Jan 20, 2026
Sanger sequencing of barcoded beads
- Koen Theunis1,2,3,4
- 1Laboratory of Computational Biology, VIB Center for AI & Computational Biology, Leuven, Belgium;
- 2VIB-KU Leuven Center for Brain & Disease Research, Leuven, Belgium;
- 3Department of Human Genetics, KU Leuven, Leuven, Belgium;
- 4Aligning Science Across Parkinson’s (ASAP) Collaborative Research Network, Chevy Chase, MD 20815, United States
- Aertslab
Protocol Citation: Koen Theunis 2026. Sanger sequencing of barcoded beads. protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl8xpzdv2w/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 20, 2026
Last Modified: January 20, 2026
Protocol Integer ID: 238928
Keywords: ASAPCRN, hydrogel bead barcode qc, barcoded hydrogel bead, barcoded bead, hydrogel bead, beads this protocol
Funders Acknowledgements:
Aligning Science Across Parkinson’s
Grant ID: ASAP-000430
Aligning Science Across Parkinson’s
Grant ID: ASAP-025179
Abstract
This protocol is used to test the purity of barcoded hydrogel beads like: https://www.protocols.io/view/hydrop-v2-bead-generation-amp-ligation-barcoding-8epv5n11dv1b/v2
Materials
Oligo's for HyDropATAC v2 Sanger QC
| PCR | Name | Sequence (5'>3') | Purification | |
| first | ATAC-QC oligo | GTCTCGTGGGCTCGGCTGTCTCTTATACACATCTGACGCTGCCGACGA | Standard desalted | |
| second | P7 indexing primer | CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXGTCTCGTGGGCTCGGAGATGTG | Standard desalted | |
| second | P5-Partial | AATGATACGGCGACCACCGA | Standard desalted |
Oligo's for HyDropATAC v1 Sanger QC
| PCR | Name | Sequence (5'>3') | Purification | |
| first | ATAC-QC oligo | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCCGAGCCCACGAGAC | Standard desalted | |
| second | P7 indexing primer | CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXGTGACTGGAGTTCAGACGTGTG | Standard desalted | |
| second | Dropseq-P5-oligo | AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C | Standard desalted |
Troubleshooting
Wash finalized barcoded beads
Take finalized barcoded beads from storage (−80 °C)
Add 5 µL beads to a 1.5mL microcentrifuge tube containing 500 µL of 0.04% BSA in PBS.
Spin 1 minute at 500 x g and remove supernatant but leave about 20 µL.
From this supernatant a negative control can be taken in order to investigate oligo bleeding from the beads.
Repeat these washes for a total of 3 washes
Pick individual beads
Prepare the lid of a petri dish (Falcon 351008) with plenty of 5 µL PBS/BSA drops as washing medium for picked beads later. Use 20-30 µL drops in the petri dish for washing and priming of the 75 μm capillaries (MXL3-STR and MXL3-75, CooperSurgical). Adjust the Stripper‱ pipette to 0.5 µL and prime with PBS/BSA.
Dilute beads by pipetting in 10-20 µL drops of PBS/BSA on a petri dish lid under a stereo microscope until individual beads are distinguishable from each other.
Now pick beads with Stripper‱ pipette and 75 μm capillaries (MXL3-STR and MXL3-75, CooperSurgical) and transfer them over three wash drops in order to verify that 1 bead was picked. The tip can be rinsed and primed from large drops of PBS/BSA in between the bead transfers.
Transfer a single bead to a PCR tube containing 1.5 µL PBS/BSA.
Wash the capillary 3 times in a large volume of PBS/BSA. Now additional beads can be picked.
A blank can be taken from an empty droplet that was used for washing.
At the end of the experiment, a few multi-droplet controls (n = 2, n = 5, n = 10) can be picked. Don't do this before picking single beads because beads can stay in the dead volume of the capillary.
First PCR amplification of the barcoded bead oligo
Add 18 µL PCR master mix 1 to the PCR tubes containing beads and/or blanks.
Final concentrations: 1x KAPA HiFi hot start ready mix (Roche Cat. No. KK2602), 30mM DTT, 1 μM ATAC-QC oligo.
| A | B | C | |
| 72 °C | 3 m | ||
| 98 °C | 30 s | ||
| 98 °C | 10 s | | | |
| 59 °C | 30 s | | 22 cycles | |
| 72 °C | 30 s | | | |
| 4-15 °C | hold |
Perform the purification according to the manufacturers recommendation with 1.5X of Ampure beads (add 30 µL). Elute in 10 µL EB buffer and transfer 8 µL to the next PCR reaction.
Second PCR reaction
Add 12 µL PCR master mix 2 to 8 µL sample.
Final concentrations: 1X KAPA HiFi hot start ready mix, 1 μM P7 indexing primer, 1 μM P5-Partial primer.
| A | B | C | |
| 95 °C | 3 m | ||
| 98 °C | 20 s | | | |
| 67 °C | 30 s | | 22 cycles | |
| 72 °C | 20 s | | | |
| 72 °C | 1 m | ||
| 4-15 °C | hold |
Perform the purification according to the manufacturers recommendation with 1.5X of Ampure beads (add 30 µL). Elute beads in 17 µL EB buffer and transfer 15 µL to a fresh tube.
Sanger sequencing
Send for Sanger sequencing (eg LGC Genomics) using a P7 primer (for HyDropV2) or P5 primer (for HyDropV1).
Expected result