 100 sample pool.
Assign at least 20 cycles to R1 (barcode + UMI) and either additional 30 cycles to R1 or 30 cycles to R2
Data Analasys Outline
1. Demultiplex pool indices with the bcl2fastq script (Illumina)
2. Process each fastq file independently
2.1 Split reads based on RT primer target (E/N1/ActB) and barcode (R1:4-8 + R1:13-17, inclusive)
2.2 Filter reads that do not exhibit their expected sequence
i.e. read with E primer should have the E sequence immediately after the primer
2.2 Collect UMI sequence per read (R1:1-4 + R1:9-12 + R1:18-19)
2.3 Cluster UMI sequences (e.g. by hamming distance and/or with UMI-tools)
2.4 Report unique molecules per target/sample