Sep 21, 2022

Sample preparation for single molecule localisation microscopy and imaging.

  • 1UCL Institute of Neurology
Icon indicating open access to content
QR code linking to this content
Protocol Citationgurvir.virdi 2022. Sample preparation for single molecule localisation microscopy and imaging.. protocols.io https://dx.doi.org/10.17504/protocols.io.3byl4j77olo5/v1
License: This is an open access  protocol  distributed under the terms of the  Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 21, 2022
Last Modified: June 01, 2024
Protocol  Integer ID: 70341
Keywords: ASAPCRN, sample preparation for single molecule localisation microscopy, single molecule localisation microscopy, midbrain dopaminergic neuron, microscopy, microscopy with the image acquisition detail, dopaminergic neuron, smlm on midbrain, dna aptamer, neuron, imaging, midbrain, using phalloidin, dna, sample preparation, smlm, image acquisition detail
Abstract
This protocol describes the sample preparation to perform SMLM on midbrain dopaminergic neurons using phalloidin and a DNA aptamer in a combination of STORM and DNA-PAINT.
It also describes the experimental set up on the microscopy with the image acquisition details.
Fixation
22m
For single molecule localisation microscopy (SMLM), neurons were grown on glass coated ibidi chambers.
Once neurons reached the desired age, they were washed once in PBS
They are then fixed for 00:15:00 in 4% paraformaldehyde + 0.1% glutaraldehyde (both from Electron Microscopy Services) in PBS at room temperature.

15m
The neurons were then reduced in 0.1% sodium borohydride (Sigma) in PBS for 00:07:00 at room temperature.

7m
Labelling cells
3h 20m
To label cells with the DNA-aptamer and phalloidin, after fixation and PBS washes, cells were permeabilised with 0.25% triton X-100 in PBS for 00:10:00 at room temperature

10m
The cells were then blocked in blocking solution (0.1% triton X-100, 10% normal goat serum (Abcam), 10% salmon sperm DNA (Thermo Fisher Scientific)) in PBS for 02:00:00 at room temperature

2h
The samples were then incubated with 100 nM of the DNA-aptamer made up in the blocking solution at 4 °C overnight.
Note
Aptamer binds to beta-sheet rich structures including protein aggregates. The sequence of the aptamer is: GCCTGTGGTGTTGGGGCGGGTGCGTTATACATCTA (ATD Bio).


After incubation, cells were washed 1x in PBS
They are then incubated with phalloidin-647 (1:400) (Thermo Fisher Scientific) made up in the blocking solution for 01:00:00 at room temperature.

1h
Cells were then washed 1x in PBS and either imaged, or incubated with DAPI (1:10000) in PBS for 00:10:00 at room temperature followed by 2x PBS washes before imaging.

10m
Labelling aggregates in cell lysate
1h 15m
Cells were lysed mechanically in PBS before being centrifuged at 3600 x g, 4°C, 00:05:00 .

5m
The supernatant was collected and the protein concentration was quantified using the BCA Protein Assay Kit (Thermo Fisher Scientific).
22 x 40 mm, 1 mm thick glass slides, were cleaned with an argon plasma for 01:00:00 before 22x22 gaskets (Bio-Rad) were affixed to the surface to create a well.

1h
Cell lysate was diluted 1 in 10 with filtered PBS (0.02 μm) and added to the glass slides
100 nM DNA-aptamer was added to the glass slide and incubated with lysate for 00:10:00 .

Note
Aptamer sequence: GCCTGTGGTGTTGGGGCGGGTGCGTTACCACCACCACCACCACCA (ATD Bio)

10m
Sample was then washed off with filtered PBS three times before imaging
Microscopy imaging
SMLM was performed on a Nanoimager super-resolution microscope (Oxford Nanoimaging Ltd) equipped with an Olympus 1.4 NA 100x oil immersion super apochromatic objective.
To ensure efficient stochastic blinking for STORM (AF647-tagged phalloidin), the samples were incubated with a blinking induction buffer (B cubed, ONI).
Separately to this, AD-PAINT was also employed which relies on the addition of an imaging oligonucleotide strand

to the buffer. 1 nM of the imaging strand was added to the B cubed buffer before imaging.

Note
sequence: CCAGATGTAT-CY3B

The laser illumination angle was set to 51o for all imaging leading to total internal reflection fluorescence (TIRF).
AF647-tagged phalloidin was first imaged for 4000-8000 frames using the 640 nm laser (80% power). After this, 4000-5000 frames at 30% power for the 561 nm laser was used to image and super-resolve the aptamer. Both were recorded at a frame-rate of 50 ms.
For imaging aggregates in neuronal lysate using AD-PAINT, 2 nM of the imaging strand was added. Images were acquired on Oxford Nanoimager at 20 frames s-1, for 8000 frames (20% 635 nm laser power, TIRF).

Note
sequence: GGTGGT-ATTO 655