Apr 03, 2025

Public workspaceSanta Cruz Reaction (SCR): Adapter-Splint Hybridization

DOI
https://dx.doi.org/10.17504/protocols.io.kqdg3ke71v25/v1
  • Alba Rey-Iglesia1,
  • Vanssy Li2,
  • Deon de Jager1,
  • Eline Lorenzen1
  • 1University of Copenhagen;
  • 2Copenhagen university
  • Lorenzen Lab
Vanssy Li
Icon indicating open access to content
QR code linking to this content
DOI: https://dx.doi.org/10.17504/protocols.io.kqdg3ke71v25/v1
Protocol Citation: Alba Rey-Iglesia, Vanssy Li, Deon de Jager, Eline Lorenzen 2025. Santa Cruz Reaction (SCR): Adapter-Splint Hybridization. protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg3ke71v25/v1
Manuscript citation:

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 20, 2025
Last Modified: April 03, 2025
Protocol Integer ID: 124720
Keywords: ancient DNA, Santa Cruz Reaction, Library Build, splint complexes for santa cruz reaction library construction, splint complexes for scr library, splint hybridization this protocol, stranded genomic library preparation method, splint hybridization, splint complex, genomic library preparation method, hybridization of p5, scr library, santa cruz reaction library construction, ancient dna, p7 adapter, scr, dna, hybridization
Abstract
This protocol describes the preparation and hybridization of P5 and P7 adapter-splint complexes for Santa Cruz Reaction library construction. Following this protocol produces 12µM hybridized P5 and P7 adapter-splint complexes for SCR library build.

This protocol is based on: Kapp, J. D., Green, R. E., & Shapiro, B. (2021). A Fast and Efficient Single-stranded Genomic Library Preparation Method Optimized for Ancient DNA. Journal of Heredity, 112(3), 241-249. https://doi.org/10.1093/jhered/esab012

Always cite the original paper (Kapp et al. 2021) when using this protocol, in addition to citing this protocols.io protocol.
Protocol materials
Reagent1M Tris-HCl, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
Reagent UltraPure™ 0.5M EDTA pH 8.0Thermo Fisher ScientificCatalog #15575020
ReagentT4 RNA Ligase Reaction Buffer - 3.0 mlNew England BiolabsCatalog #B0216L
Troubleshooting
Before start
  • UV-treat aliquots (ddH2O, etc.) for 10 minutes before use.
  • Well mix all the reagents before use.
  • Do not UV Eppendorf Tubes/PCR tubes
  • Clean all surfaces with 5% bleach solution followed by 70% ethanol before and after use.
  • Clean all equipment with 70% ethanol before and after use.
Buffer Preparation & Oligonucleotide Resuspension
Prepare TE buffer in which to resuspend adapters
  • Store TE buffer at room temperature
Reagents:
Reagent1M Tris-HCl, pH 8.0Invitrogen - Thermo FisherCatalog #15568025
Reagent UltraPure™ 0.5M EDTA pH 8.0Thermo Fisher ScientificCatalog #15575020

Table 1 TE buffer preparation
ComponentFinal conc. (mM)Volume (uL)
0.5M EDTA, pH 8.018
1M Tris-HCl, pH 8.01040
H₂O-3,952
Total-4,000
Note:
  • Final TE buffer volume depends on required amount per oligo for 100mM (rounded to 4ml for 4 tubes).
Oligo Sequences & Resuspension
  • Note: All oligonucleotides are ordered with HPLC purification conducted by IDT.
  • Note: It is recommended by Kapp et al. (2021) to order two separate batches of each splint oligonucleotide. See oligonucleotide quality control recommendations in section 11 of Kapp et al. (2021) Supplementary Material.
  • The oligonucleotides are usually delivered as a dry film in a 2 mL tube.
Resuspend all oligos to 100µM using TE buffer. Make sure all the oligos are well mixed by vortexing and mixing by pipetting. Use Table 2 as a template.

Note
  • Before resuspending the oligos, centrifuge the tubes for 30s at maximum speed. This ensures the dry film of oligos is at the bottom of the tube, as sometimes these can come loose and might fall out of the tube when you open it.
  • The volume TE buffer used for resuspension depends on the molar or ng amount of oligo in the tube - this information is usually provided on the tube itself or the accompanying paperwork.

  • Table 2 Oligonucleotides sequences (IDT Format, 5’ → 3’) and the volume of TE required to reach a final concentration of 100 µM.
OligoSequenceSize (bp)Oligo amountTE vol (µL) for 100µM final conc.
P5 adapter/5AmMC12/ACACTCTTTCCCTACACGACGCTCTTCCGATCT33
P5 splint/5AmMC6/NNNNNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/3AmMO/40
P7 adapter/5Phos/AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3AmMO/34
P7 splint/5AmMC12/GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNN/3AmMO/41

Adapter-Splint Hybridization Recipe
P5 Adapter-Splint Hybridization: 12µM (50µL)
Reagent: 10X ReagentT4 RNA Ligase Reaction Buffer - 3.0 mlNew England BiolabsCatalog #B0216L
Table 3 P5 adapter-splint recipe.
ReagentVolume (µL)
H₂O30.6
10X T4 RNA ligase buffer5
100µM P5 adapter6
100µM P5 splint8.4
Total50

P7 Adapter-Splint Hybridization: 12µM (50µL)
Reagent: 10XReagentT4 RNA Ligase Reaction Buffer - 3.0 mlNew England BiolabsCatalog #B0216L
Table 4 P7 adapter-splint recipe.
ReagentVolume (µL)
H₂O30.6
10X T4 RNA ligase buffer5
100µM P7 adapter6
100µM P7 splint8.4
Total50

Adapter-Splint Hybridization Reaction
Add components from the Adapter Hybridization Recipe to separate 0.2mL PCR tubes (one for P5, one for P7). Ensure proper mixing by pipetting or flicking the tube and spinning down in a minicentrifuge.
Perform hybridization in a thermocycler with heated lid (Temperature105 °C ):
Adapter-splint hybridization reaction conditions.
TemperatureTime
95°C1 minute
Ramp down to 10°C0.1°C per second
10°CHold indefinitely

Store hybridized P5 (12 µM) and P7 (12 µM) adapter stock solutions at -20 °C.
Protocol references
Kapp, J. D., Green, R. E., & Shapiro, B. (2021). A Fast and Efficient Single-stranded Genomic Library Preparation Method Optimized for Ancient DNA. Journal of Heredity, 112(3), 241-249. https://doi.org/10.1093/jhered/esab012