Sep 05, 2023

Sanger sequencing of SARS-CoV-2 Spike protein V.3

Peer-reviewed method
  • Tiago S. Salles*1,
  • Andrea Cony Cavalcanti*2,
  • Fabio Burack da Costa1,
  • Renata Campos Azevedo1
  • 1Laboratório de Interação Vírus-Célula, Departamento de Virologia, Inst. de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil;
  • 2Laboratório Central de Saúde Pública Noel Nutels - LACEN-RJ, Rio de Janeiro, Brazil
  • Low-cost, high-quality ...
  • Spotlight series
Icon indicating open access to content
QR code linking to this content
Protocol CitationTiago S. Salles*, Andrea Cony Cavalcanti*, Fabio Burack da Costa, Renata Campos Azevedo 2023. Sanger sequencing of SARS-CoV-2 Spike protein. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvoyzkbg4o/v3Version created by fabio_burack
Manuscript citation:
Salles TS, Cavalcanti AC, da Costa FB, Dias VZ, de Souza LM, et al. (2022) Genomic surveillance of SARS-CoV-2 Spike gene by sanger sequencing. PLOS ONE 17(1): e0262170. https://doi.org/10.1371/journal.pone.0262170
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 05, 2023
Last Modified: September 05, 2023
Protocol  Integer ID: 87401
Keywords: Sanger sequencing, SARS-CoV-2, Spike protein, sanger sequencing of sar, sequencing methodology, urgent surveillance of sar, sanger sequencing, sar, spike protein, protocol for complete nucleotide, pandemic, vaccine immunity
Abstract
The SARS-CoV-2 responsible for the ongoing COVID pandemic reveals particular evolutionary dynamics and an extensive polymorphism, mainly in Spike protein. Monitoring the S protein mutations is crucial for successful controlling measures and detect variants that can evade vaccine immunity. Even after the costs reduction imposed by the pandemic, the new generation sequencing methodologies remain unavailable to many scientific groups. Therefore, to support the urgent surveillance of SARS-CoV-2 S protein, this work describes a protocol for complete nucleotide sequencing of the S protein using the Sanger technique. Thus, any laboratory with experience in sequencing can adopt this protocol.

(The last step in this version contains a supplemental video with extra context and tips, as part of the protocols.io Spotlight series, featuring conversations with protocol authors.)
Guidelines
This protocol works well with recent extracted RNA samples, ideally with ct values lower than 20.
Materials
  • Thermal cycler
  • PCR tubes 0.2mL
  • Filter pipette tips: 1-10µL+ 10-100µL
  • Micropipettes: 1-10µL+ 10-100µL
  • Superscript III one-step RT-PCR kit (Invitrogen, Carlsbad, CA, USA)
  • Primers
  • Nuclease free water
  • Extracted RNA from SARS-CoV-2 positive samples with low ct values
  • Agarose
  • TAE buffer (Tris-acetate-EDTA)
  • LGC biotecnologia - Blue Green loading Dye I
  • Horizontal Electrophoresis cube
  • UV Transilluminator
  • Nanodrop spectrophotometer
RT-PCR

  • Program the thermal cycler before setting up the reaction. The thermal cycler should be preheated to 45–60°C.
  • Keep all components, reaction mixes, and samples on ice. After preparation of the samples, transfer them to the preheated thermal cycler and immediately start the RT–PCR program.
  • Reaction mix should be prepared according to table 1.
ABC
ComponentVolumeFinal concentration
2X Reaction Mix12.5 μL1x
Sense primer (10 μM) 1.75 μL0.7 μM
Anti-sense primer (10 μM)1.75 μL0.7 μM
SuperScript™ III RT/Platinum™ Taq High Fidelity Enzyme Mix[1] 0.5 μL
Template RNA5 μL
Nuclease free waterto 25 μL
Table 1 - RT-PCR master mix

  • RT-PCR cycle is described below:


60°C 1 min |
50°C 45 min | Reverse Transcription | 1 cycle
94°C 2 min |

95 °C 15 s Denaturation |
53 °C 30 s Annealing | 40 cycles
68 °C 60 s Extension |

68 °C 7 min Final extention | 1 cycle
4 °C ∞


  • Primers used: Position Melting temperature Size

P1 forward GTTTGTTTTTCTTGTTTTATT (21551-21574) 43.5 ºC 923bp
P1 reverse ACAGTGAAGGATTTCAACGTACAC (22450-22474) 55.3 ºC
P2 forward CGTGATCTCCCTCAGGGTTTT (22190-22211) 56.8 ºC 620bp
P2 reverse TCAGCAATCTTTCCAGTTTGCC (22810-22832) 56.1 ºC

P3 forward GTAATTAGAGGTGATGAAGTCAGA (22751-22775) 51.8 ºC 892bp
P3 reverse ACATAGTGTAGGCAATGATGGA (23621-23643) 53.6 ºC

P4 forward CTTGGCGTGTTTATTCTACAG (23445-23466) 51.4 ºC 979bp
P4 reverse GCTTGTGCATTTTGGTTGACC (24403-24424) 55.6 ºC

P5 forward AGACTCACTTTCTTCCACAGCA (24355-24377) 56.1 ºC 342bp
P5 reverse AGATGATAGCCCTTTCCACA (24699-24719) 53.3 ºC

P6 forward TTCTGCTAATCTTGCTGCTACT (24610-24632) 54.0 ºC 766bp
P6 reverse GTTTATGTGTAATGTAATTTGACTCC (25348-25372) 50.7 ºC
P7 forward TAGAGAAAACAACAGAGTT (21492-21511) 45.6 ºC 712bp
P7 reverse TGAGGGAGATCACGCACTAA (22184-22204) 55.4 ºC

P8 forward TTCTGCTAATCTTGCTGCTACT (24610-24632) 54.0 ºC 825bp
P8 reverse CCTTGCTTCAAAGTTACAGTTCCA (25409-25433) 55.6 ºC



Agarose gel Electrophoresis

  • Dissolve agarose in 1.X TAE Buffer (40 mM Tris-acetate, 1 mM EDTA) to a final concentration of 1.5% agarose.
  • Heat the solution in a microwave and let it cool at room temperature.
  • Apply the agarose gel to the casting tray with the appropriate well comb and let it solidify.
  • Mix 5 µL of PCR product with 5µL of loading buffer and 1µL Blue Green Loading dye I (LGC Biotecnologia), apply it to the gel, and run the electrophoresis at 120V.
  • Visualize the gel with UV Transilluminator
Preparing Samples for sequencing

  • Sequencing procedures are performed according to BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) guidelines.
  • Measure DNA Concentration with a nanodrop spectrophotometer
  • Dilute template to 100 ng/µl with nuclease-free water
  • Dilute primers to 1 µM with nuclease-free water. Only one primer is used for each sequencing reaction, leading to two reactions per sample. Each reaction will need 3.2 µl of diluted primer.
  • Label and ship the samples and primers according to the sequencing service provider guidelines.

sequencing reaction:
  • BigDye™ Terminator 3.1 Ready Reaction Mix - 8 µL
  • primer (1 µM) - 3.2 µL
  • Template (200ng) - 2 µL
  • Deionized water (RNase/DNase-free) to - 20 µL


sequencing cycle:

96°C 1 min Incubation | 1 cycle

96 °C 10 s Denaturation |
50 °C 05 s Annealing | 25 cycles
60 °C 4 min Extension |

4 °C ∞ | 1 cycle

Sequence analysis

  • Upon receiving the electropherograms, edit them with proper programs like chromas or Bioedit.
  • For better editing accuracy, align the forward sequence with the reverse complement of the reverse sequence.
  • Use BLAST search to confirm if the sequenced product corresponds to the desired target.
  • Create contigs by aligning the planned overlaps between each target fragment and form one consensus sequence covering the full ORF of SARS-CoV-2 Spike protein
  • Edited sequences can now be analyzed with the CoVsurver mutations app, provided by GISAID, to trace the mutation patterns of each sample and study their effects on protein structure.
  • Sequences can also be deposited in the GISAID database of SARS-CoV-2.
Spotlight video
(The following video contains extra context and tips, as part of the protocols.io Spotlight series, featuring conversations with protocol authors.)